From 056f9e21c08d2573a39d7ba3777bc968cb88ded5 Mon Sep 17 00:00:00 2001
From: natsukium <tomoya.otabi@gmail.com>
Date: Fri, 20 Oct 2023 17:08:20 +0900
Subject: [PATCH] bowtie2: enable tests

---
 .../science/biology/bowtie2/default.nix          | 16 ++++++++++++++++
 1 file changed, 16 insertions(+)

diff --git a/pkgs/applications/science/biology/bowtie2/default.nix b/pkgs/applications/science/biology/bowtie2/default.nix
index 268775fc0b34..356e90555f8d 100644
--- a/pkgs/applications/science/biology/bowtie2/default.nix
+++ b/pkgs/applications/science/biology/bowtie2/default.nix
@@ -6,6 +6,8 @@
 , python3
 , tbb
 , zlib
+, runCommand
+, bowtie2
 }:
 
 stdenv.mkDerivation (finalAttrs: {
@@ -34,6 +36,20 @@ stdenv.mkDerivation (finalAttrs: {
 
   cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"];
 
+  # ctest fails because of missing dependencies between tests
+  doCheck = false;
+
+  passthru.tests = {
+    ctest = runCommand "${finalAttrs.pname}-test" { } ''
+      mkdir $out
+      ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10
+      ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small
+      ${bowtie2}/bin/bowtie2-inspect-s $out/small
+      ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large
+      ${bowtie2}/bin/bowtie2-inspect-l $out/large
+    '';
+  };
+
   meta = with lib; {
     description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";
     license = licenses.gpl3Plus;