bowtie2: enable tests
This commit is contained in:
@@ -6,6 +6,8 @@
|
||||
, python3
|
||||
, tbb
|
||||
, zlib
|
||||
, runCommand
|
||||
, bowtie2
|
||||
}:
|
||||
|
||||
stdenv.mkDerivation (finalAttrs: {
|
||||
@@ -34,6 +36,20 @@ stdenv.mkDerivation (finalAttrs: {
|
||||
|
||||
cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"];
|
||||
|
||||
# ctest fails because of missing dependencies between tests
|
||||
doCheck = false;
|
||||
|
||||
passthru.tests = {
|
||||
ctest = runCommand "${finalAttrs.pname}-test" { } ''
|
||||
mkdir $out
|
||||
${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10
|
||||
${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small
|
||||
${bowtie2}/bin/bowtie2-inspect-s $out/small
|
||||
${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large
|
||||
${bowtie2}/bin/bowtie2-inspect-l $out/large
|
||||
'';
|
||||
};
|
||||
|
||||
meta = with lib; {
|
||||
description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";
|
||||
license = licenses.gpl3Plus;
|
||||
|
||||
Reference in New Issue
Block a user