From 06c0ac52cc76e1f6ed91c18dc0f393d0839a10fc Mon Sep 17 00:00:00 2001 From: James Fargher Date: Mon, 10 Jul 2023 16:32:35 +1200 Subject: [PATCH 001/222] ckb-next: 0.5.0 -> 0.6.0 --- pkgs/tools/misc/ckb-next/default.nix | 12 +++++++----- 1 file changed, 7 insertions(+), 5 deletions(-) diff --git a/pkgs/tools/misc/ckb-next/default.nix b/pkgs/tools/misc/ckb-next/default.nix index efd581a06cbc..113ca0c07f0d 100644 --- a/pkgs/tools/misc/ckb-next/default.nix +++ b/pkgs/tools/misc/ckb-next/default.nix @@ -1,17 +1,17 @@ -{ lib, mkDerivation, fetchFromGitHub, substituteAll, udev, stdenv +{ lib, wrapQtAppsHook, fetchFromGitHub, substituteAll, udev, stdenv , pkg-config, qtbase, cmake, zlib, kmod, libXdmcp, qttools, qtx11extras, libdbusmenu -, withPulseaudio ? stdenv.isLinux, libpulseaudio +, withPulseaudio ? stdenv.isLinux, libpulseaudio, quazip }: -mkDerivation rec { - version = "0.5.0"; +stdenv.mkDerivation rec { + version = "0.6.0"; pname = "ckb-next"; src = fetchFromGitHub { owner = "ckb-next"; repo = "ckb-next"; rev = "v${version}"; - sha256 = "sha256-yR1myagAqavAR/7lPdufcrJpPmXW7r4N4pxTMF6NbuE="; + hash = "sha256-G0cvET3wMIi4FlBmaTkdTyYtcdVGzK4X0C2HYZr43eg="; }; buildInputs = [ @@ -22,9 +22,11 @@ mkDerivation rec { qttools qtx11extras libdbusmenu + quazip ] ++ lib.optional withPulseaudio libpulseaudio; nativeBuildInputs = [ + wrapQtAppsHook pkg-config cmake ]; From 8e25133afe16edd14c537a4fa6ab7c98715544bd Mon Sep 17 00:00:00 2001 From: Thomas Sowell Date: Thu, 15 Dec 2022 18:47:56 -0900 Subject: [PATCH 002/222] maintainers: add tsowell --- maintainers/maintainer-list.nix | 6 ++++++ 1 file changed, 6 insertions(+) diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix index 66056d6f8567..715714f89854 100644 --- a/maintainers/maintainer-list.nix +++ b/maintainers/maintainer-list.nix @@ -17564,6 +17564,12 @@ githubId = 15064765; name = "tshaynik"; }; + tsowell = { + email = "tom@ldtlb.com"; + github = "tsowell"; + githubId = 4044033; + name = "Thomas Sowell"; + }; ttuegel = { email = "ttuegel@mailbox.org"; github = "ttuegel"; From f0fcea2d55c6abfe3537f608bdcf789695b661d8 Mon Sep 17 00:00:00 2001 From: Thomas Sowell Date: Thu, 15 Dec 2022 19:53:00 -0900 Subject: [PATCH 003/222] evsieve: init at 1.3.1 --- pkgs/tools/inputmethods/evsieve/default.nix | 31 +++++++++++++++++++++ pkgs/top-level/all-packages.nix | 2 ++ 2 files changed, 33 insertions(+) create mode 100644 pkgs/tools/inputmethods/evsieve/default.nix diff --git a/pkgs/tools/inputmethods/evsieve/default.nix b/pkgs/tools/inputmethods/evsieve/default.nix new file mode 100644 index 000000000000..4497448cad12 --- /dev/null +++ b/pkgs/tools/inputmethods/evsieve/default.nix @@ -0,0 +1,31 @@ +{ lib +, fetchFromGitHub +, rustPlatform +, libevdev +}: + +rustPlatform.buildRustPackage rec { + pname = "evsieve"; + version = "1.3.1"; + + src = fetchFromGitHub { + owner = "KarsMulder"; + repo = "evsieve"; + rev = "v${version}"; + hash = "sha256-R/y3iyKGE4dzAyNnDwrMCr8JFshYJwNcgHQ8UbtuRj8="; + }; + + cargoHash = "sha256-jkm+mAHejCBZFalUbJNaIxtIl2kwnlPR2wsaYlcfSz8="; + + buildInputs = [ libevdev ]; + + doCheck = false; # unit tests create uinput devices + + meta = with lib; { + description = "A utility for mapping events from Linux event devices"; + homepage = "https://github.com/KarsMulder/evsieve"; + license = licenses.gpl2Plus; + maintainers = with maintainers; [ tsowell ]; + platforms = platforms.linux; + }; +} diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index 6b78843871d4..5f2ff7c96eae 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -6924,6 +6924,8 @@ with pkgs; evdevremapkeys = callPackage ../tools/inputmethods/evdevremapkeys { }; + evsieve = callPackage ../tools/inputmethods/evsieve { }; + eyedropper = callPackage ../applications/graphics/eyedropper { }; persistent-evdev = python3Packages.callPackage ../servers/persistent-evdev { }; From abb941f20b58942ea34829d860796d11a89a3dff Mon Sep 17 00:00:00 2001 From: Cezary Siwek Date: Mon, 11 Sep 2023 22:36:14 +0200 Subject: [PATCH 004/222] maintainers: add gray-heron --- maintainers/maintainer-list.nix | 6 ++++++ 1 file changed, 6 insertions(+) diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix index 8a468301ea5d..14a9a4481b29 100644 --- a/maintainers/maintainer-list.nix +++ b/maintainers/maintainer-list.nix @@ -6333,6 +6333,12 @@ githubId = 4656860; name = "Gaute Ravndal"; }; + gray-heron = { + email = "ave+nix@cezar.info"; + github = "gray-heron"; + githubId = 7032646; + name = "Cezary Siwek"; + }; graysonhead = { email = "grayson@graysonhead.net"; github = "graysonhead"; From 488029904f1479417c677527ee73b1457b37c4a6 Mon Sep 17 00:00:00 2001 From: Cezary Siwek Date: Tue, 12 Sep 2023 11:37:53 +0200 Subject: [PATCH 005/222] python3Packages.textparser: init at 0.24.0 --- .../python-modules/textparser/default.nix | 39 +++++++++++++++++++ pkgs/top-level/python-packages.nix | 2 + 2 files changed, 41 insertions(+) create mode 100644 pkgs/development/python-modules/textparser/default.nix diff --git a/pkgs/development/python-modules/textparser/default.nix b/pkgs/development/python-modules/textparser/default.nix new file mode 100644 index 000000000000..86c436ac21f9 --- /dev/null +++ b/pkgs/development/python-modules/textparser/default.nix @@ -0,0 +1,39 @@ +{ lib +, buildPythonPackage +, fetchPypi +, setuptools-scm +, pytestCheckHook +, pythonOlder +}: + +buildPythonPackage rec { + pname = "textparser"; + version = "0.24.0"; + format = "setuptools"; + + disabled = pythonOlder "3.7"; + + src = fetchPypi { + inherit pname version; + hash = "sha256-VvcI51qp0AKtt22CO6bvFm1+zsHj5MpMHKED+BdWgzU="; + }; + + nativeBuildInputs = [ + setuptools-scm + ]; + + nativeCheckInputs = [ + pytestCheckHook + ]; + + pythonImportsCheck = [ + "textparser" + ]; + + meta = with lib; { + homepage = "https://github.com/eerimoq/textparser"; + description = "A text parser"; + license = licenses.mit; + maintainers = with maintainers; [ gray-heron ]; + }; +} diff --git a/pkgs/top-level/python-packages.nix b/pkgs/top-level/python-packages.nix index 0c8b32b1e8b7..4ef9e6edb47f 100644 --- a/pkgs/top-level/python-packages.nix +++ b/pkgs/top-level/python-packages.nix @@ -12472,6 +12472,8 @@ self: super: with self; { textile = callPackage ../development/python-modules/textile { }; + textparser = callPackage ../development/python-modules/textparser { }; + textual = callPackage ../development/python-modules/textual { }; textual-universal-directorytree = callPackage ../development/python-modules/textual-universal-directorytree { }; From 52de239082e55f191b47ec2b959ec734432bb1bd Mon Sep 17 00:00:00 2001 From: Cezary Siwek Date: Tue, 12 Sep 2023 11:40:40 +0200 Subject: [PATCH 006/222] python3Packages.cantools: init at 38.0.2 --- .../python-modules/cantools/default.nix | 58 +++++++++++++++++++ pkgs/top-level/python-packages.nix | 2 + 2 files changed, 60 insertions(+) create mode 100644 pkgs/development/python-modules/cantools/default.nix diff --git a/pkgs/development/python-modules/cantools/default.nix b/pkgs/development/python-modules/cantools/default.nix new file mode 100644 index 000000000000..3cb260dd8d1b --- /dev/null +++ b/pkgs/development/python-modules/cantools/default.nix @@ -0,0 +1,58 @@ +{ lib +, buildPythonPackage +, fetchPypi +, setuptools-scm +, argparse-addons +, bitstruct +, can +, crccheck +, diskcache +, matplotlib +, parameterized +, pytestCheckHook +, pythonOlder +, textparser +}: + +buildPythonPackage rec { + pname = "cantools"; + version = "38.0.2"; + format = "setuptools"; + + disabled = pythonOlder "3.7"; + + src = fetchPypi { + inherit pname version; + hash = "sha256-k7/m9L1lLzaXY+qRYrAnpi9CSoQA8kI9QRN5GM5oxo4="; + }; + + nativeBuildInputs = [ + setuptools-scm + ]; + + propagatedBuildInputs = [ + argparse-addons + bitstruct + can + crccheck + diskcache + matplotlib + textparser + ]; + + nativeCheckInputs = [ + parameterized + pytestCheckHook + ]; + + pythonImportsCheck = [ + "cantools" + ]; + + meta = with lib; { + homepage = "https://github.com/cantools/cantools"; + description = "CAN bus tools."; + license = licenses.mit; + maintainers = with maintainers; [ gray-heron ]; + }; +} diff --git a/pkgs/top-level/python-packages.nix b/pkgs/top-level/python-packages.nix index 4ef9e6edb47f..779259175603 100644 --- a/pkgs/top-level/python-packages.nix +++ b/pkgs/top-level/python-packages.nix @@ -1685,6 +1685,8 @@ self: super: with self; { canopen = callPackage ../development/python-modules/canopen { }; + cantools = callPackage ../development/python-modules/cantools { }; + camelot = callPackage ../development/python-modules/camelot { }; capstone = callPackage ../development/python-modules/capstone { From 5dfa639d50260d6679db1b8cd6fa870d7b6ac042 Mon Sep 17 00:00:00 2001 From: illustris Date: Thu, 21 Sep 2023 13:01:19 +0530 Subject: [PATCH 007/222] hadoop: 3.3.5 -> 3.3.6, build container executor from source --- .../cluster/hadoop/containerExecutor.nix | 37 ++++++++ .../networking/cluster/hadoop/default.nix | 91 +++++++++++-------- pkgs/top-level/all-packages.nix | 4 +- 3 files changed, 91 insertions(+), 41 deletions(-) create mode 100644 pkgs/applications/networking/cluster/hadoop/containerExecutor.nix diff --git a/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix b/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix new file mode 100644 index 000000000000..69b25784be67 --- /dev/null +++ b/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix @@ -0,0 +1,37 @@ +{ version, hash, stdenv, fetchurl, lib, cmake, openssl, platformAttrs, ... }: + +stdenv.mkDerivation (finalAttrs: { + pname = "hadoop-yarn-containerexecutor"; + inherit version; + + src = fetchurl { + url = with finalAttrs; "mirror://apache/hadoop/common/hadoop-${finalAttrs.version}/hadoop-${finalAttrs.version}-src.tar.gz"; + inherit hash; + }; + sourceRoot = "hadoop-${finalAttrs.version}-src/hadoop-yarn-project/hadoop-yarn/" + +"hadoop-yarn-server/hadoop-yarn-server-nodemanager/src"; + + nativeBuildInputs = [ cmake ]; + buildInputs = [ openssl ]; + cmakeFlags = [ "-DHADOOP_CONF_DIR=/run/wrappers/yarn-nodemanager/etc/hadoop" ]; + + installPhase = '' + mkdir $out + mv target/var/empty/local/bin $out/ + ''; + + meta = with lib; { + homepage = "https://hadoop.apache.org/"; + description = "Framework for distributed processing of large data sets across clusters of computers"; + license = licenses.asl20; + + longDescription = '' + The Hadoop YARN Container Executor is a native component responsible for managing the lifecycle of containers + on individual nodes in a Hadoop YARN cluster. It launches, monitors, and terminates containers, ensuring that + resources like CPU and memory are allocated according to the policies defined in the ResourceManager. + ''; + + maintainers = with maintainers; [ illustris ]; + platforms = attrNames platformAttrs; + }; +}) diff --git a/pkgs/applications/networking/cluster/hadoop/default.nix b/pkgs/applications/networking/cluster/hadoop/default.nix index 65512de2031b..7fb71069c76c 100644 --- a/pkgs/applications/networking/cluster/hadoop/default.nix +++ b/pkgs/applications/networking/cluster/hadoop/default.nix @@ -19,6 +19,8 @@ , nixosTests , sparkSupport ? true , spark +, libtirpc +, callPackage }: with lib; @@ -26,40 +28,49 @@ with lib; assert elem stdenv.system [ "x86_64-linux" "x86_64-darwin" "aarch64-linux" "aarch64-darwin" ]; let - common = { pname, platformAttrs, untarDir ? "${pname}-${version}", jdk, openssl ? null, nativeLibs ? [ ], libPatches ? "", tests }: - stdenv.mkDerivation rec { - inherit pname jdk libPatches untarDir openssl; + common = { pname, platformAttrs, untarDir ? "${pname}-${version}", jdk, openssl ? null, nativeLibs ? [ ], libPatchesGenerator ? (_: ""), tests }: + stdenv.mkDerivation (finalAttrs: { + inherit pname jdk untarDir openssl; + libPatches = libPatchesGenerator finalAttrs; version = platformAttrs.${stdenv.system}.version or (throw "Unsupported system: ${stdenv.system}"); src = fetchurl { - url = "mirror://apache/hadoop/common/hadoop-${version}/hadoop-${version}" + optionalString stdenv.isAarch64 "-aarch64" + ".tar.gz"; + url = "mirror://apache/hadoop/common/hadoop-${finalAttrs.version}/hadoop-${finalAttrs.version}" + optionalString stdenv.isAarch64 "-aarch64" + ".tar.gz"; inherit (platformAttrs.${stdenv.system}) hash; }; doCheck = true; + # Build the container executor binary from source + containerExecutor = callPackage ./containerExecutor.nix { + inherit (finalAttrs) version; + inherit platformAttrs; + hash = platformAttrs.${stdenv.system}.srcHash; + }; + nativeBuildInputs = [ makeWrapper ] - ++ optionals (stdenv.isLinux && (nativeLibs != [ ] || libPatches != "")) [ autoPatchelfHook ]; + ++ optionals (stdenv.isLinux && (nativeLibs != [ ] || (libPatches finalAttrs) != "")) [ autoPatchelfHook ]; buildInputs = [ openssl ] ++ nativeLibs; installPhase = '' - mkdir -p $out/{lib/${untarDir}/conf,bin,lib} - mv * $out/lib/${untarDir} + mkdir -p $out/{lib/${finalAttrs.untarDir}/conf,bin,lib} + mv * $out/lib/${finalAttrs.untarDir} '' + optionalString stdenv.isLinux '' - # All versions need container-executor, but some versions can't use autoPatchelf because of broken SSL versions - patchelf --set-interpreter ${glibc.out}/lib64/ld-linux-x86-64.so.2 $out/lib/${untarDir}/bin/container-executor + for n in $(find ${finalAttrs.containerExecutor}/bin -type f); do + ln -sf "$n" $out/lib/${finalAttrs.untarDir}/bin + done '' + '' - for n in $(find $out/lib/${untarDir}/bin -type f ! -name "*.*"); do + for n in $(find $out/lib/${finalAttrs.untarDir}/bin -type f ! -name "*.*"); do makeWrapper "$n" "$out/bin/$(basename $n)"\ - --set-default JAVA_HOME ${jdk.home}\ - --set-default HADOOP_HOME $out/lib/${untarDir}\ + --set-default JAVA_HOME ${finalAttrs.jdk.home}\ + --set-default HADOOP_HOME $out/lib/${finalAttrs.untarDir}\ --run "test -d /etc/hadoop-conf && export HADOOP_CONF_DIR=\''${HADOOP_CONF_DIR-'/etc/hadoop-conf/'}"\ - --set-default HADOOP_CONF_DIR $out/lib/${untarDir}/etc/hadoop/\ + --set-default HADOOP_CONF_DIR $out/lib/${finalAttrs.untarDir}/etc/hadoop/\ --prefix PATH : "${makeBinPath [ bash coreutils which]}"\ - --prefix JAVA_LIBRARY_PATH : "${makeLibraryPath buildInputs}" + --prefix JAVA_LIBRARY_PATH : "${makeLibraryPath finalAttrs.buildInputs}" done '' + optionalString sparkSupport '' # Add the spark shuffle service jar to YARN - cp ${spark.src}/yarn/spark-${spark.version}-yarn-shuffle.jar $out/lib/${untarDir}/share/hadoop/yarn/ - '' + libPatches; + cp ${spark.src}/yarn/spark-${spark.version}-yarn-shuffle.jar $out/lib/${finalAttrs.untarDir}/share/hadoop/yarn/ + '' + (finalAttrs.libPatches); passthru = { inherit tests; }; @@ -83,7 +94,7 @@ let maintainers = with maintainers; [ illustris ]; platforms = attrNames platformAttrs; } (attrByPath [ stdenv.system "meta" ] {} platformAttrs); - }; + }); in { # Different version of hadoop support different java runtime versions @@ -91,37 +102,39 @@ in hadoop_3_3 = common rec { pname = "hadoop"; platformAttrs = rec { - x86_64-linux = { - version = "3.3.5"; - hash = "sha256-RG4FypL6I6YGF6ixeUbe3kcoGvFQQEFhfLfV9i50JSo="; - }; - x86_64-darwin = x86_64-linux; - aarch64-linux = { - version = "3.3.5"; - hash = "sha256-qcKjbE881isauWBxIv+NY0UFbYit704/Re8Kdl6x1LA="; - }; - aarch64-darwin = aarch64-linux; + x86_64-linux = { + version = "3.3.6"; + hash = "sha256-9RlQWcDUECrap//xf3sqhd+Qa8tuGZSHFjGfmXhkGgQ="; + srcHash = "sha256-4OEsVhBNV9CJ+PN4FgCduUCVA9/el5yezSCZ6ko3+bU="; + }; + x86_64-darwin = x86_64-linux; + aarch64-linux = x86_64-linux // { + hash = "sha256-5Lv2uA72BJEva5v2yncyPe5gKNCNOPNsoHffVt6KXQ0="; + }; + aarch64-darwin = aarch64-linux; }; untarDir = "${pname}-${platformAttrs.${stdenv.system}.version}"; jdk = jdk11_headless; inherit openssl; # TODO: Package and add Intel Storage Acceleration Library - nativeLibs = [ stdenv.cc.cc.lib protobuf zlib snappy ]; - libPatches = '' - ln -s ${getLib cyrus_sasl}/lib/libsasl2.so $out/lib/${untarDir}/lib/native/libsasl2.so.2 - ln -s ${getLib openssl}/lib/libcrypto.so $out/lib/${untarDir}/lib/native/ - ln -s ${getLib zlib}/lib/libz.so.1 $out/lib/${untarDir}/lib/native/ - ln -s ${getLib zstd}/lib/libzstd.so.1 $out/lib/${untarDir}/lib/native/ - ln -s ${getLib bzip2}/lib/libbz2.so.1 $out/lib/${untarDir}/lib/native/ + nativeLibs = [ stdenv.cc.cc.lib protobuf zlib snappy libtirpc ]; + libPatchesGenerator = finalAttrs: ('' + ln -s ${getLib cyrus_sasl}/lib/libsasl2.so $out/lib/${finalAttrs.untarDir}/lib/native/libsasl2.so.2 + ln -s ${getLib openssl}/lib/libcrypto.so $out/lib/${finalAttrs.untarDir}/lib/native/ + ln -s ${getLib zlib}/lib/libz.so.1 $out/lib/${finalAttrs.untarDir}/lib/native/ + ln -s ${getLib zstd}/lib/libzstd.so.1 $out/lib/${finalAttrs.untarDir}/lib/native/ + ln -s ${getLib bzip2}/lib/libbz2.so.1 $out/lib/${finalAttrs.untarDir}/lib/native/ '' + optionalString stdenv.isLinux '' # libjvm.so for Java >=11 - patchelf --add-rpath ${jdk.home}/lib/server $out/lib/${untarDir}/lib/native/libnativetask.so.1.0.0 + patchelf --add-rpath ${finalAttrs.jdk.home}/lib/server $out/lib/${finalAttrs.untarDir}/lib/native/libnativetask.so.1.0.0 # Java 8 has libjvm.so at a different path - patchelf --add-rpath ${jdk.home}/jre/lib/amd64/server $out/lib/${untarDir}/lib/native/libnativetask.so.1.0.0 + patchelf --add-rpath ${finalAttrs.jdk.home}/jre/lib/amd64/server $out/lib/${finalAttrs.untarDir}/lib/native/libnativetask.so.1.0.0 # NixOS/nixpkgs#193370 # This workaround is needed to use protobuf 3.19 - patchelf --replace-needed libprotobuf.so.18 libprotobuf.so $out/lib/${untarDir}/lib/native/libhdfspp.so - ''; + patchelf --replace-needed libprotobuf.so.18 libprotobuf.so $out/lib/${finalAttrs.untarDir}/lib/native/libhdfspp.so + patchelf --replace-needed libcrypto.so.1.1 libcrypto.so \ + $out/lib/${finalAttrs.untarDir}/lib/native/{libhdfspp.so.0.1.0,examples/{pipes-sort,wordcount-nopipe,wordcount-part,wordcount-simple}} + ''); tests = nixosTests.hadoop; }; hadoop_3_2 = common rec { @@ -129,6 +142,7 @@ in platformAttrs.x86_64-linux = { version = "3.2.4"; hash = "sha256-qt2gpMr+NHuiVR+/zFRzRyRKG725/ZNBIM69z9J9wNw="; + srcHash = "sha256-F9nGD3mZZ1eJf3Ec3AJGE9YBcL/HiagskcdKQhCn/sw="; }; jdk = jdk8_headless; # not using native libs because of broken openssl_1_0_2 dependency @@ -140,6 +154,7 @@ in platformAttrs.x86_64-linux = { version = "2.10.2"; hash = "sha256-xhA4zxqIRGNhIeBnJO9dLKf/gx/Bq+uIyyZwsIafEyo="; + srcHash = "sha256-ucxCyXiJo8aL6aNMhZgKEbn8sGKOoMPVREbMGSfSdAI="; }; jdk = jdk8_headless; tests = nixosTests.hadoop2; diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index 237846ef28c9..cbed132677bf 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -17869,9 +17869,7 @@ with pkgs; groovy = callPackage ../development/interpreters/groovy { }; - inherit (callPackages ../applications/networking/cluster/hadoop { - openssl = openssl_1_1; - }) + inherit (callPackages ../applications/networking/cluster/hadoop {}) hadoop_3_3 hadoop_3_2 hadoop2; From 9be640a232166f14be4d38145970ffd63623c4d7 Mon Sep 17 00:00:00 2001 From: illustris Date: Fri, 22 Sep 2023 14:41:24 +0530 Subject: [PATCH 008/222] hadoop: support native libs on 3.2 --- .../networking/cluster/hadoop/default.nix | 56 ++++++++++--------- 1 file changed, 31 insertions(+), 25 deletions(-) diff --git a/pkgs/applications/networking/cluster/hadoop/default.nix b/pkgs/applications/networking/cluster/hadoop/default.nix index 7fb71069c76c..481217b44a84 100644 --- a/pkgs/applications/networking/cluster/hadoop/default.nix +++ b/pkgs/applications/networking/cluster/hadoop/default.nix @@ -28,13 +28,17 @@ with lib; assert elem stdenv.system [ "x86_64-linux" "x86_64-darwin" "aarch64-linux" "aarch64-darwin" ]; let - common = { pname, platformAttrs, untarDir ? "${pname}-${version}", jdk, openssl ? null, nativeLibs ? [ ], libPatchesGenerator ? (_: ""), tests }: + common = { + pname, platformAttrs, untarDir ? "${pname}-${version}", jdk + , nativeLibs ? [ ], libPatchesGenerator ? (_: ""), tests + }: stdenv.mkDerivation (finalAttrs: { - inherit pname jdk untarDir openssl; + inherit pname jdk untarDir; libPatches = libPatchesGenerator finalAttrs; version = platformAttrs.${stdenv.system}.version or (throw "Unsupported system: ${stdenv.system}"); src = fetchurl { - url = "mirror://apache/hadoop/common/hadoop-${finalAttrs.version}/hadoop-${finalAttrs.version}" + optionalString stdenv.isAarch64 "-aarch64" + ".tar.gz"; + url = "mirror://apache/hadoop/common/hadoop-${finalAttrs.version}/hadoop-${finalAttrs.version}" + + optionalString stdenv.isAarch64 "-aarch64" + ".tar.gz"; inherit (platformAttrs.${stdenv.system}) hash; }; doCheck = true; @@ -95,6 +99,27 @@ let platforms = attrNames platformAttrs; } (attrByPath [ stdenv.system "meta" ] {} platformAttrs); }); + nativeLibs = [ stdenv.cc.cc.lib protobuf zlib snappy libtirpc ]; + libPatchesGenerator = finalAttrs: ('' + ln -s ${getLib cyrus_sasl}/lib/libsasl2.so $out/lib/${finalAttrs.untarDir}/lib/native/libsasl2.so.2 + ln -s ${getLib openssl}/lib/libcrypto.so $out/lib/${finalAttrs.untarDir}/lib/native/ + ln -s ${getLib zlib}/lib/libz.so.1 $out/lib/${finalAttrs.untarDir}/lib/native/ + ln -s ${getLib zstd}/lib/libzstd.so.1 $out/lib/${finalAttrs.untarDir}/lib/native/ + ln -s ${getLib bzip2}/lib/libbz2.so.1 $out/lib/${finalAttrs.untarDir}/lib/native/ + '' + optionalString stdenv.isLinux '' + # libjvm.so for Java >=11 + patchelf --add-rpath ${finalAttrs.jdk.home}/lib/server $out/lib/${finalAttrs.untarDir}/lib/native/libnativetask.so.1.0.0 + # Java 8 has libjvm.so at a different path + patchelf --add-rpath ${finalAttrs.jdk.home}/jre/lib/amd64/server $out/lib/${finalAttrs.untarDir}/lib/native/libnativetask.so.1.0.0 + # NixOS/nixpkgs#193370 + # This workaround is needed to use protobuf 3.19 + # for hadoop 3.3 + patchelf --replace-needed libprotobuf.so.18 libprotobuf.so $out/lib/${finalAttrs.untarDir}/lib/native/libhdfspp.so + # for hadoop 3.2 + patchelf --replace-needed libprotobuf.so.8 libprotobuf.so $out/lib/${finalAttrs.untarDir}/lib/native/libhdfspp.so + patchelf --replace-needed libcrypto.so.1.1 libcrypto.so \ + $out/lib/${finalAttrs.untarDir}/lib/native/{libhdfspp.so.0.1.0,examples/{pipes-sort,wordcount-nopipe,wordcount-part,wordcount-simple}} + ''); in { # Different version of hadoop support different java runtime versions @@ -115,29 +140,11 @@ in }; untarDir = "${pname}-${platformAttrs.${stdenv.system}.version}"; jdk = jdk11_headless; - inherit openssl; + inherit nativeLibs libPatchesGenerator; # TODO: Package and add Intel Storage Acceleration Library - nativeLibs = [ stdenv.cc.cc.lib protobuf zlib snappy libtirpc ]; - libPatchesGenerator = finalAttrs: ('' - ln -s ${getLib cyrus_sasl}/lib/libsasl2.so $out/lib/${finalAttrs.untarDir}/lib/native/libsasl2.so.2 - ln -s ${getLib openssl}/lib/libcrypto.so $out/lib/${finalAttrs.untarDir}/lib/native/ - ln -s ${getLib zlib}/lib/libz.so.1 $out/lib/${finalAttrs.untarDir}/lib/native/ - ln -s ${getLib zstd}/lib/libzstd.so.1 $out/lib/${finalAttrs.untarDir}/lib/native/ - ln -s ${getLib bzip2}/lib/libbz2.so.1 $out/lib/${finalAttrs.untarDir}/lib/native/ - '' + optionalString stdenv.isLinux '' - # libjvm.so for Java >=11 - patchelf --add-rpath ${finalAttrs.jdk.home}/lib/server $out/lib/${finalAttrs.untarDir}/lib/native/libnativetask.so.1.0.0 - # Java 8 has libjvm.so at a different path - patchelf --add-rpath ${finalAttrs.jdk.home}/jre/lib/amd64/server $out/lib/${finalAttrs.untarDir}/lib/native/libnativetask.so.1.0.0 - # NixOS/nixpkgs#193370 - # This workaround is needed to use protobuf 3.19 - patchelf --replace-needed libprotobuf.so.18 libprotobuf.so $out/lib/${finalAttrs.untarDir}/lib/native/libhdfspp.so - patchelf --replace-needed libcrypto.so.1.1 libcrypto.so \ - $out/lib/${finalAttrs.untarDir}/lib/native/{libhdfspp.so.0.1.0,examples/{pipes-sort,wordcount-nopipe,wordcount-part,wordcount-simple}} - ''); tests = nixosTests.hadoop; }; - hadoop_3_2 = common rec { + hadoop_3_2 = common { pname = "hadoop"; platformAttrs.x86_64-linux = { version = "3.2.4"; @@ -145,8 +152,7 @@ in srcHash = "sha256-F9nGD3mZZ1eJf3Ec3AJGE9YBcL/HiagskcdKQhCn/sw="; }; jdk = jdk8_headless; - # not using native libs because of broken openssl_1_0_2 dependency - # can be manually overridden + inherit nativeLibs libPatchesGenerator; tests = nixosTests.hadoop_3_2; }; hadoop2 = common rec { From 1cd3c804bf4644fc168883c15b60baf596aba4fc Mon Sep 17 00:00:00 2001 From: illustris Date: Fri, 22 Sep 2023 16:34:07 +0530 Subject: [PATCH 009/222] hadoop, nixos/hadoop: remove untarDir --- .../services/cluster/hadoop/default.nix | 18 ++++---- .../modules/services/cluster/hadoop/yarn.nix | 2 +- nixos/tests/hadoop/hadoop.nix | 2 +- .../networking/cluster/hadoop/default.nix | 45 +++++++++---------- 4 files changed, 33 insertions(+), 34 deletions(-) diff --git a/nixos/modules/services/cluster/hadoop/default.nix b/nixos/modules/services/cluster/hadoop/default.nix index 72bf25c21146..ff6b4d5588b1 100644 --- a/nixos/modules/services/cluster/hadoop/default.nix +++ b/nixos/modules/services/cluster/hadoop/default.nix @@ -67,16 +67,16 @@ with lib; mapredSiteDefault = mkOption { default = { "mapreduce.framework.name" = "yarn"; - "yarn.app.mapreduce.am.env" = "HADOOP_MAPRED_HOME=${cfg.package}/lib/${cfg.package.untarDir}"; - "mapreduce.map.env" = "HADOOP_MAPRED_HOME=${cfg.package}/lib/${cfg.package.untarDir}"; - "mapreduce.reduce.env" = "HADOOP_MAPRED_HOME=${cfg.package}/lib/${cfg.package.untarDir}"; + "yarn.app.mapreduce.am.env" = "HADOOP_MAPRED_HOME=${cfg.package}"; + "mapreduce.map.env" = "HADOOP_MAPRED_HOME=${cfg.package}"; + "mapreduce.reduce.env" = "HADOOP_MAPRED_HOME=${cfg.package}"; }; defaultText = literalExpression '' { "mapreduce.framework.name" = "yarn"; - "yarn.app.mapreduce.am.env" = "HADOOP_MAPRED_HOME=''${config.${opt.package}}/lib/''${config.${opt.package}.untarDir}"; - "mapreduce.map.env" = "HADOOP_MAPRED_HOME=''${config.${opt.package}}/lib/''${config.${opt.package}.untarDir}"; - "mapreduce.reduce.env" = "HADOOP_MAPRED_HOME=''${config.${opt.package}}/lib/''${config.${opt.package}.untarDir}"; + "yarn.app.mapreduce.am.env" = "HADOOP_MAPRED_HOME=''${config.${opt.package}}"; + "mapreduce.map.env" = "HADOOP_MAPRED_HOME=''${config.${opt.package}}"; + "mapreduce.reduce.env" = "HADOOP_MAPRED_HOME=''${config.${opt.package}}"; } ''; type = types.attrsOf types.anything; @@ -154,13 +154,13 @@ with lib; }; log4jProperties = mkOption { - default = "${cfg.package}/lib/${cfg.package.untarDir}/etc/hadoop/log4j.properties"; + default = "${cfg.package}/etc/hadoop/log4j.properties"; defaultText = literalExpression '' - "''${config.${opt.package}}/lib/''${config.${opt.package}.untarDir}/etc/hadoop/log4j.properties" + "''${config.${opt.package}}/etc/hadoop/log4j.properties" ''; type = types.path; example = literalExpression '' - "''${pkgs.hadoop}/lib/''${pkgs.hadoop.untarDir}/etc/hadoop/log4j.properties"; + "''${pkgs.hadoop}/etc/hadoop/log4j.properties"; ''; description = lib.mdDoc "log4j.properties file added to HADOOP_CONF_DIR"; }; diff --git a/nixos/modules/services/cluster/hadoop/yarn.nix b/nixos/modules/services/cluster/hadoop/yarn.nix index 26077f35fdd0..a49aafbd1dca 100644 --- a/nixos/modules/services/cluster/hadoop/yarn.nix +++ b/nixos/modules/services/cluster/hadoop/yarn.nix @@ -160,7 +160,7 @@ in umount /run/wrappers/yarn-nodemanager/cgroup/cpu || true rm -rf /run/wrappers/yarn-nodemanager/ || true mkdir -p /run/wrappers/yarn-nodemanager/{bin,etc/hadoop,cgroup/cpu} - cp ${cfg.package}/lib/${cfg.package.untarDir}/bin/container-executor /run/wrappers/yarn-nodemanager/bin/ + cp ${cfg.package}/bin/container-executor /run/wrappers/yarn-nodemanager/bin/ chgrp hadoop /run/wrappers/yarn-nodemanager/bin/container-executor chmod 6050 /run/wrappers/yarn-nodemanager/bin/container-executor cp ${hadoopConf}/container-executor.cfg /run/wrappers/yarn-nodemanager/etc/hadoop/ diff --git a/nixos/tests/hadoop/hadoop.nix b/nixos/tests/hadoop/hadoop.nix index b132f4fa58b0..0de2366b1864 100644 --- a/nixos/tests/hadoop/hadoop.nix +++ b/nixos/tests/hadoop/hadoop.nix @@ -249,7 +249,7 @@ import ../make-test-python.nix ({ package, ... }: { assert "standby" in client.succeed("sudo -u yarn yarn rmadmin -getAllServiceState") client.succeed("sudo -u yarn yarn rmadmin -getAllServiceState | systemd-cat") - assert "Estimated value of Pi is" in client.succeed("HADOOP_USER_NAME=hdfs yarn jar $(readlink $(which yarn) | sed -r 's~bin/yarn~lib/hadoop-*/share/hadoop/mapreduce/hadoop-mapreduce-examples-*.jar~g') pi 2 10") + assert "Estimated value of Pi is" in client.succeed("HADOOP_USER_NAME=hdfs yarn jar $(readlink $(which yarn) | sed -r 's~bin/yarn~share/hadoop/mapreduce/hadoop-mapreduce-examples-*.jar~g') pi 2 10") assert "SUCCEEDED" in client.succeed("yarn application -list -appStates FINISHED") ''; }) diff --git a/pkgs/applications/networking/cluster/hadoop/default.nix b/pkgs/applications/networking/cluster/hadoop/default.nix index 481217b44a84..b952331a23b6 100644 --- a/pkgs/applications/networking/cluster/hadoop/default.nix +++ b/pkgs/applications/networking/cluster/hadoop/default.nix @@ -29,11 +29,11 @@ assert elem stdenv.system [ "x86_64-linux" "x86_64-darwin" "aarch64-linux" "aarc let common = { - pname, platformAttrs, untarDir ? "${pname}-${version}", jdk - , nativeLibs ? [ ], libPatchesGenerator ? (_: ""), tests + pname, platformAttrs, jdk, nativeLibs ? [ ] + , libPatchesGenerator ? (_: ""), tests }: stdenv.mkDerivation (finalAttrs: { - inherit pname jdk untarDir; + inherit pname jdk; libPatches = libPatchesGenerator finalAttrs; version = platformAttrs.${stdenv.system}.version or (throw "Unsupported system: ${stdenv.system}"); src = fetchurl { @@ -51,29 +51,29 @@ let }; nativeBuildInputs = [ makeWrapper ] - ++ optionals (stdenv.isLinux && (nativeLibs != [ ] || (libPatches finalAttrs) != "")) [ autoPatchelfHook ]; + ++ optionals (stdenv.isLinux && (nativeLibs != [ ] || (libPatchesGenerator finalAttrs) != "")) [ autoPatchelfHook ]; buildInputs = [ openssl ] ++ nativeLibs; installPhase = '' - mkdir -p $out/{lib/${finalAttrs.untarDir}/conf,bin,lib} - mv * $out/lib/${finalAttrs.untarDir} + mkdir $out + mv * $out/ '' + optionalString stdenv.isLinux '' for n in $(find ${finalAttrs.containerExecutor}/bin -type f); do - ln -sf "$n" $out/lib/${finalAttrs.untarDir}/bin + ln -sf "$n" $out/bin done '' + '' - for n in $(find $out/lib/${finalAttrs.untarDir}/bin -type f ! -name "*.*"); do - makeWrapper "$n" "$out/bin/$(basename $n)"\ + for n in $(find $out/bin -type f ! -name "*.*"); do + wrapProgram "$n"\ --set-default JAVA_HOME ${finalAttrs.jdk.home}\ - --set-default HADOOP_HOME $out/lib/${finalAttrs.untarDir}\ + --set-default HADOOP_HOME $out/\ --run "test -d /etc/hadoop-conf && export HADOOP_CONF_DIR=\''${HADOOP_CONF_DIR-'/etc/hadoop-conf/'}"\ - --set-default HADOOP_CONF_DIR $out/lib/${finalAttrs.untarDir}/etc/hadoop/\ + --set-default HADOOP_CONF_DIR $out/etc/hadoop/\ --prefix PATH : "${makeBinPath [ bash coreutils which]}"\ --prefix JAVA_LIBRARY_PATH : "${makeLibraryPath finalAttrs.buildInputs}" done '' + optionalString sparkSupport '' # Add the spark shuffle service jar to YARN - cp ${spark.src}/yarn/spark-${spark.version}-yarn-shuffle.jar $out/lib/${finalAttrs.untarDir}/share/hadoop/yarn/ + cp ${spark.src}/yarn/spark-${spark.version}-yarn-shuffle.jar $out/share/hadoop/yarn/ '' + (finalAttrs.libPatches); passthru = { inherit tests; }; @@ -101,24 +101,24 @@ let }); nativeLibs = [ stdenv.cc.cc.lib protobuf zlib snappy libtirpc ]; libPatchesGenerator = finalAttrs: ('' - ln -s ${getLib cyrus_sasl}/lib/libsasl2.so $out/lib/${finalAttrs.untarDir}/lib/native/libsasl2.so.2 - ln -s ${getLib openssl}/lib/libcrypto.so $out/lib/${finalAttrs.untarDir}/lib/native/ - ln -s ${getLib zlib}/lib/libz.so.1 $out/lib/${finalAttrs.untarDir}/lib/native/ - ln -s ${getLib zstd}/lib/libzstd.so.1 $out/lib/${finalAttrs.untarDir}/lib/native/ - ln -s ${getLib bzip2}/lib/libbz2.so.1 $out/lib/${finalAttrs.untarDir}/lib/native/ + ln -s ${getLib cyrus_sasl}/lib/libsasl2.so $out/lib/native/libsasl2.so.2 + ln -s ${getLib openssl}/lib/libcrypto.so $out/lib/native/ + ln -s ${getLib zlib}/lib/libz.so.1 $out/lib/native/ + ln -s ${getLib zstd}/lib/libzstd.so.1 $out/lib/native/ + ln -s ${getLib bzip2}/lib/libbz2.so.1 $out/lib/native/ '' + optionalString stdenv.isLinux '' # libjvm.so for Java >=11 - patchelf --add-rpath ${finalAttrs.jdk.home}/lib/server $out/lib/${finalAttrs.untarDir}/lib/native/libnativetask.so.1.0.0 + patchelf --add-rpath ${finalAttrs.jdk.home}/lib/server $out/lib/native/libnativetask.so.1.0.0 # Java 8 has libjvm.so at a different path - patchelf --add-rpath ${finalAttrs.jdk.home}/jre/lib/amd64/server $out/lib/${finalAttrs.untarDir}/lib/native/libnativetask.so.1.0.0 + patchelf --add-rpath ${finalAttrs.jdk.home}/jre/lib/amd64/server $out/lib/native/libnativetask.so.1.0.0 # NixOS/nixpkgs#193370 # This workaround is needed to use protobuf 3.19 # for hadoop 3.3 - patchelf --replace-needed libprotobuf.so.18 libprotobuf.so $out/lib/${finalAttrs.untarDir}/lib/native/libhdfspp.so + patchelf --replace-needed libprotobuf.so.18 libprotobuf.so $out/lib/native/libhdfspp.so # for hadoop 3.2 - patchelf --replace-needed libprotobuf.so.8 libprotobuf.so $out/lib/${finalAttrs.untarDir}/lib/native/libhdfspp.so + patchelf --replace-needed libprotobuf.so.8 libprotobuf.so $out/lib/native/libhdfspp.so patchelf --replace-needed libcrypto.so.1.1 libcrypto.so \ - $out/lib/${finalAttrs.untarDir}/lib/native/{libhdfspp.so.0.1.0,examples/{pipes-sort,wordcount-nopipe,wordcount-part,wordcount-simple}} + $out/lib/native/{libhdfspp.so.0.1.0,examples/{pipes-sort,wordcount-nopipe,wordcount-part,wordcount-simple}} ''); in { @@ -138,7 +138,6 @@ in }; aarch64-darwin = aarch64-linux; }; - untarDir = "${pname}-${platformAttrs.${stdenv.system}.version}"; jdk = jdk11_headless; inherit nativeLibs libPatchesGenerator; # TODO: Package and add Intel Storage Acceleration Library From ef4843339891c10edb550368ae77446441321f28 Mon Sep 17 00:00:00 2001 From: illustris Date: Sun, 24 Sep 2023 00:35:22 +0530 Subject: [PATCH 010/222] hadoop: add native libs support in all versions --- .../cluster/hadoop/containerExecutor.nix | 4 +- .../networking/cluster/hadoop/default.nix | 64 +++++++++---------- 2 files changed, 33 insertions(+), 35 deletions(-) diff --git a/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix b/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix index 69b25784be67..3845026fd4a3 100644 --- a/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix +++ b/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix @@ -1,4 +1,4 @@ -{ version, hash, stdenv, fetchurl, lib, cmake, openssl, platformAttrs, ... }: +{ version, stdenv, fetchurl, lib, cmake, openssl, platformAttrs, ... }: stdenv.mkDerivation (finalAttrs: { pname = "hadoop-yarn-containerexecutor"; @@ -6,7 +6,7 @@ stdenv.mkDerivation (finalAttrs: { src = fetchurl { url = with finalAttrs; "mirror://apache/hadoop/common/hadoop-${finalAttrs.version}/hadoop-${finalAttrs.version}-src.tar.gz"; - inherit hash; + hash = platformAttrs.${stdenv.system}.srcHash; }; sourceRoot = "hadoop-${finalAttrs.version}-src/hadoop-yarn-project/hadoop-yarn/" +"hadoop-yarn-server/hadoop-yarn-server-nodemanager/src"; diff --git a/pkgs/applications/networking/cluster/hadoop/default.nix b/pkgs/applications/networking/cluster/hadoop/default.nix index b952331a23b6..f90ec32177c4 100644 --- a/pkgs/applications/networking/cluster/hadoop/default.nix +++ b/pkgs/applications/networking/cluster/hadoop/default.nix @@ -28,13 +28,9 @@ with lib; assert elem stdenv.system [ "x86_64-linux" "x86_64-darwin" "aarch64-linux" "aarch64-darwin" ]; let - common = { - pname, platformAttrs, jdk, nativeLibs ? [ ] - , libPatchesGenerator ? (_: ""), tests - }: + common = { pname, platformAttrs, jdk, tests }: stdenv.mkDerivation (finalAttrs: { inherit pname jdk; - libPatches = libPatchesGenerator finalAttrs; version = platformAttrs.${stdenv.system}.version or (throw "Unsupported system: ${stdenv.system}"); src = fetchurl { url = "mirror://apache/hadoop/common/hadoop-${finalAttrs.version}/hadoop-${finalAttrs.version}" @@ -47,12 +43,11 @@ let containerExecutor = callPackage ./containerExecutor.nix { inherit (finalAttrs) version; inherit platformAttrs; - hash = platformAttrs.${stdenv.system}.srcHash; }; nativeBuildInputs = [ makeWrapper ] - ++ optionals (stdenv.isLinux && (nativeLibs != [ ] || (libPatchesGenerator finalAttrs) != "")) [ autoPatchelfHook ]; - buildInputs = [ openssl ] ++ nativeLibs; + ++ optionals stdenv.isLinux [ autoPatchelfHook ]; + buildInputs = [ stdenv.cc.cc.lib openssl protobuf zlib snappy libtirpc ]; installPhase = '' mkdir $out @@ -61,6 +56,32 @@ let for n in $(find ${finalAttrs.containerExecutor}/bin -type f); do ln -sf "$n" $out/bin done + + # these libraries are loaded at runtime by the JVM + ln -s ${getLib cyrus_sasl}/lib/libsasl2.so $out/lib/native/libsasl2.so.2 + ln -s ${getLib openssl}/lib/libcrypto.so $out/lib/native/ + ln -s ${getLib zlib}/lib/libz.so.1 $out/lib/native/ + ln -s ${getLib zstd}/lib/libzstd.so.1 $out/lib/native/ + ln -s ${getLib bzip2}/lib/libbz2.so.1 $out/lib/native/ + ln -s ${getLib snappy}/lib/libsnappy.so.1 $out/lib/native/ + + # libjvm.so is in different paths for java 8 and 11 + # libnativetask.so in hadooop 3 and libhdfs.so in hadoop 2 depend on it + find $out/lib/native/ -name 'libnativetask.so*' -o -name 'libhdfs.so*' | \ + xargs -n1 patchelf --add-rpath $(dirname $(find ${finalAttrs.jdk.home} -name libjvm.so | head -n1)) + + # NixOS/nixpkgs#193370 + # This workaround is needed to use protobuf 3.19 + # hadoop 3.3+ depends on protobuf 3.18, 3.2 depends on 3.8 + find $out/lib/native -name 'libhdfspp.so*' | \ + xargs -r -n1 patchelf --replace-needed libprotobuf.so.${ + if (versionAtLeast finalAttrs.version "3.3") then "18" + else "8" + } libprotobuf.so + + patchelf --replace-needed libcrypto.so.1.1 libcrypto.so \ + $out/lib/native/{libhdfs{pp,}.so*,examples/{pipes-sort,wordcount-nopipe,wordcount-part,wordcount-simple}} + '' + '' for n in $(find $out/bin -type f ! -name "*.*"); do wrapProgram "$n"\ @@ -71,10 +92,10 @@ let --prefix PATH : "${makeBinPath [ bash coreutils which]}"\ --prefix JAVA_LIBRARY_PATH : "${makeLibraryPath finalAttrs.buildInputs}" done - '' + optionalString sparkSupport '' + '' + (optionalString sparkSupport '' # Add the spark shuffle service jar to YARN cp ${spark.src}/yarn/spark-${spark.version}-yarn-shuffle.jar $out/share/hadoop/yarn/ - '' + (finalAttrs.libPatches); + ''); passthru = { inherit tests; }; @@ -99,27 +120,6 @@ let platforms = attrNames platformAttrs; } (attrByPath [ stdenv.system "meta" ] {} platformAttrs); }); - nativeLibs = [ stdenv.cc.cc.lib protobuf zlib snappy libtirpc ]; - libPatchesGenerator = finalAttrs: ('' - ln -s ${getLib cyrus_sasl}/lib/libsasl2.so $out/lib/native/libsasl2.so.2 - ln -s ${getLib openssl}/lib/libcrypto.so $out/lib/native/ - ln -s ${getLib zlib}/lib/libz.so.1 $out/lib/native/ - ln -s ${getLib zstd}/lib/libzstd.so.1 $out/lib/native/ - ln -s ${getLib bzip2}/lib/libbz2.so.1 $out/lib/native/ - '' + optionalString stdenv.isLinux '' - # libjvm.so for Java >=11 - patchelf --add-rpath ${finalAttrs.jdk.home}/lib/server $out/lib/native/libnativetask.so.1.0.0 - # Java 8 has libjvm.so at a different path - patchelf --add-rpath ${finalAttrs.jdk.home}/jre/lib/amd64/server $out/lib/native/libnativetask.so.1.0.0 - # NixOS/nixpkgs#193370 - # This workaround is needed to use protobuf 3.19 - # for hadoop 3.3 - patchelf --replace-needed libprotobuf.so.18 libprotobuf.so $out/lib/native/libhdfspp.so - # for hadoop 3.2 - patchelf --replace-needed libprotobuf.so.8 libprotobuf.so $out/lib/native/libhdfspp.so - patchelf --replace-needed libcrypto.so.1.1 libcrypto.so \ - $out/lib/native/{libhdfspp.so.0.1.0,examples/{pipes-sort,wordcount-nopipe,wordcount-part,wordcount-simple}} - ''); in { # Different version of hadoop support different java runtime versions @@ -139,7 +139,6 @@ in aarch64-darwin = aarch64-linux; }; jdk = jdk11_headless; - inherit nativeLibs libPatchesGenerator; # TODO: Package and add Intel Storage Acceleration Library tests = nixosTests.hadoop; }; @@ -151,7 +150,6 @@ in srcHash = "sha256-F9nGD3mZZ1eJf3Ec3AJGE9YBcL/HiagskcdKQhCn/sw="; }; jdk = jdk8_headless; - inherit nativeLibs libPatchesGenerator; tests = nixosTests.hadoop_3_2; }; hadoop2 = common rec { From 21fa56c145258730be931cb870094b87997429cf Mon Sep 17 00:00:00 2001 From: illustris Date: Sun, 24 Sep 2023 00:55:42 +0530 Subject: [PATCH 011/222] hadoop: fix eval on darwin --- pkgs/applications/networking/cluster/hadoop/default.nix | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/pkgs/applications/networking/cluster/hadoop/default.nix b/pkgs/applications/networking/cluster/hadoop/default.nix index f90ec32177c4..b36921e89792 100644 --- a/pkgs/applications/networking/cluster/hadoop/default.nix +++ b/pkgs/applications/networking/cluster/hadoop/default.nix @@ -47,7 +47,7 @@ let nativeBuildInputs = [ makeWrapper ] ++ optionals stdenv.isLinux [ autoPatchelfHook ]; - buildInputs = [ stdenv.cc.cc.lib openssl protobuf zlib snappy libtirpc ]; + buildInputs = optionals stdenv.isLinux [ stdenv.cc.cc.lib openssl protobuf zlib snappy libtirpc ]; installPhase = '' mkdir $out From a76135599c92d91fb7260aae4c4b40a075d3f62c Mon Sep 17 00:00:00 2001 From: Pavel Sobolev Date: Tue, 26 Sep 2023 12:31:03 +0300 Subject: [PATCH 012/222] python3Packages.readmdict: init at 0.1.1 --- .../python-modules/readmdict/default.nix | 50 +++++++++++++++++++ pkgs/top-level/all-packages.nix | 2 + pkgs/top-level/python-packages.nix | 2 + 3 files changed, 54 insertions(+) create mode 100644 pkgs/development/python-modules/readmdict/default.nix diff --git a/pkgs/development/python-modules/readmdict/default.nix b/pkgs/development/python-modules/readmdict/default.nix new file mode 100644 index 000000000000..b7d61f8c8f57 --- /dev/null +++ b/pkgs/development/python-modules/readmdict/default.nix @@ -0,0 +1,50 @@ +{ lib +, buildPythonPackage +, pythonOlder +, fetchFromGitHub + +, poetry-core +, python-lzo +, tkinter + +, pytestCheckHook +}: + +buildPythonPackage rec { + pname = "readmdict"; + version = "0.1.1"; + pyproject = true; + + disabled = pythonOlder "3.6"; + + src = fetchFromGitHub { + owner = "ffreemt"; + repo = "readmdict"; + rev = "v${version}"; + hash = "sha256-1/f+o2bVscT3EA8XQyS2hWjhimLRzfIBM6u2O7UqwcA="; + }; + + nativeBuildInputs = [ + poetry-core + ]; + + propagatedBuildInputs = [ + python-lzo + tkinter + ]; + + nativeCheckInputs = [ + pytestCheckHook + ]; + + pythonImportsCheck = [ + "readmdict" + ]; + + meta = with lib; { + description = "Read mdx/mdd files (repacking of readmdict from mdict-analysis)"; + homepage = "https://github.com/ffreemt/readmdict"; + license = licenses.mit; + maintainers = with maintainers; [ paveloom ]; + }; +} diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index 4bd4637e6c50..45ce4cbf9c78 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -24879,6 +24879,8 @@ with pkgs; readline82 = callPackage ../development/libraries/readline/8.2.nix { }; + readmdict = with python3Packages; toPythonApplication readmdict; + readosm = callPackage ../development/libraries/readosm { }; recastnavigation = callPackage ../development/libraries/recastnavigation { }; diff --git a/pkgs/top-level/python-packages.nix b/pkgs/top-level/python-packages.nix index ce1944ea8d88..ee27c4083fc8 100644 --- a/pkgs/top-level/python-packages.nix +++ b/pkgs/top-level/python-packages.nix @@ -11169,6 +11169,8 @@ self: super: with self; { readlike = callPackage ../development/python-modules/readlike { }; + readmdict = callPackage ../development/python-modules/readmdict { }; + readme = callPackage ../development/python-modules/readme { }; readme_renderer = callPackage ../development/python-modules/readme_renderer { }; From 84758141375f12b0574326ae46515f945213fcec Mon Sep 17 00:00:00 2001 From: Nicolas Benes Date: Sun, 1 Oct 2023 02:13:53 +0200 Subject: [PATCH 013/222] pynitrokey: 0.4.39 -> 0.4.40 https://github.com/Nitrokey/pynitrokey/releases/tag/v0.4.40 --- pkgs/tools/security/pynitrokey/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/tools/security/pynitrokey/default.nix b/pkgs/tools/security/pynitrokey/default.nix index 9c36ceb3c841..690d566c476d 100644 --- a/pkgs/tools/security/pynitrokey/default.nix +++ b/pkgs/tools/security/pynitrokey/default.nix @@ -10,12 +10,12 @@ with python3Packages; buildPythonApplication rec { pname = "pynitrokey"; - version = "0.4.39"; + version = "0.4.40"; format = "pyproject"; src = fetchPypi { inherit pname version; - hash = "sha256-KXYHeWwV9Tw1ZpO/vASHjDnceeb+1K0yIUohb7EcRAI="; + hash = "sha256-Hu+8UooDzv4GhkWt0sCckQQyHjWn4V/zt2ADlVCoHmk="; }; propagatedBuildInputs = [ From 524714f7eaa37f599c978bc7cb6085934ca2c6b5 Mon Sep 17 00:00:00 2001 From: Will Fancher Date: Wed, 2 Aug 2023 14:56:25 -0400 Subject: [PATCH 014/222] systemd 254: ZFS /usr fix with systemd-stage-1 --- nixos/modules/tasks/filesystems/zfs.nix | 7 ++++++- nixos/tests/installer.nix | 3 +++ 2 files changed, 9 insertions(+), 1 deletion(-) diff --git a/nixos/modules/tasks/filesystems/zfs.nix b/nixos/modules/tasks/filesystems/zfs.nix index 5cf863c87f27..9126d59f9f0d 100644 --- a/nixos/modules/tasks/filesystems/zfs.nix +++ b/nixos/modules/tasks/filesystems/zfs.nix @@ -90,12 +90,17 @@ let getPoolMounts = prefix: pool: let + poolFSes = getPoolFilesystems pool; + # Remove the "/" suffix because even though most mountpoints # won't have it, the "/" mountpoint will, and we can't have the # trailing slash in "/sysroot/" in stage 1. mountPoint = fs: escapeSystemdPath (prefix + (lib.removeSuffix "/" fs.mountPoint)); + + hasUsr = lib.any (fs: fs.mountPoint == "/usr") poolFSes; in - map (x: "${mountPoint x}.mount") (getPoolFilesystems pool); + map (x: "${mountPoint x}.mount") poolFSes + ++ lib.optional hasUsr "sysusr-usr.mount"; getKeyLocations = pool: if isBool cfgZfs.requestEncryptionCredentials then { hasKeys = cfgZfs.requestEncryptionCredentials; diff --git a/nixos/tests/installer.nix b/nixos/tests/installer.nix index 56ba85b76e6f..963e670ee2d8 100644 --- a/nixos/tests/installer.nix +++ b/nixos/tests/installer.nix @@ -690,6 +690,9 @@ in { "zpool create rpool /dev/vda2", "zfs create -o mountpoint=legacy rpool/root", "mount -t zfs rpool/root /mnt", + "zfs create -o mountpoint=legacy rpool/root/usr", + "mkdir /mnt/usr", + "mount -t zfs rpool/root/usr /mnt/usr", "udevadm settle", ) ''; From 11e05fb515796718107764a8a4786ed6e118366e Mon Sep 17 00:00:00 2001 From: Izorkin Date: Tue, 3 Oct 2023 16:50:03 +0300 Subject: [PATCH 015/222] netdata: fix build without cloud support --- pkgs/tools/system/netdata/default.nix | 7 +++---- 1 file changed, 3 insertions(+), 4 deletions(-) diff --git a/pkgs/tools/system/netdata/default.nix b/pkgs/tools/system/netdata/default.nix index f380bf4fd6f6..eccd6ba8ca76 100644 --- a/pkgs/tools/system/netdata/default.nix +++ b/pkgs/tools/system/netdata/default.nix @@ -2,13 +2,13 @@ , CoreFoundation, IOKit, libossp_uuid , nixosTests , netdata-go-plugins -, bash, curl, jemalloc, libuv, zlib, libyaml +, bash, curl, jemalloc, json_c, libuv, zlib, libyaml , libcap, libuuid, lm_sensors, protobuf , withCups ? false, cups , withDBengine ? true, lz4 , withIpmi ? (!stdenv.isDarwin), freeipmi , withNetfilter ? (!stdenv.isDarwin), libmnl, libnetfilter_acct -, withCloud ? (!stdenv.isDarwin), json_c +, withCloud ? (!stdenv.isDarwin) , withCloudUi ? false , withConnPubSub ? false, google-cloud-cpp, grpc , withConnPrometheus ? false, snappy @@ -42,14 +42,13 @@ stdenv.mkDerivation rec { nativeBuildInputs = [ autoreconfHook pkg-config makeWrapper protobuf ]; # bash is only used to rewrite shebangs - buildInputs = [ bash curl jemalloc libuv zlib libyaml ] + buildInputs = [ bash curl jemalloc json_c libuv zlib libyaml ] ++ lib.optionals stdenv.isDarwin [ CoreFoundation IOKit libossp_uuid ] ++ lib.optionals (!stdenv.isDarwin) [ libcap libuuid ] ++ lib.optionals withCups [ cups ] ++ lib.optionals withDBengine [ lz4 ] ++ lib.optionals withIpmi [ freeipmi ] ++ lib.optionals withNetfilter [ libmnl libnetfilter_acct ] - ++ lib.optionals withCloud [ json_c ] ++ lib.optionals withConnPubSub [ google-cloud-cpp grpc ] ++ lib.optionals withConnPrometheus [ snappy ] ++ lib.optionals (withCloud || withConnPrometheus) [ protobuf ] From 4b3012c59fcf07b5701a597c4dafee97ae99ae72 Mon Sep 17 00:00:00 2001 From: Izorkin Date: Tue, 3 Oct 2023 17:23:40 +0300 Subject: [PATCH 016/222] netdata: disable cloud support by default, add netdataCloud package --- nixos/doc/manual/release-notes/rl-2311.section.md | 2 ++ pkgs/tools/system/netdata/default.nix | 2 +- pkgs/top-level/all-packages.nix | 4 ++++ 3 files changed, 7 insertions(+), 1 deletion(-) diff --git a/nixos/doc/manual/release-notes/rl-2311.section.md b/nixos/doc/manual/release-notes/rl-2311.section.md index 9b4323292236..26c4d77debe5 100644 --- a/nixos/doc/manual/release-notes/rl-2311.section.md +++ b/nixos/doc/manual/release-notes/rl-2311.section.md @@ -339,6 +339,8 @@ The module update takes care of the new config syntax and the data itself (user - Suricata was upgraded from 6.0 to 7.0 and no longer considers HTTP/2 support as experimental, see [upstream release notes](https://forum.suricata.io/t/suricata-7-0-0-released/3715) for more details. +- Cloud support in the `netdata` package is now disabled by default. To enable it use the `netdataCloud` package. + - `networking.nftables` now has the option `networking.nftables.table.` to create tables and have them be updated atomically, instead of flushing the ruleset. diff --git a/pkgs/tools/system/netdata/default.nix b/pkgs/tools/system/netdata/default.nix index eccd6ba8ca76..c76bcc7aa094 100644 --- a/pkgs/tools/system/netdata/default.nix +++ b/pkgs/tools/system/netdata/default.nix @@ -8,7 +8,7 @@ , withDBengine ? true, lz4 , withIpmi ? (!stdenv.isDarwin), freeipmi , withNetfilter ? (!stdenv.isDarwin), libmnl, libnetfilter_acct -, withCloud ? (!stdenv.isDarwin) +, withCloud ? false , withCloudUi ? false , withConnPubSub ? false, google-cloud-cpp, grpc , withConnPrometheus ? false, snappy diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index 600517900c39..2eb18f24689a 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -10229,6 +10229,10 @@ with pkgs; inherit (darwin.apple_sdk.frameworks) CoreFoundation IOKit; protobuf = protobuf3_21; }; + netdataCloud = netdata.override { + withCloud = !stdenv.isDarwin; + withCloudUi = true; + }; # Exposed here so the bots can auto-upgrade it netdata-go-plugins = callPackage ../tools/system/netdata/go.d.plugin.nix { }; From e5415d50184fe1c609c85fec82286b9acc77b5ac Mon Sep 17 00:00:00 2001 From: Per Stark Date: Sun, 8 Oct 2023 11:32:02 +0200 Subject: [PATCH 017/222] maintainers: add perstark --- maintainers/maintainer-list.nix | 6 ++++++ 1 file changed, 6 insertions(+) diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix index f8b83f13e89f..58138d236a45 100644 --- a/maintainers/maintainer-list.nix +++ b/maintainers/maintainer-list.nix @@ -12992,6 +12992,12 @@ githubId = 152312; name = "Periklis Tsirakidis"; }; + perstark = { + email = "perstark.se@gmail.com"; + github = "perstarkse"; + githubId = 63069986; + name = "Per Stark"; + }; petercommand = { email = "petercommand@gmail.com"; github = "petercommand"; From b1926f189e4122460af0e7dd49f5c700bf957c97 Mon Sep 17 00:00:00 2001 From: illustris Date: Mon, 9 Oct 2023 18:49:06 +0530 Subject: [PATCH 018/222] hadoop: fix build on darwin --- .../networking/cluster/hadoop/containerExecutor.nix | 2 +- pkgs/applications/networking/cluster/hadoop/default.nix | 5 +++-- 2 files changed, 4 insertions(+), 3 deletions(-) diff --git a/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix b/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix index 3845026fd4a3..83f2fe971d41 100644 --- a/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix +++ b/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix @@ -32,6 +32,6 @@ stdenv.mkDerivation (finalAttrs: { ''; maintainers = with maintainers; [ illustris ]; - platforms = attrNames platformAttrs; + platforms = filter (strings.hasSuffix "linux") (attrNames platformAttrs); }; }) diff --git a/pkgs/applications/networking/cluster/hadoop/default.nix b/pkgs/applications/networking/cluster/hadoop/default.nix index b36921e89792..d5bae9ad885b 100644 --- a/pkgs/applications/networking/cluster/hadoop/default.nix +++ b/pkgs/applications/networking/cluster/hadoop/default.nix @@ -40,10 +40,11 @@ let doCheck = true; # Build the container executor binary from source - containerExecutor = callPackage ./containerExecutor.nix { + # InstallPhase is not lazily evaluating containerExecutor for some reason + containerExecutor = if stdenv.isLinux then (callPackage ./containerExecutor.nix { inherit (finalAttrs) version; inherit platformAttrs; - }; + }) else ""; nativeBuildInputs = [ makeWrapper ] ++ optionals stdenv.isLinux [ autoPatchelfHook ]; From ff16588aa6a57b5f3abeed6f85ce742a213ab0ae Mon Sep 17 00:00:00 2001 From: Per Stark Date: Mon, 9 Oct 2023 20:05:08 +0200 Subject: [PATCH 019/222] blinkstick: 1.2.0 -> unstable-2023-05-04 --- .../python-modules/blinkstick/default.nix | 30 +++++++------------ 1 file changed, 11 insertions(+), 19 deletions(-) diff --git a/pkgs/development/python-modules/blinkstick/default.nix b/pkgs/development/python-modules/blinkstick/default.nix index d3de7561bec2..bafd5254b968 100644 --- a/pkgs/development/python-modules/blinkstick/default.nix +++ b/pkgs/development/python-modules/blinkstick/default.nix @@ -1,35 +1,27 @@ -{ lib -, buildPythonPackage -, fetchPypi -, pyusb -}: +{ lib, buildPythonPackage, fetchFromGitHub, pyusb }: buildPythonPackage rec { pname = "blinkstick"; - version = "1.2.0"; + version = "unstable-2023-05-04"; + format = "setuptools"; - src = fetchPypi { - inherit pname version; - sha256 = "0rdk3i81s6byw23za0bxvkh7sj5l16qxxgc2c53qjg3klc24wcm9"; + src = fetchFromGitHub { + owner = "arvydas"; + repo = "blinkstick-python"; + rev = "8140b9fa18a9ff4f0e9df8e70c073f41cb8f1d35"; + hash = "sha256-9bc7TD/Ilc952ywLauFd0+3Lh64lQlYuDC1KG9eWDgs="; }; - # Upstream fix https://github.com/arvydas/blinkstick-python/pull/54 - # https://github.com/arvydas/blinkstick-python/pull/54/commits/b9bee2cd72f799f1210e5d9e13207f93bbc2d244.patch - # has line ending issues after 1.2.0 - postPatch = '' - substituteInPlace setup.py --replace "pyusb==1.0.0" "pyusb>=1.0.0" - ''; - propagatedBuildInputs = [ pyusb ]; # Project has no tests doCheck = false; pythonImportsCheck = [ "blinkstick" ]; - meta = with lib; { + meta = { description = "Python package to control BlinkStick USB devices"; homepage = "https://github.com/arvydas/blinkstick-python"; - license = licenses.bsd3; - maintainers = with maintainers; [ np ]; + license = lib.licenses.bsd3; + maintainers = with lib.maintainers; [ np perstark ]; }; } From e5c2c71280244eca8fd2dc87f2be0ca1db7f49dd Mon Sep 17 00:00:00 2001 From: Carl Dong Date: Fri, 7 Jul 2023 11:52:37 -0400 Subject: [PATCH 020/222] nixos/nginx: Allow empty port for listen directive When listening on unix sockets, it doesn't make sense to specify a port for nginx's listen directive. Since nginx defaults to port 80 when the port isn't specified (but the address is), we can change the default for the option to null as well without changing any behaviour. --- nixos/lib/test-driver/test_driver/machine.py | 22 +++++++++++++++ .../services/web-servers/nginx/default.nix | 4 +-- .../web-servers/nginx/vhost-options.nix | 7 ++--- nixos/tests/all-tests.nix | 1 + nixos/tests/nginx-unix-socket.nix | 27 +++++++++++++++++++ pkgs/servers/http/nginx/generic.nix | 2 +- 6 files changed, 57 insertions(+), 6 deletions(-) create mode 100644 nixos/tests/nginx-unix-socket.nix diff --git a/nixos/lib/test-driver/test_driver/machine.py b/nixos/lib/test-driver/test_driver/machine.py index 7ed001a1dfce..b1688cd3b64f 100644 --- a/nixos/lib/test-driver/test_driver/machine.py +++ b/nixos/lib/test-driver/test_driver/machine.py @@ -791,6 +791,28 @@ class Machine: with self.nested(f"waiting for TCP port {port} on {addr}"): retry(port_is_open, timeout) + def wait_for_open_unix_socket( + self, addr: str, is_datagram: bool = False, timeout: int = 900 + ) -> None: + """ + Wait until a process is listening on the given UNIX-domain socket + (default to a UNIX-domain stream socket). + """ + + nc_flags = [ + "-z", + "-uU" if is_datagram else "-U", + ] + + def socket_is_open(_: Any) -> bool: + status, _ = self.execute(f"nc {' '.join(nc_flags)} {addr}") + return status == 0 + + with self.nested( + f"waiting for UNIX-domain {'datagram' if is_datagram else 'stream'} on '{addr}'" + ): + retry(socket_is_open, timeout) + def wait_for_closed_port( self, port: int, addr: str = "localhost", timeout: int = 900 ) -> None: diff --git a/nixos/modules/services/web-servers/nginx/default.nix b/nixos/modules/services/web-servers/nginx/default.nix index 955d6e19064e..9eebd18855c7 100644 --- a/nixos/modules/services/web-servers/nginx/default.nix +++ b/nixos/modules/services/web-servers/nginx/default.nix @@ -329,7 +329,7 @@ let listenString = { addr, port, ssl, proxyProtocol ? false, extraParameters ? [], ... }: # UDP listener for QUIC transport protocol. (optionalString (ssl && vhost.quic) (" - listen ${addr}:${toString port} quic " + listen ${addr}${optionalString (port != null) ":${toString port}"} quic " + optionalString vhost.default "default_server " + optionalString vhost.reuseport "reuseport " + optionalString (extraParameters != []) (concatStringsSep " " @@ -338,7 +338,7 @@ let in filter isCompatibleParameter extraParameters)) + ";")) + " - listen ${addr}:${toString port} " + listen ${addr}${optionalString (port != null) ":${toString port}"} " + optionalString (ssl && vhost.http2 && oldHTTP2) "http2 " + optionalString ssl "ssl " + optionalString vhost.default "default_server " diff --git a/nixos/modules/services/web-servers/nginx/vhost-options.nix b/nixos/modules/services/web-servers/nginx/vhost-options.nix index 7636c1b26115..c82f02ecefec 100644 --- a/nixos/modules/services/web-servers/nginx/vhost-options.nix +++ b/nixos/modules/services/web-servers/nginx/vhost-options.nix @@ -31,12 +31,12 @@ with lib; options = { addr = mkOption { type = str; - description = lib.mdDoc "IP address."; + description = lib.mdDoc "Listen address."; }; port = mkOption { - type = port; + type = types.nullOr port; description = lib.mdDoc "Port number."; - default = 80; + default = null; }; ssl = mkOption { type = bool; @@ -60,6 +60,7 @@ with lib; example = [ { addr = "195.154.1.1"; port = 443; ssl = true; } { addr = "192.154.1.1"; port = 80; } + { addr = "unix:/var/run/nginx.sock"; } ]; description = lib.mdDoc '' Listen addresses and ports for this virtual host. diff --git a/nixos/tests/all-tests.nix b/nixos/tests/all-tests.nix index 3f19ed548121..bb44d68e275d 100644 --- a/nixos/tests/all-tests.nix +++ b/nixos/tests/all-tests.nix @@ -555,6 +555,7 @@ in { nginx-sso = handleTest ./nginx-sso.nix {}; nginx-status-page = handleTest ./nginx-status-page.nix {}; nginx-tmpdir = handleTest ./nginx-tmpdir.nix {}; + nginx-unix-socket = handleTest ./nginx-unix-socket.nix {}; nginx-variants = handleTest ./nginx-variants.nix {}; nifi = handleTestOn ["x86_64-linux"] ./web-apps/nifi.nix {}; nitter = handleTest ./nitter.nix {}; diff --git a/nixos/tests/nginx-unix-socket.nix b/nixos/tests/nginx-unix-socket.nix new file mode 100644 index 000000000000..4640eaa171bd --- /dev/null +++ b/nixos/tests/nginx-unix-socket.nix @@ -0,0 +1,27 @@ +import ./make-test-python.nix ({ pkgs, ... }: +let + nginxSocketPath = "/var/run/nginx/test.sock"; +in +{ + name = "nginx-unix-socket"; + + nodes = { + webserver = { pkgs, lib, ... }: { + services.nginx = { + enable = true; + virtualHosts.localhost = { + serverName = "localhost"; + listen = [{ addr = "unix:${nginxSocketPath}"; }]; + locations."/test".return = "200 'foo'"; + }; + }; + }; + }; + + testScript = '' + webserver.wait_for_unit("nginx") + webserver.wait_for_open_unix_socket("${nginxSocketPath}") + + webserver.succeed("curl --fail --silent --unix-socket '${nginxSocketPath}' http://localhost/test | grep '^foo$'") + ''; +}) diff --git a/pkgs/servers/http/nginx/generic.nix b/pkgs/servers/http/nginx/generic.nix index 3db19396bee9..b5e42c3dffb3 100644 --- a/pkgs/servers/http/nginx/generic.nix +++ b/pkgs/servers/http/nginx/generic.nix @@ -178,7 +178,7 @@ stdenv.mkDerivation { passthru = { inherit modules; tests = { - inherit (nixosTests) nginx nginx-auth nginx-etag nginx-globalredirect nginx-http3 nginx-proxyprotocol nginx-pubhtml nginx-sandbox nginx-sso nginx-status-page; + inherit (nixosTests) nginx nginx-auth nginx-etag nginx-globalredirect nginx-http3 nginx-proxyprotocol nginx-pubhtml nginx-sandbox nginx-sso nginx-status-page nginx-unix-socket; variants = lib.recurseIntoAttrs nixosTests.nginx-variants; acme-integration = nixosTests.acme; } // passthru.tests; From 9198645f5c96e4df4aa1fff144f3f339c1124637 Mon Sep 17 00:00:00 2001 From: Austin Butler Date: Thu, 12 Oct 2023 13:21:36 -0700 Subject: [PATCH 021/222] vscode-extensions.astro-build.astro-vscode: 2.1.1 -> 2.3.3 --- pkgs/applications/editors/vscode/extensions/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/applications/editors/vscode/extensions/default.nix b/pkgs/applications/editors/vscode/extensions/default.nix index 22f047a1bc72..d7507321df26 100644 --- a/pkgs/applications/editors/vscode/extensions/default.nix +++ b/pkgs/applications/editors/vscode/extensions/default.nix @@ -326,8 +326,8 @@ let mktplcRef = { name = "astro-vscode"; publisher = "astro-build"; - version = "2.1.1"; - sha256 = "sha256-UVZOpkOHbLiwA4VfTgXxuIU8EtJLnqRa5zUVha6xQJY="; + version = "2.3.3"; + sha256 = "sha256-A7+7lnCPAtSWUfHLNKbYqKuTxi2Nx05Qdh5HCkT1dnM="; }; meta = { changelog = "https://marketplace.visualstudio.com/items/astro-build.astro-vscode/changelog"; From 3771ec45c0adef0a8687657b8633b6adbf96e053 Mon Sep 17 00:00:00 2001 From: OPNA2608 Date: Fri, 13 Oct 2023 13:37:18 +0200 Subject: [PATCH 022/222] xsct: init at 2.0 --- pkgs/by-name/xs/xsct/package.nix | 38 ++++++++++++++++++++++++++++++++ 1 file changed, 38 insertions(+) create mode 100644 pkgs/by-name/xs/xsct/package.nix diff --git a/pkgs/by-name/xs/xsct/package.nix b/pkgs/by-name/xs/xsct/package.nix new file mode 100644 index 000000000000..80023f676c49 --- /dev/null +++ b/pkgs/by-name/xs/xsct/package.nix @@ -0,0 +1,38 @@ +{ stdenv +, lib +, fetchFromGitHub +, gitUpdater +, libX11 +, libXrandr +}: + +stdenv.mkDerivation (finalAttrs: { + pname = "xsct"; + version = "2.0"; + + src = fetchFromGitHub { + owner = "faf0"; + repo = "sct"; + rev = finalAttrs.version; + hash = "sha256-XhrkaK85I/U2ChO5mZYah/TaXz03yahfMEbfgzXqytU="; + }; + + buildInputs = [ + libX11 + libXrandr + ]; + + makeFlags = [ + "PREFIX=${placeholder "out"}" + ]; + + passthru.updateScript = gitUpdater { }; + + meta = with lib; { + description = "Set color temperature of screen"; + homepage = "https://github.com/faf0/sct"; + license = licenses.unlicense; + maintainers = with maintainers; [ OPNA2608 ]; + platforms = with platforms; linux ++ freebsd ++ openbsd; + }; +}) From fd04990a6f6725141c2f3d7cf6dd59785fc96477 Mon Sep 17 00:00:00 2001 From: OPNA2608 Date: Sat, 14 Oct 2023 10:03:46 +0200 Subject: [PATCH 023/222] dbus-cpp: init at 5.0.3 --- pkgs/by-name/db/dbus-cpp/package.nix | 122 +++++++++++++++++++++++++++ 1 file changed, 122 insertions(+) create mode 100644 pkgs/by-name/db/dbus-cpp/package.nix diff --git a/pkgs/by-name/db/dbus-cpp/package.nix b/pkgs/by-name/db/dbus-cpp/package.nix new file mode 100644 index 000000000000..1aa09505c8df --- /dev/null +++ b/pkgs/by-name/db/dbus-cpp/package.nix @@ -0,0 +1,122 @@ +{ stdenv +, lib +, fetchFromGitLab +, fetchpatch +, gitUpdater +, testers +, boost +, cmake +, dbus +, doxygen +, graphviz +, gtest +, libxml2 +, lomiri +, pkg-config +, process-cpp +, properties-cpp +}: + +stdenv.mkDerivation (finalAttrs: { + pname = "dbus-cpp"; + version = "5.0.3"; + + src = fetchFromGitLab { + owner = "ubports"; + repo = "development/core/lib-cpp/dbus-cpp"; + rev = finalAttrs.version; + hash = "sha256-t8SzPRUuKeEchT8vAsITf8MwbgHA+mR5C9CnkdVyX7s="; + }; + + outputs = [ + "out" + "dev" + "doc" + "examples" + ]; + + patches = [ + # Handle already-stolen dbus call better + # Remove when version > 5.0.3 + (fetchpatch { + name = "0001-dbus-cpp-src-Dont-steal-a-pending-dbus-call-more-then-once.patch"; + url = "https://gitlab.com/ubports/development/core/lib-cpp/dbus-cpp/-/commit/9f3d1ff2b1c6c732285949c3dbb35e40cf55ea92.patch"; + hash = "sha256-xzOCIJVsK2J+X9RsV930R9uw6h4UxqwSaNOgv8v4qQU="; + }) + + # Fix GCC13 compilation + # Remove when version > 5.0.3 + (fetchpatch { + name = "0002-dbus-cpp-Add-missing-headers-for-GCC13.patch"; + url = "https://gitlab.com/ubports/development/core/lib-cpp/dbus-cpp/-/commit/c761b1eec084962dbe64d35d7f7b86dcbe57a3f7.patch"; + hash = "sha256-/tKe3iHWxP9jWtpdgwwRynj8565u9LxCt4WXJDXzgX4="; + }) + ]; + + postPatch = '' + substituteInPlace doc/CMakeLists.txt \ + --replace 'DESTINATION share/''${CMAKE_PROJECT_NAME}/doc' 'DESTINATION ''${CMAKE_INSTALL_DOCDIR}' + + # Warning on aarch64-linux breaks build due to -Werror + substituteInPlace CMakeLists.txt \ + --replace '-Werror' "" + '' + lib.optionalString (!finalAttrs.doCheck) '' + sed -i -e '/add_subdirectory(tests)/d' CMakeLists.txt + ''; + + strictDeps = true; + + nativeBuildInputs = [ + cmake + doxygen + graphviz + pkg-config + ]; + + buildInputs = [ + boost + lomiri.cmake-extras + dbus + libxml2 + process-cpp + properties-cpp + ]; + + nativeCheckInputs = [ + dbus + ]; + + checkInputs = [ + gtest + ]; + + cmakeFlags = [ + "-DDBUS_CPP_ENABLE_DOC_GENERATION=ON" + ]; + + doCheck = stdenv.buildPlatform.canExecute stdenv.hostPlatform; + + # DBus mess, hoping this fixes occational flakiness + enableParallelChecking = false; + + preFixup = '' + moveToOutput libexec/examples $examples + ''; + + passthru = { + tests.pkg-config = testers.testMetaPkgConfig finalAttrs.finalPackage; + updateScript = gitUpdater { }; + }; + + meta = with lib; { + description = "A dbus-binding leveraging C++-11"; + homepage = "https://gitlab.com/ubports/development/core/lib-cpp/dbus-cpp"; + license = licenses.lgpl3Only; + maintainers = with maintainers; [ OPNA2608 ]; + mainProgram = "dbus-cppc"; + platforms = platforms.linux; + pkgConfigModules = [ + "dbus-cpp" + ]; + }; +}) From 99202824be73c502945b3fdbd651f724a2361671 Mon Sep 17 00:00:00 2001 From: OPNA2608 Date: Sat, 14 Oct 2023 11:26:59 +0200 Subject: [PATCH 024/222] dbus-cpp: Disable tests Tests seem very flaky on some systems / for some ppl. Consistently fail on OfBorg ARM CI, past reports of sporadic test failures on amd64. Not sure if due to weak systems or DBus weirdness. Disabling for now. --- pkgs/by-name/db/dbus-cpp/package.nix | 5 +++-- 1 file changed, 3 insertions(+), 2 deletions(-) diff --git a/pkgs/by-name/db/dbus-cpp/package.nix b/pkgs/by-name/db/dbus-cpp/package.nix index 1aa09505c8df..6ad4c355b6ad 100644 --- a/pkgs/by-name/db/dbus-cpp/package.nix +++ b/pkgs/by-name/db/dbus-cpp/package.nix @@ -94,9 +94,10 @@ stdenv.mkDerivation (finalAttrs: { "-DDBUS_CPP_ENABLE_DOC_GENERATION=ON" ]; - doCheck = stdenv.buildPlatform.canExecute stdenv.hostPlatform; + # Too flaky on ARM CI & for some amd64 users + doCheck = false; - # DBus mess, hoping this fixes occational flakiness + # DBus, parallelism messes with communication enableParallelChecking = false; preFixup = '' From 80dc2acd23b198e61bd39f12d65fbd694e69dbb1 Mon Sep 17 00:00:00 2001 From: Robert Scott Date: Sat, 14 Oct 2023 23:43:54 +0100 Subject: [PATCH 025/222] teleport_11: 11.3.25 -> 11.3.27 --- pkgs/servers/teleport/11/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/servers/teleport/11/default.nix b/pkgs/servers/teleport/11/default.nix index 59d788872b88..3a935b630e72 100644 --- a/pkgs/servers/teleport/11/default.nix +++ b/pkgs/servers/teleport/11/default.nix @@ -1,7 +1,7 @@ { callPackage, ... }@args: callPackage ../generic.nix ({ - version = "11.3.25"; - hash = "sha256-KIbRn90BUJp8Uc8GMHuIMMSn5tJQbxzE0ntngx1ELaE="; + version = "11.3.27"; + hash = "sha256-A3EeFQsDOaggfb5S+eyRCe/vm054MabfRrcHPxhO0So="; vendorHash = "sha256-hjMv/H4dlinlv3ku7i1km2/b+6uCdbznHtVOMIjDlUc="; yarnHash = "sha256-hip0WQVZpx2qfVDmEy4nk4UFYEjX1Xhj8HsIIQ8PF1Y="; cargoLock = { From 6e1b982b8e1f48dcf256cf2d430fe8c0eb36602f Mon Sep 17 00:00:00 2001 From: Robert Scott Date: Sun, 15 Oct 2023 01:54:06 +0100 Subject: [PATCH 026/222] teleport_12: 12.4.20 -> 12.4.22 --- pkgs/servers/teleport/12/Cargo.lock | 4 ++-- pkgs/servers/teleport/12/default.nix | 8 ++++---- 2 files changed, 6 insertions(+), 6 deletions(-) diff --git a/pkgs/servers/teleport/12/Cargo.lock b/pkgs/servers/teleport/12/Cargo.lock index 895145e3927f..c150d003f3ac 100644 --- a/pkgs/servers/teleport/12/Cargo.lock +++ b/pkgs/servers/teleport/12/Cargo.lock @@ -1734,9 +1734,9 @@ dependencies = [ [[package]] name = "webpki" -version = "0.22.0" +version = "0.22.2" source = "registry+https://github.com/rust-lang/crates.io-index" -checksum = "f095d78192e208183081cc07bc5515ef55216397af48b873e5edcd72637fa1bd" +checksum = "07ecc0cd7cac091bf682ec5efa18b1cff79d617b84181f38b3951dbe135f607f" dependencies = [ "ring", "untrusted 0.7.1", diff --git a/pkgs/servers/teleport/12/default.nix b/pkgs/servers/teleport/12/default.nix index e53fdcce494a..ee166f5d4721 100644 --- a/pkgs/servers/teleport/12/default.nix +++ b/pkgs/servers/teleport/12/default.nix @@ -1,9 +1,9 @@ { callPackage, ... }@args: callPackage ../generic.nix ({ - version = "12.4.20"; - hash = "sha256-Qz+JOS4YPj2865Fkj7eVJMdilHMOGbTD179bQ5wHY7A="; - vendorHash = "sha256-cS8ylLujgp9Is+D2JjoK4yGgWRCVRyRw3NPQAAuE2vY="; - yarnHash = "sha256-tOdT7X8jM+tl1GZ7lBN2aW8KRiVW/zWK9fZIU7CSHVE="; + version = "12.4.22"; + hash = "sha256-UEiS+GiderYTU34GHsQr4G8XrasV5ewmPcdrec4v5B4="; + vendorHash = "sha256-etutgK/5u+e86kx7ha3x+di9np7Tcr7hpGUMKZxJNT4="; + yarnHash = "sha256-MBTElkMH5rb33l+AYWH+zguSLQf+ntXpOkHZpjLAx/Q="; cargoLock = { lockFile = ./Cargo.lock; outputHashes = { From fb9413b9402c687ce4b9bbd8d32cb5d307d08e2a Mon Sep 17 00:00:00 2001 From: Robert Scott Date: Sun, 15 Oct 2023 21:00:18 +0100 Subject: [PATCH 027/222] teleport_13: 13.4.1 -> 13.4.3 --- pkgs/servers/teleport/13/Cargo.lock | 4 ++-- pkgs/servers/teleport/13/default.nix | 8 ++++---- 2 files changed, 6 insertions(+), 6 deletions(-) diff --git a/pkgs/servers/teleport/13/Cargo.lock b/pkgs/servers/teleport/13/Cargo.lock index b82c0b0e435f..d22467c3e7dc 100644 --- a/pkgs/servers/teleport/13/Cargo.lock +++ b/pkgs/servers/teleport/13/Cargo.lock @@ -1786,9 +1786,9 @@ dependencies = [ [[package]] name = "webpki" -version = "0.22.0" +version = "0.22.2" source = "registry+https://github.com/rust-lang/crates.io-index" -checksum = "f095d78192e208183081cc07bc5515ef55216397af48b873e5edcd72637fa1bd" +checksum = "07ecc0cd7cac091bf682ec5efa18b1cff79d617b84181f38b3951dbe135f607f" dependencies = [ "ring", "untrusted 0.7.1", diff --git a/pkgs/servers/teleport/13/default.nix b/pkgs/servers/teleport/13/default.nix index 58d682f52ac2..65cbed70d9cc 100644 --- a/pkgs/servers/teleport/13/default.nix +++ b/pkgs/servers/teleport/13/default.nix @@ -1,9 +1,9 @@ { callPackage, ... }@args: callPackage ../generic.nix ({ - version = "13.4.1"; - hash = "sha256-wgSaek4eq5Jx9SZFenvdRSU1wEtfJHzTz9GdczzUU2w="; - vendorHash = "sha256-DesT18nV/SxOsKCC+Nt0hgtH7CRtRL0B5FQhE1J148I="; - yarnHash = "sha256-iyMcP9L6dwBhN8JL9eSVEzsXI2EOjfyxjF9Dm4Gs04s="; + version = "13.4.3"; + hash = "sha256-x8G94jKycK3nYwqDA5RPc63GHIk9y4pHfSwSBqGBINk="; + vendorHash = "sha256-Pb3eO9zqLgTD7otM7yGRWicQjvpIXg7xKV8Oc4yh8PA="; + yarnHash = "sha256-GnoiLqzqGV0UZm5zePCDBUUX63NTIIo1dcxtiWQDPqc="; cargoLock = { lockFile = ./Cargo.lock; outputHashes = { From 433fdf4b78a47de96b275dfe4446baa13bf9ab51 Mon Sep 17 00:00:00 2001 From: Robert Scott Date: Sun, 15 Oct 2023 21:30:55 +0100 Subject: [PATCH 028/222] teleport: 14.0.1 -> 14.0.3 --- pkgs/servers/teleport/14/Cargo.lock | 4 ++-- pkgs/servers/teleport/14/default.nix | 8 ++++---- 2 files changed, 6 insertions(+), 6 deletions(-) diff --git a/pkgs/servers/teleport/14/Cargo.lock b/pkgs/servers/teleport/14/Cargo.lock index 8b18ac74ae70..c9b50a388b0b 100644 --- a/pkgs/servers/teleport/14/Cargo.lock +++ b/pkgs/servers/teleport/14/Cargo.lock @@ -1789,9 +1789,9 @@ dependencies = [ [[package]] name = "webpki" -version = "0.22.0" +version = "0.22.2" source = "registry+https://github.com/rust-lang/crates.io-index" -checksum = "f095d78192e208183081cc07bc5515ef55216397af48b873e5edcd72637fa1bd" +checksum = "07ecc0cd7cac091bf682ec5efa18b1cff79d617b84181f38b3951dbe135f607f" dependencies = [ "ring", "untrusted 0.7.1", diff --git a/pkgs/servers/teleport/14/default.nix b/pkgs/servers/teleport/14/default.nix index 15a594ef13e6..71036da070ef 100644 --- a/pkgs/servers/teleport/14/default.nix +++ b/pkgs/servers/teleport/14/default.nix @@ -1,9 +1,9 @@ { callPackage, ... }@args: callPackage ../generic.nix ({ - version = "14.0.1"; - hash = "sha256-esQwk2PFnk3/REzLr3ExtzEcUs2q4Tn/2KpfFWAx5uU="; - vendorHash = "sha256-lzwrkW0dHxCHBSJjzNhXgq3Av8Zj8xEn3kfTRtT/q04="; - yarnHash = "sha256-Y2dVxRyKPLD2xjwr0QqrKHf/4gnMCErmDzievu5zTGg="; + version = "14.0.3"; + hash = "sha256-X+vekYmuTE7n22SH/z2GWO3wnBsIef1GEjR7WOJpjc8="; + vendorHash = "sha256-+R6f2HrlN/RLec83YutccDFJW6gq6HXbxoJVtxMgdp8="; + yarnHash = "sha256-udM4DNaTGiMkqfkllJjmT+Nk6PNbGUzT34ixQOhmScw="; cargoLock = { lockFile = ./Cargo.lock; outputHashes = { From e414a727dfdd0336fbf7f2be6a4b5c5ebe112864 Mon Sep 17 00:00:00 2001 From: Weijia Wang <9713184+wegank@users.noreply.github.com> Date: Mon, 16 Oct 2023 21:37:45 +0200 Subject: [PATCH 029/222] texmacs: 2.1 -> 2.1.2 --- pkgs/applications/editors/texmacs/default.nix | 42 ++++++++++++++----- pkgs/top-level/all-packages.nix | 1 + 2 files changed, 32 insertions(+), 11 deletions(-) diff --git a/pkgs/applications/editors/texmacs/default.nix b/pkgs/applications/editors/texmacs/default.nix index 427d0aa3ace8..00372c1cab8b 100644 --- a/pkgs/applications/editors/texmacs/default.nix +++ b/pkgs/applications/editors/texmacs/default.nix @@ -1,5 +1,5 @@ -{ lib, mkDerivation, callPackage, fetchurl, - guile_1_8, qtbase, xmodmap, which, freetype, +{ lib, stdenv, callPackage, fetchurl, + guile_1_8, xmodmap, which, freetype, libjpeg, sqlite, tex ? null, @@ -8,6 +8,11 @@ python3 ? null, cmake, pkg-config, + wrapQtAppsHook, + xdg-utils, + qtbase, + qtsvg, + qtmacextras, ghostscriptX ? null, extraFonts ? false, chineseFonts ? false, @@ -15,32 +20,49 @@ koreanFonts ? false }: let - pname = "TeXmacs"; - version = "2.1"; + pname = "texmacs"; + version = "2.1.2"; common = callPackage ./common.nix { inherit tex extraFonts chineseFonts japaneseFonts koreanFonts; }; in -mkDerivation { +stdenv.mkDerivation { inherit pname version; src = fetchurl { url = "https://www.texmacs.org/Download/ftp/tmftp/source/TeXmacs-${version}-src.tar.gz"; - sha256 = "1gl6k1bwrk1y7hjyl4xvlqvmk5crl4jvsk8wrfp7ynbdin6n2i48"; + hash = "sha256-Ds9gxOwMYSttEWrawgxLHGxHyMBvt8WmyPIwBP2g/CM="; }; - nativeBuildInputs = [ cmake pkg-config ]; + postPatch = common.postPatch + '' + substituteInPlace configure \ + --replace "-mfpmath=sse -msse2" "" + ''; + + nativeBuildInputs = [ + guile_1_8 + pkg-config + wrapQtAppsHook + xdg-utils + ] ++ lib.optionals (!stdenv.isDarwin) [ + cmake + ]; + buildInputs = [ guile_1_8 qtbase + qtsvg ghostscriptX freetype libjpeg sqlite git python3 + ] ++ lib.optionals stdenv.isDarwin [ + qtmacextras ]; - NIX_LDFLAGS = "-lz"; + + env.NIX_LDFLAGS = "-lz"; qtWrapperArgs = [ "--suffix" "PATH" ":" (lib.makeBinPath [ @@ -58,10 +80,8 @@ mkDerivation { wrapQtApp $out/bin/texmacs ''; - inherit (common) postPatch; - meta = common.meta // { maintainers = [ lib.maintainers.roconnor ]; - platforms = lib.platforms.gnu ++ lib.platforms.linux; # arbitrary choice + platforms = lib.platforms.all; }; } diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index 8f3087038877..de9a8283f2e4 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -13799,6 +13799,7 @@ with pkgs; tewisay = callPackage ../tools/misc/tewisay { }; texmacs = libsForQt5.callPackage ../applications/editors/texmacs { + stdenv = if stdenv.isDarwin then darwin.apple_sdk_11_0.stdenv else stdenv; tex = texlive.combined.scheme-small; extraFonts = true; }; From 9bcbf00cc94fe3ab5c7aff6f05e0c533a7ffaf30 Mon Sep 17 00:00:00 2001 From: Eduardo Quiros Date: Tue, 10 Oct 2023 01:06:01 -0600 Subject: [PATCH 030/222] signal-desktop: 6.32.0 -> 6.34.1, signal-desktop-beta: 6.33.0-beta.1 -> 6.35.0-beta.2 --- .../instant-messengers/signal-desktop/default.nix | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix b/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix index 7ae6a8a11abe..d6118db16f3c 100644 --- a/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix +++ b/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix @@ -1,12 +1,12 @@ { callPackage }: builtins.mapAttrs (pname: attrs: callPackage ./generic.nix (attrs // { inherit pname; })) { signal-desktop = { dir = "Signal"; - version = "6.32.0"; - hash = "sha256-FZ2wG3nkgIndeoUfXag/9jftXGDSY/MNpT8mqSZpJzA="; + version = "6.34.1"; + hash = "sha256-1kffRXPQmtxIsLZVOgPXDnxUmY59q+1umy25cditRhw="; }; signal-desktop-beta = { dir = "Signal Beta"; - version = "6.33.0-beta.1"; - hash = "sha256-FLCZvRYUysiE8BLMJVnn0hOkA3km0z383AjN6JvOyWI="; + version = "6.35.0-beta.2"; + hash = "sha256-TgzqKGt3ojkjq+mIu0EtqXfnnZ/xulWjiuS5/0dlwIM="; }; } From ba63d2f8da23b6e847361c7221d328e992e6b587 Mon Sep 17 00:00:00 2001 From: Rob <86313040+robert-manchester@users.noreply.github.com> Date: Tue, 10 Oct 2023 00:45:34 -0700 Subject: [PATCH 031/222] duckdb: 0.9.0 -> 0.9.1 changelog https://github.com/duckdb/duckdb/releases/tag/v0.9.1 --- pkgs/development/libraries/duckdb/default.nix | 10 ++++--- .../libraries/duckdb/version.patch | 22 -------------- .../python-modules/duckdb/default.nix | 14 +++++---- .../python-modules/duckdb/setup.patch | 30 +++++++++++++++++++ 4 files changed, 44 insertions(+), 32 deletions(-) create mode 100644 pkgs/development/python-modules/duckdb/setup.patch diff --git a/pkgs/development/libraries/duckdb/default.nix b/pkgs/development/libraries/duckdb/default.nix index ea152c0cc099..c9f6711780b0 100644 --- a/pkgs/development/libraries/duckdb/default.nix +++ b/pkgs/development/libraries/duckdb/default.nix @@ -15,13 +15,13 @@ let in stdenv.mkDerivation rec { pname = "duckdb"; - version = "0.9.0"; + version = "0.9.1"; src = fetchFromGitHub { owner = pname; repo = pname; rev = "v${version}"; - hash = "sha256-EKvDH7RwOC4Gu/lturrfnGpzXnJ9azIwAFeuVoa6L/Y="; + hash = "sha256-UG/vV/6WxVLq9mdze8pSDFJIekOgGsg93dzMq6eP6Dg="; }; patches = [ ./version.patch ]; @@ -106,10 +106,12 @@ stdenv.mkDerivation rec { ''; meta = with lib; { - homepage = "https://github.com/duckdb/duckdb"; + changelog = "https://github.com/duckdb/duckdb/releases/tag/v${version}"; description = "Embeddable SQL OLAP Database Management System"; + homepage = "https://duckdb.org/"; license = licenses.mit; - platforms = platforms.all; + mainProgram = "duckdb"; maintainers = with maintainers; [ costrouc cpcloud ]; + platforms = platforms.all; }; } diff --git a/pkgs/development/libraries/duckdb/version.patch b/pkgs/development/libraries/duckdb/version.patch index 9b368eac5dbc..f40785b43079 100644 --- a/pkgs/development/libraries/duckdb/version.patch +++ b/pkgs/development/libraries/duckdb/version.patch @@ -56,25 +56,3 @@ index 2b49e11288..0a4a69b9a0 100644 message(STATUS "git hash ${GIT_COMMIT_HASH}, version ${DUCKDB_VERSION}") -diff --git a/tools/pythonpkg/setup.py b/tools/pythonpkg/setup.py -index fdf2911019..c363cc518a 100644 ---- a/tools/pythonpkg/setup.py -+++ b/tools/pythonpkg/setup.py -@@ -163,8 +163,6 @@ if 'BUILD_HTTPFS' in os.environ: - for ext in extensions: - toolchain_args.extend(['-DDUCKDB_EXTENSION_{}_LINKED'.format(ext.upper())]) - --toolchain_args.extend(['-DDUCKDB_EXTENSION_AUTOLOAD_DEFAULT=1', '-DDUCKDB_EXTENSION_AUTOINSTALL_DEFAULT=1']) -- - - class get_pybind_include(object): - def __init__(self, user=False): -@@ -343,7 +341,7 @@ setup( - packages=packages, - include_package_data=True, - python_requires='>=3.7.0', -- setup_requires=setup_requires + ["setuptools_scm<7.0.0", 'pybind11>=2.6.0'], -+ setup_requires=setup_requires + ["setuptools_scm", 'pybind11>=2.6.0'], - use_scm_version=setuptools_scm_conf, - tests_require=['google-cloud-storage', 'mypy', 'pytest'], - classifiers=[ diff --git a/pkgs/development/python-modules/duckdb/default.nix b/pkgs/development/python-modules/duckdb/default.nix index e9aac74d835e..37ddad2cd045 100644 --- a/pkgs/development/python-modules/duckdb/default.nix +++ b/pkgs/development/python-modules/duckdb/default.nix @@ -13,17 +13,19 @@ }: buildPythonPackage rec { - inherit (duckdb) pname version src patches; + inherit (duckdb) pname version src; format = "setuptools"; - postPatch = '' + # 1. let nix control build cores + # 2. default to extension autoload & autoinstall disabled + # 3. unconstrain setuptools_scm version + patches = (duckdb.patches or []) ++ [ ./setup.patch ]; + + postPatch = (duckdb.postPatch or "") + '' # we can't use sourceRoot otherwise patches don't apply, because the patches apply to the C++ library cd tools/pythonpkg - # 1. let nix control build cores - # 2. unconstrain setuptools_scm version - substituteInPlace setup.py \ - --replace "multiprocessing.cpu_count()" "$NIX_BUILD_CORES" + substituteInPlace setup.py --subst-var NIX_BUILD_CORES # avoid dependency on mypy rm tests/stubs/test_stubs.py diff --git a/pkgs/development/python-modules/duckdb/setup.patch b/pkgs/development/python-modules/duckdb/setup.patch new file mode 100644 index 000000000000..8c8f790a66a1 --- /dev/null +++ b/pkgs/development/python-modules/duckdb/setup.patch @@ -0,0 +1,30 @@ +diff --git a/tools/pythonpkg/setup.py b/tools/pythonpkg/setup.py +index 30f1e1ccdd..6784169fcb 100644 +--- a/tools/pythonpkg/setup.py ++++ b/tools/pythonpkg/setup.py +@@ -96,7 +96,7 @@ def parallel_cpp_compile( + return + self._compile(obj, src, ext, cc_args, extra_postargs, pp_opts) + +- list(multiprocessing.pool.ThreadPool(multiprocessing.cpu_count()).imap(_single_compile, objects)) ++ list(multiprocessing.pool.ThreadPool(@NIX_BUILD_CORES@).imap(_single_compile, objects)) + return objects + + +@@ -163,7 +163,6 @@ if 'BUILD_HTTPFS' in os.environ: + for ext in extensions: + toolchain_args.extend(['-DDUCKDB_EXTENSION_{}_LINKED'.format(ext.upper())]) + +-toolchain_args.extend(['-DDUCKDB_EXTENSION_AUTOLOAD_DEFAULT=1', '-DDUCKDB_EXTENSION_AUTOINSTALL_DEFAULT=1']) + + + class get_pybind_include(object): +@@ -348,7 +347,7 @@ setup( + packages=packages, + include_package_data=True, + python_requires='>=3.7.0', +- setup_requires=setup_requires + ["setuptools_scm<7.0.0", 'pybind11>=2.6.0'], ++ setup_requires=setup_requires + ["setuptools_scm", 'pybind11>=2.6.0'], + use_scm_version=setuptools_scm_conf, + tests_require=['google-cloud-storage', 'mypy', 'pytest'], + classifiers=[ From d9925bd964b32246d28ffd6fa969c6eea6595938 Mon Sep 17 00:00:00 2001 From: Thomas Gerbet Date: Mon, 4 Sep 2023 16:34:03 +0200 Subject: [PATCH 032/222] rekor-cli, rekor-server: 1.2.2 -> 1.3.2 Changes: https://github.com/sigstore/rekor/releases/tag/v1.3.0 https://github.com/sigstore/rekor/releases/tag/v1.3.1 https://github.com/sigstore/rekor/releases/tag/v1.3.2 --- pkgs/tools/security/rekor/default.nix | 6 +++--- pkgs/top-level/all-packages.nix | 2 +- 2 files changed, 4 insertions(+), 4 deletions(-) diff --git a/pkgs/tools/security/rekor/default.nix b/pkgs/tools/security/rekor/default.nix index 2820f473c11b..c27416e29d2e 100644 --- a/pkgs/tools/security/rekor/default.nix +++ b/pkgs/tools/security/rekor/default.nix @@ -4,13 +4,13 @@ let generic = { pname, packageToBuild, description }: buildGoModule rec { inherit pname; - version = "1.2.2"; + version = "1.3.2"; src = fetchFromGitHub { owner = "sigstore"; repo = "rekor"; rev = "v${version}"; - hash = "sha256-U7KxkPYVAy3/olXsEgPMX/kzg0KvYMovLO4LWw8guE4="; + hash = "sha256-QiK+ixVURf5Fsx9YPgzYCuCy1wYjxTUXGVr4FIn41Xc="; # populate values that require us to use git. By doing this in postFetch we # can delete .git afterwards and maintain better reproducibility of the src. leaveDotGit = true; @@ -23,7 +23,7 @@ let ''; }; - vendorHash = "sha256-hZyoVlNrPKE6ub94jVEOLGvxWoXKxFYcsEZyRrZuNkQ="; + vendorHash = "sha256-0379IX5W51Z48CffK1F2ZCPGLUq0g8lZXIQqaupC5io="; nativeBuildInputs = [ installShellFiles ]; diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index 2c8b406ef327..bea18dd36a43 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -12640,7 +12640,7 @@ with pkgs; rewrk = callPackage ../tools/networking/rewrk { }; - inherit (callPackage ../tools/security/rekor { }) + inherit (callPackage ../tools/security/rekor { buildGoModule = buildGo121Module; }) rekor-cli rekor-server; From 57db0508e65f41ce9c248d67880d7d90b80fb686 Mon Sep 17 00:00:00 2001 From: Madoura Date: Tue, 17 Oct 2023 00:52:44 -0500 Subject: [PATCH 033/222] rocmPackages.rocmUpdateScript: use 'releases/latest' by default --- pkgs/development/rocm-modules/5/update.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/rocm-modules/5/update.nix b/pkgs/development/rocm-modules/5/update.nix index 1cc7e354d240..e20697675c11 100644 --- a/pkgs/development/rocm-modules/5/update.nix +++ b/pkgs/development/rocm-modules/5/update.nix @@ -5,8 +5,8 @@ { name ? "" , owner ? "" , repo ? "" -, page ? "releases?per_page=1" -, filter ? ".[0].tag_name | split(\"-\") | .[1]" +, page ? "releases/latest" +, filter ? ".tag_name | split(\"-\") | .[1]" }: let From 79b7cbd55d0f0cf517069d6447227c1b9b11a1da Mon Sep 17 00:00:00 2001 From: Madoura Date: Tue, 17 Oct 2023 00:45:38 -0500 Subject: [PATCH 034/222] rocmPackages.rocm-cmake: no need to specify page/filter now --- pkgs/development/rocm-modules/5/rocm-cmake/default.nix | 2 -- 1 file changed, 2 deletions(-) diff --git a/pkgs/development/rocm-modules/5/rocm-cmake/default.nix b/pkgs/development/rocm-modules/5/rocm-cmake/default.nix index 04ae947d3a4a..9e9cf3caf12e 100644 --- a/pkgs/development/rocm-modules/5/rocm-cmake/default.nix +++ b/pkgs/development/rocm-modules/5/rocm-cmake/default.nix @@ -22,8 +22,6 @@ stdenv.mkDerivation (finalAttrs: { name = finalAttrs.pname; owner = finalAttrs.src.owner; repo = finalAttrs.src.repo; - page = "releases?per_page=2"; - filter = ".[1].tag_name | split(\"-\") | .[1]"; }; meta = with lib; { From 26b379fbbaa6a03425e5c52e9ac6a93e573bf09b Mon Sep 17 00:00:00 2001 From: Madoura Date: Tue, 17 Oct 2023 01:18:14 -0500 Subject: [PATCH 035/222] rocmPackages.clr: use tags for update script --- pkgs/development/rocm-modules/5/clr/default.nix | 2 ++ 1 file changed, 2 insertions(+) diff --git a/pkgs/development/rocm-modules/5/clr/default.nix b/pkgs/development/rocm-modules/5/clr/default.nix index 8a5d695e2b4c..5e4039586211 100644 --- a/pkgs/development/rocm-modules/5/clr/default.nix +++ b/pkgs/development/rocm-modules/5/clr/default.nix @@ -144,6 +144,8 @@ in stdenv.mkDerivation (finalAttrs: { name = finalAttrs.pname; owner = finalAttrs.src.owner; repo = finalAttrs.src.repo; + page = "tags?per_page=1"; + filter = ".[0].name | split(\"-\") | .[1]"; }; impureTests = { From 39b6fcc8c72dc7d52955076cbe01d76c7140424c Mon Sep 17 00:00:00 2001 From: Madoura Date: Tue, 17 Oct 2023 05:53:19 +0000 Subject: [PATCH 036/222] rocmPackages: 5.7.0 -> 5.7.1 rocmPackages.clang-ocl: 5.7.0 -> 5.7.1 rocmPackages.hip-common: 5.7.0 -> 5.7.1 rocmPackages.half: 5.7.0 -> 5.7.1 rocmPackages.hipcc: 5.7.0 -> 5.7.1 rocmPackages.hipcub: 5.7.0 -> 5.7.1 rocmPackages.hipfft: 5.7.0 -> 5.7.1 rocmPackages.composable_kernel: 5.7.0 -> 5.7.1 rocmPackages.hipblas: 5.7.0 -> 5.7.1 rocmPackages.hiprand: 5.7.0 -> 5.7.1 rocmPackages.hipsolver: 5.7.0 -> 5.7.1 rocmPackages.hipsparse: 5.7.0 -> 5.7.1 rocmPackages.llvm.llvm: 5.7.0 -> 5.7.1 rocmPackages.migraphx: 5.7.0 -> 5.7.1 rocmPackages.hipfort: 5.7.0 -> 5.7.1 rocmPackages.miopen: 5.7.0 -> 5.7.1 rocmPackages.mivisionx: 5.7.0 -> 5.7.1 rocmPackages.hipify: 5.7.0 -> 5.7.1 rocmPackages.rocalution: 5.7.0 -> 5.7.1 rocmPackages.rocblas: 5.7.0 -> 5.7.1 rocmPackages.rdc: 5.7.0 -> 5.7.1 rocmPackages.rocfft: 5.7.0 -> 5.7.1 rocmPackages.rocgdb: 5.7.0 -> 5.7.1 rocmPackages.rccl: 5.7.0 -> 5.7.1 rocmPackages.rocm-comgr: 5.7.0 -> 5.7.1 rocmPackages.rocm-cmake: 5.7.0 -> 5.7.1 rocmPackages.rocm-device-libs: 5.7.0 -> 5.7.1 rocmPackages.rocm-runtime: 5.7.0 -> 5.7.1 rocmPackages.rocm-smi: 5.7.0 -> 5.7.1 rocmPackages.rocm-thunk: 5.7.0 -> 5.7.1 rocmPackages.rocminfo: 5.7.0 -> 5.7.1 rocmPackages.rocmlir: 5.7.0 -> 5.7.1 rocmPackages.rocdbgapi: 5.7.0 -> 5.7.1 rocmPackages.rocprim: 5.7.0 -> 5.7.1 rocmPackages.rocr-debug-agent: 5.7.0 -> 5.7.1 rocmPackages.rocsolver: 5.7.0 -> 5.7.1 rocmPackages.rocm-docs-core: 0.25.0 -> 0.26.0 rocmPackages.rocthrust: 5.7.0 -> 5.7.1 rocmPackages.rocprofiler: 5.7.0 -> 5.7.1 rocmPackages.roctracer: 5.7.0 -> 5.7.1 rocmPackages.rocsparse: 5.7.0 -> 5.7.1 rocmPackages.rpp: 5.7.0 -> 5.7.1 rocmPackages.tensile: 5.7.0 -> 5.7.1 rocmPackages.rocwmma: 5.7.0 -> 5.7.1 rocmPackages.clr: 5.7.0 -> 5.7.1 --- pkgs/development/rocm-modules/5/clang-ocl/default.nix | 2 +- pkgs/development/rocm-modules/5/clr/default.nix | 4 ++-- pkgs/development/rocm-modules/5/composable_kernel/default.nix | 2 +- pkgs/development/rocm-modules/5/half/default.nix | 2 +- pkgs/development/rocm-modules/5/hip-common/default.nix | 2 +- pkgs/development/rocm-modules/5/hipblas/default.nix | 2 +- pkgs/development/rocm-modules/5/hipcc/default.nix | 2 +- pkgs/development/rocm-modules/5/hipcub/default.nix | 2 +- pkgs/development/rocm-modules/5/hipfft/default.nix | 2 +- pkgs/development/rocm-modules/5/hipfort/default.nix | 2 +- pkgs/development/rocm-modules/5/hipify/default.nix | 2 +- pkgs/development/rocm-modules/5/hipsolver/default.nix | 4 ++-- pkgs/development/rocm-modules/5/hipsparse/default.nix | 2 +- pkgs/development/rocm-modules/5/llvm/base.nix | 4 ++-- pkgs/development/rocm-modules/5/migraphx/default.nix | 4 ++-- pkgs/development/rocm-modules/5/miopen/default.nix | 2 +- pkgs/development/rocm-modules/5/mivisionx/default.nix | 4 ++-- pkgs/development/rocm-modules/5/rccl/default.nix | 4 ++-- pkgs/development/rocm-modules/5/rdc/default.nix | 2 +- pkgs/development/rocm-modules/5/rocalution/default.nix | 2 +- pkgs/development/rocm-modules/5/rocblas/default.nix | 2 +- pkgs/development/rocm-modules/5/rocdbgapi/default.nix | 2 +- pkgs/development/rocm-modules/5/rocfft/default.nix | 2 +- pkgs/development/rocm-modules/5/rocgdb/default.nix | 2 +- pkgs/development/rocm-modules/5/rocm-cmake/default.nix | 2 +- pkgs/development/rocm-modules/5/rocm-comgr/default.nix | 2 +- pkgs/development/rocm-modules/5/rocm-device-libs/default.nix | 4 ++-- pkgs/development/rocm-modules/5/rocm-docs-core/default.nix | 4 ++-- pkgs/development/rocm-modules/5/rocm-runtime/default.nix | 2 +- pkgs/development/rocm-modules/5/rocm-smi/default.nix | 4 ++-- pkgs/development/rocm-modules/5/rocm-thunk/default.nix | 2 +- pkgs/development/rocm-modules/5/rocminfo/default.nix | 2 +- pkgs/development/rocm-modules/5/rocmlir/default.nix | 2 +- pkgs/development/rocm-modules/5/rocprim/default.nix | 2 +- pkgs/development/rocm-modules/5/rocprofiler/default.nix | 4 ++-- pkgs/development/rocm-modules/5/rocr-debug-agent/default.nix | 2 +- pkgs/development/rocm-modules/5/rocrand/default.nix | 4 ++-- pkgs/development/rocm-modules/5/rocsolver/default.nix | 2 +- pkgs/development/rocm-modules/5/rocsparse/default.nix | 2 +- pkgs/development/rocm-modules/5/rocthrust/default.nix | 4 ++-- pkgs/development/rocm-modules/5/roctracer/default.nix | 2 +- pkgs/development/rocm-modules/5/rocwmma/default.nix | 4 ++-- pkgs/development/rocm-modules/5/rpp/default.nix | 2 +- pkgs/development/rocm-modules/5/tensile/default.nix | 2 +- 44 files changed, 57 insertions(+), 57 deletions(-) diff --git a/pkgs/development/rocm-modules/5/clang-ocl/default.nix b/pkgs/development/rocm-modules/5/clang-ocl/default.nix index 96fc4945747f..7af83bd2e132 100644 --- a/pkgs/development/rocm-modules/5/clang-ocl/default.nix +++ b/pkgs/development/rocm-modules/5/clang-ocl/default.nix @@ -9,7 +9,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "clang-ocl"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "RadeonOpenCompute"; diff --git a/pkgs/development/rocm-modules/5/clr/default.nix b/pkgs/development/rocm-modules/5/clr/default.nix index 5e4039586211..f12ef2bfc8b5 100644 --- a/pkgs/development/rocm-modules/5/clr/default.nix +++ b/pkgs/development/rocm-modules/5/clr/default.nix @@ -35,7 +35,7 @@ let ]; in stdenv.mkDerivation (finalAttrs: { pname = "clr"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" @@ -46,7 +46,7 @@ in stdenv.mkDerivation (finalAttrs: { owner = "ROCm-Developer-Tools"; repo = "clr"; rev = "rocm-${finalAttrs.version}"; - hash = "sha256-C+rFW/7kf35rz0sQTI2+iY5RhZZQY07fc5a+e6cB5OQ="; + hash = "sha256-1gZJhvBbUFdKH9p/7SRfzEV/fM+gIN2Qvlxf2VbmAIw="; }; nativeBuildInputs = [ diff --git a/pkgs/development/rocm-modules/5/composable_kernel/default.nix b/pkgs/development/rocm-modules/5/composable_kernel/default.nix index 2372b27ebe52..75039fc7d417 100644 --- a/pkgs/development/rocm-modules/5/composable_kernel/default.nix +++ b/pkgs/development/rocm-modules/5/composable_kernel/default.nix @@ -15,7 +15,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "composable_kernel"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/half/default.nix b/pkgs/development/rocm-modules/5/half/default.nix index 08c645848fa2..1ddd06b01449 100644 --- a/pkgs/development/rocm-modules/5/half/default.nix +++ b/pkgs/development/rocm-modules/5/half/default.nix @@ -8,7 +8,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "half"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "ROCmSoftwarePlatform"; diff --git a/pkgs/development/rocm-modules/5/hip-common/default.nix b/pkgs/development/rocm-modules/5/hip-common/default.nix index 9f5f37511ef0..6e2f950c0193 100644 --- a/pkgs/development/rocm-modules/5/hip-common/default.nix +++ b/pkgs/development/rocm-modules/5/hip-common/default.nix @@ -6,7 +6,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "hip-common"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "ROCm-Developer-Tools"; diff --git a/pkgs/development/rocm-modules/5/hipblas/default.nix b/pkgs/development/rocm-modules/5/hipblas/default.nix index b2206c737b00..c604dda46593 100644 --- a/pkgs/development/rocm-modules/5/hipblas/default.nix +++ b/pkgs/development/rocm-modules/5/hipblas/default.nix @@ -18,7 +18,7 @@ # Can also use cuBLAS stdenv.mkDerivation (finalAttrs: { pname = "hipblas"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/hipcc/default.nix b/pkgs/development/rocm-modules/5/hipcc/default.nix index e6610e8909f7..20c428bbf809 100644 --- a/pkgs/development/rocm-modules/5/hipcc/default.nix +++ b/pkgs/development/rocm-modules/5/hipcc/default.nix @@ -8,7 +8,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "hipcc"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "ROCm-Developer-Tools"; diff --git a/pkgs/development/rocm-modules/5/hipcub/default.nix b/pkgs/development/rocm-modules/5/hipcub/default.nix index 447c2c4174af..943a14c379a1 100644 --- a/pkgs/development/rocm-modules/5/hipcub/default.nix +++ b/pkgs/development/rocm-modules/5/hipcub/default.nix @@ -16,7 +16,7 @@ # CUB can also be used as a backend instead of rocPRIM. stdenv.mkDerivation (finalAttrs: { pname = "hipcub"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/hipfft/default.nix b/pkgs/development/rocm-modules/5/hipfft/default.nix index 153a7c8c18cc..b0c5928a192d 100644 --- a/pkgs/development/rocm-modules/5/hipfft/default.nix +++ b/pkgs/development/rocm-modules/5/hipfft/default.nix @@ -21,7 +21,7 @@ # Can also use cuFFT stdenv.mkDerivation (finalAttrs: { pname = "hipfft"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/hipfort/default.nix b/pkgs/development/rocm-modules/5/hipfort/default.nix index 4bb2a270271b..4b6c7c56af41 100644 --- a/pkgs/development/rocm-modules/5/hipfort/default.nix +++ b/pkgs/development/rocm-modules/5/hipfort/default.nix @@ -9,7 +9,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "hipfort"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "ROCmSoftwarePlatform"; diff --git a/pkgs/development/rocm-modules/5/hipify/default.nix b/pkgs/development/rocm-modules/5/hipify/default.nix index 893056496c9c..e553c0e385a5 100644 --- a/pkgs/development/rocm-modules/5/hipify/default.nix +++ b/pkgs/development/rocm-modules/5/hipify/default.nix @@ -9,7 +9,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "hipify"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "ROCm-Developer-Tools"; diff --git a/pkgs/development/rocm-modules/5/hipsolver/default.nix b/pkgs/development/rocm-modules/5/hipsolver/default.nix index 34592a5bbd96..9c5c1cad2207 100644 --- a/pkgs/development/rocm-modules/5/hipsolver/default.nix +++ b/pkgs/development/rocm-modules/5/hipsolver/default.nix @@ -18,7 +18,7 @@ # Can also use cuSOLVER stdenv.mkDerivation (finalAttrs: { pname = "hipsolver"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" @@ -34,7 +34,7 @@ stdenv.mkDerivation (finalAttrs: { owner = "ROCmSoftwarePlatform"; repo = "hipSOLVER"; rev = "rocm-${finalAttrs.version}"; - hash = "sha256-I9Xjkilo+baeM1CRXjLAbj/vrg8r5/E2yEImhHGSyf8="; + hash = "sha256-5b6kPj9yvXvP7f7AyHDTYRoM/EhQZvwkVCfDflFJugc="; }; nativeBuildInputs = [ diff --git a/pkgs/development/rocm-modules/5/hipsparse/default.nix b/pkgs/development/rocm-modules/5/hipsparse/default.nix index 79b78f3661d8..0e77079348b3 100644 --- a/pkgs/development/rocm-modules/5/hipsparse/default.nix +++ b/pkgs/development/rocm-modules/5/hipsparse/default.nix @@ -18,7 +18,7 @@ # This can also use cuSPARSE as a backend instead of rocSPARSE stdenv.mkDerivation (finalAttrs: { pname = "hipsparse"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/llvm/base.nix b/pkgs/development/rocm-modules/5/llvm/base.nix index 655192d892bb..82de9e6f3665 100644 --- a/pkgs/development/rocm-modules/5/llvm/base.nix +++ b/pkgs/development/rocm-modules/5/llvm/base.nix @@ -53,7 +53,7 @@ let llvmTargetsToBuild' = [ "AMDGPU" ] ++ builtins.map inferNativeTarget llvmTargetsToBuild; in stdenv.mkDerivation (finalAttrs: { pname = "rocm-llvm-${targetName}"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" @@ -70,7 +70,7 @@ in stdenv.mkDerivation (finalAttrs: { owner = "RadeonOpenCompute"; repo = "llvm-project"; rev = "rocm-${finalAttrs.version}"; - hash = "sha256-oJIXALwxo130jl8b6yCFw+a2kMBlny5/0ubiqF6MOWY="; + hash = "sha256-0+lJnDiMntxCYbZBCSWvHOcKXexFfEzRfb49QbfOmK8="; }; nativeBuildInputs = [ diff --git a/pkgs/development/rocm-modules/5/migraphx/default.nix b/pkgs/development/rocm-modules/5/migraphx/default.nix index 5842cd1695d5..dc84e526823f 100644 --- a/pkgs/development/rocm-modules/5/migraphx/default.nix +++ b/pkgs/development/rocm-modules/5/migraphx/default.nix @@ -49,7 +49,7 @@ let }; in stdenv.mkDerivation (finalAttrs: { pname = "migraphx"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" @@ -63,7 +63,7 @@ in stdenv.mkDerivation (finalAttrs: { owner = "ROCmSoftwarePlatform"; repo = "AMDMIGraphX"; rev = "rocm-${finalAttrs.version}"; - hash = "sha256-7yL7Zn5I8GUPIAgB7tVLZI7OEHLv0E4FcLVx9xMfsNY="; + hash = "sha256-lg3pxHBpwqxBvdOQgE44YKLuumhkVF6b3Xx4+cw7jNQ="; }; nativeBuildInputs = [ diff --git a/pkgs/development/rocm-modules/5/miopen/default.nix b/pkgs/development/rocm-modules/5/miopen/default.nix index d22518aa51c6..a9a1cd5abe01 100644 --- a/pkgs/development/rocm-modules/5/miopen/default.nix +++ b/pkgs/development/rocm-modules/5/miopen/default.nix @@ -35,7 +35,7 @@ }: let - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "ROCmSoftwarePlatform"; diff --git a/pkgs/development/rocm-modules/5/mivisionx/default.nix b/pkgs/development/rocm-modules/5/mivisionx/default.nix index d6e198eb4c77..7eac2a4ca497 100644 --- a/pkgs/development/rocm-modules/5/mivisionx/default.nix +++ b/pkgs/development/rocm-modules/5/mivisionx/default.nix @@ -38,13 +38,13 @@ stdenv.mkDerivation (finalAttrs: { else "cpu" ); - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "GPUOpen-ProfessionalCompute-Libraries"; repo = "MIVisionX"; rev = "rocm-${finalAttrs.version}"; - hash = "sha256-Z7UIqJWuSD+/FoZ1VIbITp4R/bwaqFCQqsL8CRW73Ek="; + hash = "sha256-jmOgwESNALQt7ctmUY9JHgKq47tCwsW1ybynkX9236U="; }; nativeBuildInputs = [ diff --git a/pkgs/development/rocm-modules/5/rccl/default.nix b/pkgs/development/rocm-modules/5/rccl/default.nix index d4045252bae4..3f011d3fdfac 100644 --- a/pkgs/development/rocm-modules/5/rccl/default.nix +++ b/pkgs/development/rocm-modules/5/rccl/default.nix @@ -16,7 +16,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rccl"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" @@ -28,7 +28,7 @@ stdenv.mkDerivation (finalAttrs: { owner = "ROCmSoftwarePlatform"; repo = "rccl"; rev = "rocm-${finalAttrs.version}"; - hash = "sha256-Abrwmsjnkx9JVTrARP/BM965g+R10lY+XPwthy/SG0k="; + hash = "sha256-nFkou/kjGBmImorlPOZNTlCrxbfAYpDhgRveyoAufu8="; }; nativeBuildInputs = [ diff --git a/pkgs/development/rocm-modules/5/rdc/default.nix b/pkgs/development/rocm-modules/5/rdc/default.nix index 134b946c5f7a..abdd121bce3c 100644 --- a/pkgs/development/rocm-modules/5/rdc/default.nix +++ b/pkgs/development/rocm-modules/5/rdc/default.nix @@ -41,7 +41,7 @@ let }; in stdenv.mkDerivation (finalAttrs: { pname = "rdc"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/rocalution/default.nix b/pkgs/development/rocm-modules/5/rocalution/default.nix index 80fd655557df..2a0e149bb3e9 100644 --- a/pkgs/development/rocm-modules/5/rocalution/default.nix +++ b/pkgs/development/rocm-modules/5/rocalution/default.nix @@ -21,7 +21,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocalution"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/rocblas/default.nix b/pkgs/development/rocm-modules/5/rocblas/default.nix index 17732fd51681..ca6a9e6e723a 100644 --- a/pkgs/development/rocm-modules/5/rocblas/default.nix +++ b/pkgs/development/rocm-modules/5/rocblas/default.nix @@ -73,7 +73,7 @@ let fallbacks = rocblas.overrideAttrs { pname = "rocblas-tensile-fallbacks"; }; in stdenv.mkDerivation (finalAttrs: { pname = "rocblas"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/rocdbgapi/default.nix b/pkgs/development/rocm-modules/5/rocdbgapi/default.nix index 41c1178f1089..aef89d2330d1 100644 --- a/pkgs/development/rocm-modules/5/rocdbgapi/default.nix +++ b/pkgs/development/rocm-modules/5/rocdbgapi/default.nix @@ -38,7 +38,7 @@ let }; in stdenv.mkDerivation (finalAttrs: { pname = "rocdbgapi"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/rocfft/default.nix b/pkgs/development/rocm-modules/5/rocfft/default.nix index ac50318622ce..309a7f2fe224 100644 --- a/pkgs/development/rocm-modules/5/rocfft/default.nix +++ b/pkgs/development/rocm-modules/5/rocfft/default.nix @@ -19,7 +19,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocfft"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "ROCmSoftwarePlatform"; diff --git a/pkgs/development/rocm-modules/5/rocgdb/default.nix b/pkgs/development/rocm-modules/5/rocgdb/default.nix index a2f4435ee7bc..facec0cf16d3 100644 --- a/pkgs/development/rocm-modules/5/rocgdb/default.nix +++ b/pkgs/development/rocm-modules/5/rocgdb/default.nix @@ -15,7 +15,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocgdb"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "ROCm-Developer-Tools"; diff --git a/pkgs/development/rocm-modules/5/rocm-cmake/default.nix b/pkgs/development/rocm-modules/5/rocm-cmake/default.nix index 9e9cf3caf12e..d88912154f8b 100644 --- a/pkgs/development/rocm-modules/5/rocm-cmake/default.nix +++ b/pkgs/development/rocm-modules/5/rocm-cmake/default.nix @@ -7,7 +7,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocm-cmake"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "RadeonOpenCompute"; diff --git a/pkgs/development/rocm-modules/5/rocm-comgr/default.nix b/pkgs/development/rocm-modules/5/rocm-comgr/default.nix index c3c4c5fab3cd..8411c4d53cb3 100644 --- a/pkgs/development/rocm-modules/5/rocm-comgr/default.nix +++ b/pkgs/development/rocm-modules/5/rocm-comgr/default.nix @@ -15,7 +15,7 @@ let else throw "Unsupported ROCm LLVM platform"; in stdenv.mkDerivation (finalAttrs: { pname = "rocm-comgr"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "RadeonOpenCompute"; diff --git a/pkgs/development/rocm-modules/5/rocm-device-libs/default.nix b/pkgs/development/rocm-modules/5/rocm-device-libs/default.nix index 594e21031284..844f38a9a4b2 100644 --- a/pkgs/development/rocm-modules/5/rocm-device-libs/default.nix +++ b/pkgs/development/rocm-modules/5/rocm-device-libs/default.nix @@ -14,13 +14,13 @@ let else throw "Unsupported ROCm LLVM platform"; in stdenv.mkDerivation (finalAttrs: { pname = "rocm-device-libs"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "RadeonOpenCompute"; repo = "ROCm-Device-Libs"; rev = "rocm-${finalAttrs.version}"; - hash = "sha256-f6/LAhJ2mBDO1/JloHvl7MJyDo3WutbXd4IDknA9nzM="; + hash = "sha256-ARxs/yqyVoIUWliJkINzitumF+64/5u3fbB0tHB5hPU="; }; patches = [ ./cmake.patch ]; diff --git a/pkgs/development/rocm-modules/5/rocm-docs-core/default.nix b/pkgs/development/rocm-modules/5/rocm-docs-core/default.nix index 65d21daa5b50..220e89fe71d2 100644 --- a/pkgs/development/rocm-modules/5/rocm-docs-core/default.nix +++ b/pkgs/development/rocm-modules/5/rocm-docs-core/default.nix @@ -22,14 +22,14 @@ buildPythonPackage rec { pname = "rocm-docs-core"; - version = "0.25.0"; + version = "0.26.0"; format = "pyproject"; src = fetchFromGitHub { owner = "RadeonOpenCompute"; repo = "rocm-docs-core"; rev = "v${version}"; - hash = "sha256-kOsoIK0vaPT60hGr960s5vc0eloSr5CECtd8Dy24YuM="; + hash = "sha256-Mr6/Ne6P+TapoCqN7xkKMNse3fTaIAvvLmMl0kVg7Vs="; }; buildInputs = [ setuptools ]; diff --git a/pkgs/development/rocm-modules/5/rocm-runtime/default.nix b/pkgs/development/rocm-modules/5/rocm-runtime/default.nix index fd9182c8254d..79174c7032f0 100644 --- a/pkgs/development/rocm-modules/5/rocm-runtime/default.nix +++ b/pkgs/development/rocm-modules/5/rocm-runtime/default.nix @@ -16,7 +16,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocm-runtime"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "RadeonOpenCompute"; diff --git a/pkgs/development/rocm-modules/5/rocm-smi/default.nix b/pkgs/development/rocm-modules/5/rocm-smi/default.nix index 2e1692539e23..66c1c765c13f 100644 --- a/pkgs/development/rocm-modules/5/rocm-smi/default.nix +++ b/pkgs/development/rocm-modules/5/rocm-smi/default.nix @@ -8,13 +8,13 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocm-smi"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "RadeonOpenCompute"; repo = "rocm_smi_lib"; rev = "rocm-${finalAttrs.version}"; - hash = "sha256-swCRO4PBMBJ6fO2bLq/xxFZIYw2IgiFB490wsU8Wm2o="; + hash = "sha256-NZR4jBgKVfpkRNQFPmav1yCZF872LkcrPBNNcBVTLDU="; }; patches = [ ./cmake.patch ]; diff --git a/pkgs/development/rocm-modules/5/rocm-thunk/default.nix b/pkgs/development/rocm-modules/5/rocm-thunk/default.nix index 73368dbb0e7f..98fbc56517f9 100644 --- a/pkgs/development/rocm-modules/5/rocm-thunk/default.nix +++ b/pkgs/development/rocm-modules/5/rocm-thunk/default.nix @@ -10,7 +10,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocm-thunk"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "RadeonOpenCompute"; diff --git a/pkgs/development/rocm-modules/5/rocminfo/default.nix b/pkgs/development/rocm-modules/5/rocminfo/default.nix index c9ff79e380ff..c80dbc4aeacf 100644 --- a/pkgs/development/rocm-modules/5/rocminfo/default.nix +++ b/pkgs/development/rocm-modules/5/rocminfo/default.nix @@ -18,7 +18,7 @@ }: stdenv.mkDerivation (finalAttrs: { - version = "5.7.0"; + version = "5.7.1"; pname = "rocminfo"; src = fetchFromGitHub { diff --git a/pkgs/development/rocm-modules/5/rocmlir/default.nix b/pkgs/development/rocm-modules/5/rocmlir/default.nix index 9b24112dce8a..74fe00e781cc 100644 --- a/pkgs/development/rocm-modules/5/rocmlir/default.nix +++ b/pkgs/development/rocm-modules/5/rocmlir/default.nix @@ -32,7 +32,7 @@ let else throw "Unsupported ROCm LLVM platform"; in stdenv.mkDerivation (finalAttrs: { pname = "rocmlir${suffix}"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/rocprim/default.nix b/pkgs/development/rocm-modules/5/rocprim/default.nix index 1dd2555c6915..10d1f187ba73 100644 --- a/pkgs/development/rocm-modules/5/rocprim/default.nix +++ b/pkgs/development/rocm-modules/5/rocprim/default.nix @@ -14,7 +14,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocprim"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/rocprofiler/default.nix b/pkgs/development/rocm-modules/5/rocprofiler/default.nix index ec24a3f41e59..c77014b50cfd 100644 --- a/pkgs/development/rocm-modules/5/rocprofiler/default.nix +++ b/pkgs/development/rocm-modules/5/rocprofiler/default.nix @@ -33,13 +33,13 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocprofiler"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "ROCm-Developer-Tools"; repo = "rocprofiler"; rev = "rocm-${finalAttrs.version}"; - hash = "sha256-ue/2uiLbhOv/5XY4cIJuZ8DUMRhniYgxolq9xMwO1FY="; + hash = "sha256-1s/7C9y+73ADLF/17Vepw0pZNVtYnKoP24GdwKc9X2Y="; }; nativeBuildInputs = [ diff --git a/pkgs/development/rocm-modules/5/rocr-debug-agent/default.nix b/pkgs/development/rocm-modules/5/rocr-debug-agent/default.nix index dfc8580b3e14..6dd0ec45b3b6 100644 --- a/pkgs/development/rocm-modules/5/rocr-debug-agent/default.nix +++ b/pkgs/development/rocm-modules/5/rocr-debug-agent/default.nix @@ -11,7 +11,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocr-debug-agent"; - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "ROCm-Developer-Tools"; diff --git a/pkgs/development/rocm-modules/5/rocrand/default.nix b/pkgs/development/rocm-modules/5/rocrand/default.nix index 954a299e317e..d61b95394cab 100644 --- a/pkgs/development/rocm-modules/5/rocrand/default.nix +++ b/pkgs/development/rocm-modules/5/rocrand/default.nix @@ -14,7 +14,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocrand"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" @@ -28,7 +28,7 @@ stdenv.mkDerivation (finalAttrs: { owner = "ROCmSoftwarePlatform"; repo = "rocRAND"; rev = "rocm-${finalAttrs.version}"; - hash = "sha256-cFH38fLD8tk6V9JERcqHokuwKemdDgHCZ75bZNEqmdY="; + hash = "sha256-VrpiHlZZQH+IOoaEDuDOfRgnMiqm1bpRIuNyrPz2SGY="; fetchSubmodules = true; # For inline hipRAND }; diff --git a/pkgs/development/rocm-modules/5/rocsolver/default.nix b/pkgs/development/rocm-modules/5/rocsolver/default.nix index 6490870ea48a..ade9c69e534e 100644 --- a/pkgs/development/rocm-modules/5/rocsolver/default.nix +++ b/pkgs/development/rocm-modules/5/rocsolver/default.nix @@ -18,7 +18,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocsolver"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/rocsparse/default.nix b/pkgs/development/rocm-modules/5/rocsparse/default.nix index 945e03c0bc8b..e19334df1514 100644 --- a/pkgs/development/rocm-modules/5/rocsparse/default.nix +++ b/pkgs/development/rocm-modules/5/rocsparse/default.nix @@ -19,7 +19,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocsparse"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/rocthrust/default.nix b/pkgs/development/rocm-modules/5/rocthrust/default.nix index b80b161f5799..4fe2e0828a16 100644 --- a/pkgs/development/rocm-modules/5/rocthrust/default.nix +++ b/pkgs/development/rocm-modules/5/rocthrust/default.nix @@ -14,7 +14,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocthrust"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" @@ -28,7 +28,7 @@ stdenv.mkDerivation (finalAttrs: { owner = "ROCmSoftwarePlatform"; repo = "rocThrust"; rev = "rocm-${finalAttrs.version}"; - hash = "sha256-i0XCtJth8caVQT5oUgsxWXNzcePa02Gb7AQsthYTOv8="; + hash = "sha256-+bcHcA87IToTcII7N/hm81C/JiokJKj0M1yAph/x9Qc="; }; nativeBuildInputs = [ diff --git a/pkgs/development/rocm-modules/5/roctracer/default.nix b/pkgs/development/rocm-modules/5/roctracer/default.nix index 92e557426b10..41491bc22345 100644 --- a/pkgs/development/rocm-modules/5/roctracer/default.nix +++ b/pkgs/development/rocm-modules/5/roctracer/default.nix @@ -19,7 +19,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "roctracer"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" diff --git a/pkgs/development/rocm-modules/5/rocwmma/default.nix b/pkgs/development/rocm-modules/5/rocwmma/default.nix index 71d0e3fbe793..e982e036c477 100644 --- a/pkgs/development/rocm-modules/5/rocwmma/default.nix +++ b/pkgs/development/rocm-modules/5/rocwmma/default.nix @@ -18,7 +18,7 @@ stdenv.mkDerivation (finalAttrs: { pname = "rocwmma"; - version = "5.7.0"; + version = "5.7.1"; outputs = [ "out" @@ -34,7 +34,7 @@ stdenv.mkDerivation (finalAttrs: { owner = "ROCmSoftwarePlatform"; repo = "rocWMMA"; rev = "rocm-${finalAttrs.version}"; - hash = "sha256-/EuBBSjhlMwJfsqYvRb9oCNC0hNkEa1JH1KUDLMSs08="; + hash = "sha256-0otJxgVYLwvVYIWT/hjrrpuSj5jslP1dbJRt6GUOrDs="; }; patches = lib.optionals (buildTests || buildBenchmarks) [ diff --git a/pkgs/development/rocm-modules/5/rpp/default.nix b/pkgs/development/rocm-modules/5/rpp/default.nix index eee10f2ab7c8..a9456587ff3b 100644 --- a/pkgs/development/rocm-modules/5/rpp/default.nix +++ b/pkgs/development/rocm-modules/5/rpp/default.nix @@ -23,7 +23,7 @@ stdenv.mkDerivation (finalAttrs: { else "cpu" ); - version = "5.7.0"; + version = "5.7.1"; src = fetchFromGitHub { owner = "GPUOpen-ProfessionalCompute-Libraries"; diff --git a/pkgs/development/rocm-modules/5/tensile/default.nix b/pkgs/development/rocm-modules/5/tensile/default.nix index 86dbaa95e192..fa111c056c5c 100644 --- a/pkgs/development/rocm-modules/5/tensile/default.nix +++ b/pkgs/development/rocm-modules/5/tensile/default.nix @@ -15,7 +15,7 @@ buildPythonPackage rec { pname = "tensile"; - version = "5.7.0"; + version = "5.7.1"; format = "pyproject"; src = fetchFromGitHub { From 6f3f5b64f2cb52294097f9b2b74762cb7776c95e Mon Sep 17 00:00:00 2001 From: Madoura Date: Tue, 17 Oct 2023 03:18:15 -0500 Subject: [PATCH 037/222] rocmPackages.roctracer: make roctracer free again --- pkgs/development/python-modules/torch/default.nix | 3 +-- pkgs/development/rocm-modules/5/default.nix | 3 +-- pkgs/development/rocm-modules/5/roctracer/default.nix | 6 ++---- 3 files changed, 4 insertions(+), 8 deletions(-) diff --git a/pkgs/development/python-modules/torch/default.nix b/pkgs/development/python-modules/torch/default.nix index 65131548e5db..9dcb9c6c266c 100644 --- a/pkgs/development/python-modules/torch/default.nix +++ b/pkgs/development/python-modules/torch/default.nix @@ -95,8 +95,7 @@ let paths = with rocmPackages; [ rocm-core clr rccl miopen miopengemm rocrand rocblas - rocsparse hipsparse rocthrust rocprim hipcub - roctracer # Unfree at the moment due to hsa-amd-aqlprofile hard dependency in rocprofiler + rocsparse hipsparse rocthrust rocprim hipcub roctracer rocfft rocsolver hipfft hipsolver hipblas rocminfo rocm-thunk rocm-comgr rocm-device-libs rocm-runtime clr.icd hipify diff --git a/pkgs/development/rocm-modules/5/default.nix b/pkgs/development/rocm-modules/5/default.nix index 6e263998dbe6..3229d7b077a0 100644 --- a/pkgs/development/rocm-modules/5/default.nix +++ b/pkgs/development/rocm-modules/5/default.nix @@ -111,8 +111,7 @@ in rec { # Needs GCC roctracer = callPackage ./roctracer { - inherit rocmUpdateScript rocm-device-libs rocm-runtime rocprofiler clr; - inherit (llvm) clang; + inherit rocmUpdateScript rocm-device-libs rocm-runtime clr; }; # Needs GCC diff --git a/pkgs/development/rocm-modules/5/roctracer/default.nix b/pkgs/development/rocm-modules/5/roctracer/default.nix index 41491bc22345..7be3ea0f7505 100644 --- a/pkgs/development/rocm-modules/5/roctracer/default.nix +++ b/pkgs/development/rocm-modules/5/roctracer/default.nix @@ -3,14 +3,13 @@ , fetchFromGitHub , rocmUpdateScript , cmake -, clang , clr , rocm-device-libs -, rocprofiler , libxml2 , doxygen , graphviz , gcc-unwrapped +, libbacktrace , rocm-runtime , python3Packages , buildDocs ? false # Nothing seems to be generated, so not making the output @@ -38,7 +37,6 @@ stdenv.mkDerivation (finalAttrs: { nativeBuildInputs = [ cmake - clang clr ] ++ lib.optionals buildDocs [ doxygen @@ -46,8 +44,8 @@ stdenv.mkDerivation (finalAttrs: { ]; buildInputs = [ - rocprofiler libxml2 + libbacktrace python3Packages.python python3Packages.cppheaderparser ]; From 713796cf47d3585bdf63ded8e3a3d04880332629 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?=E5=8C=97=E9=9B=81=20Cryolitia?= Date: Wed, 18 Oct 2023 08:28:02 +0800 Subject: [PATCH 038/222] nordic: complement buildInputs --- pkgs/data/themes/nordic/default.nix | 10 ++++++++++ 1 file changed, 10 insertions(+) diff --git a/pkgs/data/themes/nordic/default.nix b/pkgs/data/themes/nordic/default.nix index 8d977671fe7d..c8e956c3f83d 100644 --- a/pkgs/data/themes/nordic/default.nix +++ b/pkgs/data/themes/nordic/default.nix @@ -3,6 +3,7 @@ , fetchFromGitHub , gtk-engine-murrine , jdupes +, libsForQt5 }: stdenv.mkDerivation rec { @@ -79,6 +80,15 @@ stdenv.mkDerivation rec { nativeBuildInputs = [ jdupes ]; + buildInputs = with libsForQt5; [ + plasma-framework + qtgraphicaleffects + plasma-workspace + breeze-icons + ]; + + dontWrapQtApps = true; + propagatedUserEnvPkgs = [ gtk-engine-murrine ]; installPhase = '' From c74a14e9605b3240fd9d3e1f17635a04986cadc1 Mon Sep 17 00:00:00 2001 From: Emily Trau Date: Wed, 18 Oct 2023 03:05:17 +0000 Subject: [PATCH 039/222] mrustc: 0.10 -> 0.10.1 --- pkgs/development/compilers/mrustc/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/development/compilers/mrustc/default.nix b/pkgs/development/compilers/mrustc/default.nix index 6570199f8523..eae17cbce91f 100644 --- a/pkgs/development/compilers/mrustc/default.nix +++ b/pkgs/development/compilers/mrustc/default.nix @@ -4,9 +4,9 @@ }: let - version = "0.10"; + version = "0.10.1"; tag = "v${version}"; - rev = "b364724f15fd6fce8234ad8add68107c23a22151"; + rev = "b6754f574f8846eb842feba4ccbeeecb10bdfacc"; in stdenv.mkDerivation rec { @@ -18,7 +18,7 @@ stdenv.mkDerivation rec { owner = "thepowersgang"; repo = "mrustc"; rev = tag; - sha256 = "0f7kh4n2663sn0z3xib8gzw0s97qpvwag40g2vs3bfjlrbpgi9z0"; + hash = "sha256-sYnx5dUTaQbK4ugnSzAJwIUwZKPUhThmNA+WlY+LEWc="; }; postPatch = '' From 8ead438ce81e71cdb1b2182e48615deaf27dcfdc Mon Sep 17 00:00:00 2001 From: Claudi Date: Tue, 17 Oct 2023 15:58:20 +0200 Subject: [PATCH 040/222] obsidian: 1.4.14 -> 1.4.16 --- pkgs/applications/misc/obsidian/default.nix | 4 ++-- pkgs/top-level/all-packages.nix | 2 +- 2 files changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/applications/misc/obsidian/default.nix b/pkgs/applications/misc/obsidian/default.nix index 78967c55a5d7..43ea198d62c9 100644 --- a/pkgs/applications/misc/obsidian/default.nix +++ b/pkgs/applications/misc/obsidian/default.nix @@ -12,7 +12,7 @@ let inherit (stdenv.hostPlatform) system; pname = "obsidian"; - version = "1.4.14"; + version = "1.4.16"; appname = "Obsidian"; meta = with lib; { description = "A powerful knowledge base that works on top of a local folder of plain text Markdown files"; @@ -25,7 +25,7 @@ let filename = if stdenv.isDarwin then "Obsidian-${version}-universal.dmg" else "obsidian-${version}.tar.gz"; src = fetchurl { url = "https://github.com/obsidianmd/obsidian-releases/releases/download/v${version}/${filename}"; - hash = if stdenv.isDarwin then "sha256-5cVKlZJDtXOkil+RohijCcqyJVTrysmqyTvJR0dDAuc=" else "sha256-qFSQer37Nkh3A3oVAFP/0qXzPWJ7SqY2GYA6b1iaYmE="; + hash = if stdenv.isDarwin then "sha256-ydLWr+Snkza9G+R7HbPuUdoZsL25Uj+KDos67Mq/urY=" else "sha256-PBKLGs3MZyarSMiWnjqY7d9bQrKu2uLAvLUufpHLxcw="; }; icon = fetchurl { diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index 6ee46ee11644..b75fd9671f07 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -34420,7 +34420,7 @@ with pkgs; wrapOBS = callPackage ../applications/video/obs-studio/wrapper.nix { }; obsidian = callPackage ../applications/misc/obsidian { - electron = electron_24; + electron = electron_25; }; octoprint = callPackage ../applications/misc/octoprint { }; From 2d9d250d08b26703894bdc865f0862b78d636951 Mon Sep 17 00:00:00 2001 From: DS Date: Wed, 18 Oct 2023 05:40:30 -0700 Subject: [PATCH 041/222] maintainers: add danielsidhion --- maintainers/maintainer-list.nix | 6 ++++++ 1 file changed, 6 insertions(+) diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix index f1310e137680..8ace384cff32 100644 --- a/maintainers/maintainer-list.nix +++ b/maintainers/maintainer-list.nix @@ -3880,6 +3880,12 @@ githubId = 50051176; name = "Daniel Rolls"; }; + danielsidhion = { + email = "nixpkgs@sidhion.com"; + github = "DanielSidhion"; + githubId = 160084; + name = "Daniel Sidhion"; + }; daniyalsuri6 = { email = "daniyal.suri@gmail.com"; github = "daniyalsuri6"; From 19bbd0299d099d38e5e2105feaabf85dd869da33 Mon Sep 17 00:00:00 2001 From: YMSTNT <21342713+YMSTNT@users.noreply.github.com> Date: Wed, 18 Oct 2023 21:06:43 +0200 Subject: [PATCH 042/222] maintainers: add ymstnt --- maintainers/maintainer-list.nix | 5 +++++ 1 file changed, 5 insertions(+) diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix index d77fc7eb26c1..97887c332cd8 100644 --- a/maintainers/maintainer-list.nix +++ b/maintainers/maintainer-list.nix @@ -19209,6 +19209,11 @@ github = "ymeister"; githubId = 47071325; }; + ymstnt = { + name = "YMSTNT"; + github = "ymstnt"; + githubId = 21342713; + }; yoavlavi = { email = "yoav@yoavlavi.com"; github = "yoav-lavi"; From b3dc7eafcd82f01a3fc4451e0af17330032fb4f6 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Wed, 18 Oct 2023 19:29:16 +0000 Subject: [PATCH 043/222] requestly: 1.5.6 -> 1.5.12 --- pkgs/tools/networking/requestly/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/tools/networking/requestly/default.nix b/pkgs/tools/networking/requestly/default.nix index 33d03140c398..3a4128c0806d 100644 --- a/pkgs/tools/networking/requestly/default.nix +++ b/pkgs/tools/networking/requestly/default.nix @@ -5,11 +5,11 @@ let pname = "requestly"; - version = "1.5.6"; + version = "1.5.12"; src = fetchurl { url = "https://github.com/requestly/requestly-desktop-app/releases/download/v${version}/Requestly-${version}.AppImage"; - hash = "sha256-Yb90OGIIvExfNPoJPmuZSvtU5OQVuGqh4EmyKltE+is="; + hash = "sha256-HM3+j9E67J1bAklnDtSN5/rOK9Wn7N7h+qlPKR/E8Ns="; }; appimageContents = appimageTools.extractType2 { inherit pname version src; }; From c7c632d6f0e381b2a3dbdf2f329aebee3fce11aa Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Wed, 18 Oct 2023 20:01:05 +0000 Subject: [PATCH 044/222] rizin: 0.6.2 -> 0.6.3 --- pkgs/development/tools/analysis/rizin/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/tools/analysis/rizin/default.nix b/pkgs/development/tools/analysis/rizin/default.nix index e6b20bd5e159..d4bd1e84b112 100644 --- a/pkgs/development/tools/analysis/rizin/default.nix +++ b/pkgs/development/tools/analysis/rizin/default.nix @@ -25,11 +25,11 @@ let rizin = stdenv.mkDerivation rec { pname = "rizin"; - version = "0.6.2"; + version = "0.6.3"; src = fetchurl { url = "https://github.com/rizinorg/rizin/releases/download/v${version}/rizin-src-v${version}.tar.xz"; - hash = "sha256-4poAo+IgBL3RAUbShrHM4OBhltQarkcpqvydeDIf+Gs="; + hash = "sha256-lfZMarnm2qnp+lY0OY649s206/LoFNouTLlp0x9FCcI="; }; mesonFlags = [ From 68766ab4a884bcfb52e5a2b05a8bb812142423a7 Mon Sep 17 00:00:00 2001 From: OPNA2608 Date: Wed, 18 Oct 2023 23:48:09 +0200 Subject: [PATCH 045/222] dbus-cpp: Fix pkg-config file lomiri.mediascanner2 errored due to includedir being a non-existent path. TIL our pkg-config patcher requires ${prefix} to work. --- pkgs/by-name/db/dbus-cpp/package.nix | 4 ++++ 1 file changed, 4 insertions(+) diff --git a/pkgs/by-name/db/dbus-cpp/package.nix b/pkgs/by-name/db/dbus-cpp/package.nix index 6ad4c355b6ad..2e834111c9d9 100644 --- a/pkgs/by-name/db/dbus-cpp/package.nix +++ b/pkgs/by-name/db/dbus-cpp/package.nix @@ -60,6 +60,10 @@ stdenv.mkDerivation (finalAttrs: { # Warning on aarch64-linux breaks build due to -Werror substituteInPlace CMakeLists.txt \ --replace '-Werror' "" + + # pkg-config output patching hook expects prefix variable here + substituteInPlace data/dbus-cpp.pc.in \ + --replace 'includedir=''${exec_prefix}' 'includedir=''${prefix}' '' + lib.optionalString (!finalAttrs.doCheck) '' sed -i -e '/add_subdirectory(tests)/d' CMakeLists.txt ''; From 78d87ea07ce5990de7ad3a004465dc9e4bfe7bc3 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Thu, 19 Oct 2023 04:17:09 +0000 Subject: [PATCH 046/222] ryujinx: 1.1.1044 -> 1.1.1053 --- pkgs/applications/emulators/ryujinx/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/applications/emulators/ryujinx/default.nix b/pkgs/applications/emulators/ryujinx/default.nix index 892e6faaa94c..f4fe6f467abf 100644 --- a/pkgs/applications/emulators/ryujinx/default.nix +++ b/pkgs/applications/emulators/ryujinx/default.nix @@ -28,13 +28,13 @@ buildDotnetModule rec { pname = "ryujinx"; - version = "1.1.1044"; # Based off of the official github actions builds: https://github.com/Ryujinx/Ryujinx/actions/workflows/release.yml + version = "1.1.1053"; # Based off of the official github actions builds: https://github.com/Ryujinx/Ryujinx/actions/workflows/release.yml src = fetchFromGitHub { owner = "Ryujinx"; repo = "Ryujinx"; - rev = "7afae8c69947f7a5fa9a55cee36381aef372dfba"; - sha256 = "1kf95sbb4p50b6bah75sd95660kk2a7cbjwgvqv4c4cal6c126g7"; + rev = "28dd7d80af56701887dbb538b56aa58edaf39d91"; + sha256 = "09h4423z18q8r8fqcd5kv34iwmy9gkmpgw8an8myrhhvkmxi3zwg"; }; dotnet-sdk = dotnetCorePackages.sdk_7_0; From 3d74a09d93f20146dceb4b3c72634b2018a795fd Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Thu, 19 Oct 2023 05:17:55 +0000 Subject: [PATCH 047/222] dasel: 2.3.6 -> 2.4.1 --- pkgs/applications/misc/dasel/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/applications/misc/dasel/default.nix b/pkgs/applications/misc/dasel/default.nix index 04804732edc4..14a8f6013f2b 100644 --- a/pkgs/applications/misc/dasel/default.nix +++ b/pkgs/applications/misc/dasel/default.nix @@ -6,16 +6,16 @@ buildGoModule rec { pname = "dasel"; - version = "2.3.6"; + version = "2.4.1"; src = fetchFromGitHub { owner = "TomWright"; repo = "dasel"; rev = "v${version}"; - sha256 = "sha256-k+I4n05IbQT7tGzkJ0aPW6kLT1mGqwQOwoKDyal8L3w="; + sha256 = "sha256-zxTT/CkSbH40R7itXAx0zD+haHOoMep/W4KfalJQ/8w="; }; - vendorHash = "sha256-Gueo8aZS5N1rLqZweXjXv7BLrtShxGDSGfbkYXhy4DQ="; + vendorHash = "sha256-CbR0uHtha2OoHW9mcB1I2lGJbjerbZARVN/mTstv/Y0="; ldflags = [ "-s" "-w" "-X github.com/tomwright/dasel/v2/internal.Version=${version}" From 23704cce1f1c38fbf68e3ba76d80dad5199204bf Mon Sep 17 00:00:00 2001 From: K900 Date: Thu, 19 Oct 2023 13:10:22 +0300 Subject: [PATCH 048/222] nixos/firefox: preserve old wrapper args when overriding Also some drive-by cleanups --- nixos/modules/programs/firefox.nix | 25 +++++++++++-------------- 1 file changed, 11 insertions(+), 14 deletions(-) diff --git a/nixos/modules/programs/firefox.nix b/nixos/modules/programs/firefox.nix index 83a3edaf813e..99236f01c537 100644 --- a/nixos/modules/programs/firefox.nix +++ b/nixos/modules/programs/firefox.nix @@ -220,23 +220,20 @@ in config = mkIf cfg.enable { environment.systemPackages = [ - (cfg.package.override { + (cfg.package.override (old: { extraPrefs = cfg.autoConfig; - extraNativeMessagingHosts = with pkgs; optionals nmh.ff2mpv [ - ff2mpv - ] ++ optionals nmh.euwebid [ - web-eid-app - ] ++ optionals nmh.gsconnect [ - gnomeExtensions.gsconnect - ] ++ optionals nmh.jabref [ - jabref - ] ++ optionals nmh.passff [ - passff-host - ]; + extraNativeMessagingHosts = + old.extraNativeMessagingHosts or [] + ++ optional nmh.ff2mpv ff2mpv + ++ optional nmh.euwebid web-eid-app + ++ optional nmh.gsconnect gnomeExtensions.gsconnect + ++ optional nmh.jabref jabref + ++ optional nmh.passff passff-host; cfg = let # copy-pasted from the wrapper; TODO: figure out fix applicationName = cfg.package.binaryName or (lib.getName cfg.package); + oldCfg = old.cfg or {}; nixpkgsConfig = pkgs.config.${applicationName} or {}; optionConfig = cfg.wrapperConfig; nmhConfig = { @@ -246,8 +243,8 @@ in enableUgetIntegrator = nmh.ugetIntegrator; enableFXCastBridge = nmh.fxCast; }; - in nixpkgsConfig // optionConfig // nmhConfig; - }) + in oldCfg // nixpkgsConfig // optionConfig // nmhConfig; + })) ]; environment.etc = From 64210945d60c17561f74fa6d2bdc7b1453e18635 Mon Sep 17 00:00:00 2001 From: Anton Mosich Date: Sat, 7 Oct 2023 01:33:13 +0200 Subject: [PATCH 049/222] maintainers: antonmosich: add gpg key --- maintainers/maintainer-list.nix | 3 +++ 1 file changed, 3 insertions(+) diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix index 6c834689f3c7..8086c5144e32 100644 --- a/maintainers/maintainer-list.nix +++ b/maintainers/maintainer-list.nix @@ -1274,6 +1274,9 @@ github = "antonmosich"; githubId = 27223336; name = "Anton Mosich"; + keys = [ { + fingerprint = "F401 287C 324F 0A1C B321 657B 9B96 97B8 FB18 7D14"; + } ]; }; antono = { email = "self@antono.info"; From 1b0ba784ea78388de2b19e98e12b7aa0fd20fc2e Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Thu, 19 Oct 2023 11:47:37 +0000 Subject: [PATCH 050/222] sequoia-sqop: 0.28.0 -> 0.30.0 --- pkgs/tools/security/sequoia-sqop/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/tools/security/sequoia-sqop/default.nix b/pkgs/tools/security/sequoia-sqop/default.nix index f4cae90b546b..fdefbdea9e50 100644 --- a/pkgs/tools/security/sequoia-sqop/default.nix +++ b/pkgs/tools/security/sequoia-sqop/default.nix @@ -9,7 +9,7 @@ rustPlatform.buildRustPackage rec { pname = "sequoia-sqop"; - version = "0.28.0"; + version = "0.30.0"; src = fetchFromGitLab { owner = "sequoia-pgp"; @@ -17,10 +17,10 @@ rustPlatform.buildRustPackage rec { # generated etc repo = "sequoia-sop"; rev = "v${version}"; - hash = "sha256-4A0eZMXzFtojRD5cXQQUVoS32sQ2lWtFll+q6yhnwG4="; + hash = "sha256-2fRlHkT2jhUp1dIqKe8r7ktSbgudCmzuiiyF0WcbYIE="; }; - cargoHash = "sha256-gH5WM+PmciViD+eFVlp8tzdc0KdYy1WZLQi92UEWVG4="; + cargoHash = "sha256-/LLW0AHCgqi2pAOkhZXNGlmNF/+u0TmSstd/B6mDr6M="; nativeBuildInputs = [ pkg-config From 6e1ab5722448765c740493b748422547cf24789e Mon Sep 17 00:00:00 2001 From: DS Date: Wed, 18 Oct 2023 05:59:33 -0700 Subject: [PATCH 051/222] alpine-make-rootfs: init at 0.7.0 --- .../by-name/al/alpine-make-rootfs/package.nix | 33 +++++++++++++++++++ 1 file changed, 33 insertions(+) create mode 100644 pkgs/by-name/al/alpine-make-rootfs/package.nix diff --git a/pkgs/by-name/al/alpine-make-rootfs/package.nix b/pkgs/by-name/al/alpine-make-rootfs/package.nix new file mode 100644 index 000000000000..1fcfc23710a5 --- /dev/null +++ b/pkgs/by-name/al/alpine-make-rootfs/package.nix @@ -0,0 +1,33 @@ +{ stdenvNoCC, lib, fetchFromGitHub, makeWrapper, apk-tools, coreutils, findutils, gnugrep, gnused, gnutar, gzip, rsync, util-linux, wget +}: +stdenvNoCC.mkDerivation rec { + pname = "alpine-make-rootfs"; + version = "0.7.0"; + + src = fetchFromGitHub { + owner = "alpinelinux"; + repo = "alpine-make-rootfs"; + rev = "v${version}"; + hash = "sha256-B5qYQ6ah4hFZfb3S5vwgevh7aEHI3YGLoA+IyipaDck="; + }; + + nativeBuildInputs = [ makeWrapper ]; + + dontBuild = true; + makeFlags = [ "PREFIX=$(out)" ]; + + postInstall = '' + wrapProgram $out/bin/alpine-make-rootfs --set PATH ${lib.makeBinPath [ + apk-tools coreutils findutils gnugrep gnused gnutar gzip rsync util-linux wget + ]} + ''; + + meta = with lib; { + homepage = "https://github.com/alpinelinux/alpine-make-rootfs"; + description = "Make customized Alpine Linux rootfs (base image) for containers"; + mainProgram = "alpine-make-rootfs"; + maintainers = with maintainers; [ danielsidhion ]; + license = licenses.mit; + platforms = platforms.linux; + }; +} From 2ab715d5aa725a19592471b0e26a0cd44cc54d46 Mon Sep 17 00:00:00 2001 From: Sean Buckley Date: Thu, 19 Oct 2023 12:03:26 -0400 Subject: [PATCH 052/222] brave: 1.59.117 -> 1.59.120 https://community.brave.com/t/release-channel-1-59-120/511540 --- pkgs/applications/networking/browsers/brave/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/applications/networking/browsers/brave/default.nix b/pkgs/applications/networking/browsers/brave/default.nix index 8466850808cb..c3495160029f 100644 --- a/pkgs/applications/networking/browsers/brave/default.nix +++ b/pkgs/applications/networking/browsers/brave/default.nix @@ -92,11 +92,11 @@ in stdenv.mkDerivation rec { pname = "brave"; - version = "1.59.117"; + version = "1.59.120"; src = fetchurl { url = "https://github.com/brave/brave-browser/releases/download/v${version}/brave-browser_${version}_amd64.deb"; - sha256 = "sha256-yckxTKAgglk6YRXist9RZufZdI22iitecmb01NmYPGQ="; + sha256 = "sha256-fkIU6XuydF6Bo8V0uS4NObh2fRuKxOWMqVft81uUs9Q="; }; dontConfigure = true; From dae0fd5fa0cf06f17715bb8e49790b81a3a44a22 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Thu, 19 Oct 2023 20:58:29 +0000 Subject: [PATCH 053/222] stm32cubemx: 6.9.1 -> 6.9.2 --- pkgs/development/embedded/stm32/stm32cubemx/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/embedded/stm32/stm32cubemx/default.nix b/pkgs/development/embedded/stm32/stm32cubemx/default.nix index a9384d9b2b8b..e3e0f2672cf2 100644 --- a/pkgs/development/embedded/stm32/stm32cubemx/default.nix +++ b/pkgs/development/embedded/stm32/stm32cubemx/default.nix @@ -13,11 +13,11 @@ let in stdenv.mkDerivation rec { pname = "stm32cubemx"; - version = "6.9.1"; + version = "6.9.2"; src = fetchzip { url = "https://sw-center.st.com/packs/resource/library/stm32cube_mx_v${builtins.replaceStrings ["."] [""] version}-lin.zip"; - sha256 = "sha256-KTbIRj7DkWoC2h/TLKjVduvsKVSue28kGOL34JqBVx4="; + sha256 = "sha256-x3ZRMtTvFGz2/0gJMx4zOx9rSnrSkCEl3pj5raeyVHg="; stripRoot = false; }; From db3731b88799ec90d8ac90f7c85a38aed28ff4d8 Mon Sep 17 00:00:00 2001 From: nixdrin <146267602+nixdrin@users.noreply.github.com> Date: Thu, 19 Oct 2023 23:03:09 +0200 Subject: [PATCH 054/222] chromium: fix libpci GPU detection Chromium has blocklists that workaround various GPU driver bugs, either by forcing software rendering [1] or by disabling use of certain GPU features [2]. These blocklists can only be applied successfully if the GPU vendor and device is detected correctly. One of the methods used for GPU detection is to load libpci.so via dlopen() at runtime to read the PCI vendor and device ID. The current derivation already contains a sed command to rewrite the dlopen() to the absolute path of libpci.so in the Nix store, namely sed -i -e '/libpci_loader.*Load/s!"\(libpci\.so\)!"${pciutils}/lib/\1!' \ gpu/config/gpu_info_collector_linux.cc However, in Chromium 59 (6 years ago), this code was moved into the ANGLE library used by Chromium [3]. This sed command no longer works. There is similar code in ANGLE now [4] that must be similarly patched to ensure the GPU vendor and device is always detected correctly. Without libpci some GPUs are not detected correctly. For example, in a VMWare virtual machine opening chrome://gpu in the browser shows: VENDOR= 0x0000 [Google Inc. (VMware, Inc.)], DEVICE=0x0000 [ANGLE (VMware Inc., SVGA3D; build: RELEASE; LLVM;, OpenGL 4.1 (Core Profile) Mesa 23.0.3)], DRIVER_VENDOR=Mesa, DRIVER_VERSION=23.0.3 *ACTIVE* Note the VENDOR=0x0000 and DEVICE=0x0000. Adding libpci.so to the library path fixes this: VENDOR= 0x15ad [Google Inc. (VMware, Inc.)], DEVICE=0x0405 [ANGLE (VMware Inc., SVGA3D; build: RELEASE; LLVM;, OpenGL 4.1 (Core Profile) Mesa 23.0.3)], DRIVER_VENDOR=Mesa, DRIVER_VERSION=23.0.3 *ACTIVE* Note the VENDOR=0x15ad and DEVICE=0x0405. Also now the blocklist entries are applied correctly, fixing some graphical issues. Fix this by adding pciutils to the rpath set with patchelf. This avoids having to patch lines in the source code that might get moved around. [1]: https://chromium.googlesource.com/chromium/src/+/e52f33f30b91b4ddfad649acddc39ab570473b86/gpu/config/software_rendering_list.json [2]: https://chromium.googlesource.com/chromium/src/+/e52f33f30b91b4ddfad649acddc39ab570473b86/gpu/config/gpu_driver_bug_list.json [3]: https://github.com/chromium/chromium/commit/873b27d518038be94df98d1128a2e8047e0ef942 [4]: https://github.com/google/angle/blob/05f45adc147393562b518ca1f82a3ccba7ee40f7/src/gpu_info_util/SystemInfo_libpci.cpp#L41 --- pkgs/applications/networking/browsers/chromium/common.nix | 6 ++---- 1 file changed, 2 insertions(+), 4 deletions(-) diff --git a/pkgs/applications/networking/browsers/chromium/common.nix b/pkgs/applications/networking/browsers/chromium/common.nix index e3bb552d57c0..f2c1568e8d28 100644 --- a/pkgs/applications/networking/browsers/chromium/common.nix +++ b/pkgs/applications/networking/browsers/chromium/common.nix @@ -312,9 +312,6 @@ let sed -i -e '/lib_loader.*Load/s!"\(libudev\.so\)!"${lib.getLib systemd}/lib/\1!' \ device/udev_linux/udev?_loader.cc '' + '' - sed -i -e '/libpci_loader.*Load/s!"\(libpci\.so\)!"${pciutils}/lib/\1!' \ - gpu/config/gpu_info_collector_linux.cc - # Allow to put extensions into the system-path. sed -i -e 's,/usr,/run/current-system/sw,' chrome/common/chrome_paths.cc @@ -476,9 +473,10 @@ let postFixup = '' # Make sure that libGLESv2 and libvulkan are found by dlopen. + # libpci (from pciutils) is needed by dlopen in angle/src/gpu_info_util/SystemInfo_libpci.cpp chromiumBinary="$libExecPath/$packageName" origRpath="$(patchelf --print-rpath "$chromiumBinary")" - patchelf --set-rpath "${lib.makeLibraryPath [ libGL vulkan-loader ]}:$origRpath" "$chromiumBinary" + patchelf --set-rpath "${lib.makeLibraryPath [ libGL vulkan-loader pciutils ]}:$origRpath" "$chromiumBinary" ''; passthru = { From a24b848ab69f976865c69f85a42fce1a65914692 Mon Sep 17 00:00:00 2001 From: kilianar Date: Thu, 19 Oct 2023 23:34:35 +0200 Subject: [PATCH 055/222] orchis-theme: 2023-05-27 -> 2023-10-20 https://github.com/vinceliuice/Orchis-theme/releases/tag/2023-10-20 --- pkgs/data/themes/orchis-theme/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/data/themes/orchis-theme/default.nix b/pkgs/data/themes/orchis-theme/default.nix index 2d07ac3ae380..351c1c22207c 100644 --- a/pkgs/data/themes/orchis-theme/default.nix +++ b/pkgs/data/themes/orchis-theme/default.nix @@ -26,13 +26,13 @@ lib.checkListOfEnum "${pname}: theme tweaks" validTweaks tweaks stdenvNoCC.mkDerivation rec { inherit pname; - version = "2023-05-27"; + version = "2023-10-20"; src = fetchFromGitHub { repo = "Orchis-theme"; owner = "vinceliuice"; rev = version; - hash = "sha256-I1a8y9dAJqFgnhyMqfupSdGvbbScf6tSYKlAhAzY4Dk="; + hash = "sha256-GhSzTtbuvbAuXxKNm29sJX5kXE2s2jMDB6Ww6Q7GNSo="; }; nativeBuildInputs = [ gtk3 sassc ]; From 3b1e2975719d76bd322af5ce6c757be6dc949fff Mon Sep 17 00:00:00 2001 From: Jerry Starke <42114389+JerrySM64@users.noreply.github.com> Date: Fri, 20 Oct 2023 00:58:50 +0200 Subject: [PATCH 056/222] linuxKernel.kernels.linux_zen: 6.5.7-zen2 -> 6.5.8-zen1 --- pkgs/os-specific/linux/kernel/zen-kernels.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/os-specific/linux/kernel/zen-kernels.nix b/pkgs/os-specific/linux/kernel/zen-kernels.nix index 716a45820ca5..cfdf50fc4b94 100644 --- a/pkgs/os-specific/linux/kernel/zen-kernels.nix +++ b/pkgs/os-specific/linux/kernel/zen-kernels.nix @@ -4,9 +4,9 @@ let # comments with variant added for update script # ./update-zen.py zen zenVariant = { - version = "6.5.7"; #zen - suffix = "zen2"; #zen - sha256 = "0qy3xn7kr16crm7iw1zhm3kpgxpmn66xc4g1yalvghwn6si0n81l"; #zen + version = "6.5.8"; #zen + suffix = "zen1"; #zen + sha256 = "0pg5q5alsxrbbf8hzbcgmwsyirs86715qijdzaldyw9sf74h4z1l"; #zen isLqx = false; }; # ./update-zen.py lqx From 648bd0d775532620ff8966709d08dcd6315a0bc4 Mon Sep 17 00:00:00 2001 From: Jerry Starke <42114389+JerrySM64@users.noreply.github.com> Date: Fri, 20 Oct 2023 01:00:41 +0200 Subject: [PATCH 057/222] linuxKernel.kernels.linux_lqx: 6.5.7-lqx1 -> 6.5.8-lqx1 --- pkgs/os-specific/linux/kernel/zen-kernels.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/os-specific/linux/kernel/zen-kernels.nix b/pkgs/os-specific/linux/kernel/zen-kernels.nix index cfdf50fc4b94..f978cb429df5 100644 --- a/pkgs/os-specific/linux/kernel/zen-kernels.nix +++ b/pkgs/os-specific/linux/kernel/zen-kernels.nix @@ -11,9 +11,9 @@ let }; # ./update-zen.py lqx lqxVariant = { - version = "6.5.7"; #lqx + version = "6.5.8"; #lqx suffix = "lqx1"; #lqx - sha256 = "1c4093xhfnzx6h8frqcigdlikgy1n0vv34ajs0237v3w7psw99d7"; #lqx + sha256 = "1f10p7mriwjrgmdfz10vs48xiipdk9ljj884fsj63r5n1g7pz4bf"; #lqx isLqx = true; }; zenKernelsFor = { version, suffix, sha256, isLqx }: buildLinux (args // { From 533d0c3d567d1f980e937ba5767a3530d85dee99 Mon Sep 17 00:00:00 2001 From: Misaka13514 Date: Fri, 20 Oct 2023 08:20:39 +0800 Subject: [PATCH 058/222] nuclei: 2.9.15 -> 3.0.0 Diff: https://github.com/projectdiscovery/nuclei/compare/v2.9.15...v3.0.0 Changelog: https://github.com/projectdiscovery/nuclei/releases/tag/v3.0.0 --- pkgs/tools/security/nuclei/default.nix | 7 +++---- pkgs/top-level/all-packages.nix | 4 +++- 2 files changed, 6 insertions(+), 5 deletions(-) diff --git a/pkgs/tools/security/nuclei/default.nix b/pkgs/tools/security/nuclei/default.nix index 1f6dd8baeeb1..0797b739ea58 100644 --- a/pkgs/tools/security/nuclei/default.nix +++ b/pkgs/tools/security/nuclei/default.nix @@ -5,18 +5,17 @@ buildGoModule rec { pname = "nuclei"; - version = "2.9.15"; + version = "3.0.0"; src = fetchFromGitHub { owner = "projectdiscovery"; repo = pname; rev = "refs/tags/v${version}"; - hash = "sha256-/7013cf9nnDiKqcwFOYZUF1D+wkQKXPBcwz3YhpBUK0="; + hash = "sha256-0/eyMDEE6RGkvGwreMkbv0kk48U6yi0NCCz8kfA8svk="; }; - vendorHash = "sha256-b5CY66c2vfGaqlFENw2lnK47Cf2+buh/LtbJyPSAbOA="; + vendorHash = "sha256-9BNmrg5gaILlb9V7A/oHe74CHxwkCBP6ybkzYVFqNUk="; - modRoot = "./v2"; subPackages = [ "cmd/nuclei/" ]; diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index 34d9d153a437..9ec712d1df07 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -29735,7 +29735,9 @@ with pkgs; nuclear = callPackage ../applications/audio/nuclear { }; - nuclei = callPackage ../tools/security/nuclei { }; + nuclei = callPackage ../tools/security/nuclei { + buildGoModule = buildGo121Module; + }; nullmailer = callPackage ../servers/mail/nullmailer { stdenv = gccStdenv; From 18013cc71e8d00cc1297af29d519b420f1326b41 Mon Sep 17 00:00:00 2001 From: Will Fancher Date: Thu, 19 Oct 2023 21:09:12 -0400 Subject: [PATCH 059/222] systemd-stage-1: Use specific fs packages --- nixos/modules/system/boot/systemd/initrd.nix | 2 +- nixos/modules/tasks/filesystems/btrfs.nix | 17 ++++++++++------- nixos/modules/tasks/filesystems/cifs.nix | 2 ++ nixos/modules/tasks/filesystems/ext.nix | 2 ++ nixos/modules/tasks/filesystems/f2fs.nix | 2 ++ nixos/modules/tasks/filesystems/jfs.nix | 2 ++ nixos/modules/tasks/filesystems/reiserfs.nix | 2 ++ nixos/modules/tasks/filesystems/vfat.nix | 2 ++ nixos/modules/tasks/filesystems/xfs.nix | 2 ++ nixos/modules/tasks/filesystems/zfs.nix | 3 ++- .../kernel/make-initrd-ng/src/main.rs | 2 +- 11 files changed, 28 insertions(+), 10 deletions(-) diff --git a/nixos/modules/system/boot/systemd/initrd.nix b/nixos/modules/system/boot/systemd/initrd.nix index 61af2768e295..175e757cbbb6 100644 --- a/nixos/modules/system/boot/systemd/initrd.nix +++ b/nixos/modules/system/boot/systemd/initrd.nix @@ -358,7 +358,7 @@ in { ++ lib.optional (cfg.enableTpm2 && !(pkgs.stdenv.hostPlatform.isRiscV64 || pkgs.stdenv.hostPlatform.isArmv7)) "tpm-crb"; boot.initrd.systemd = { - initrdBin = [pkgs.bash pkgs.coreutils cfg.package.kmod cfg.package] ++ config.system.fsPackages; + initrdBin = [pkgs.bash pkgs.coreutils cfg.package.kmod cfg.package]; extraBin = { less = "${pkgs.less}/bin/less"; mount = "${cfg.package.util-linux}/bin/mount"; diff --git a/nixos/modules/tasks/filesystems/btrfs.nix b/nixos/modules/tasks/filesystems/btrfs.nix index 82fdd6058710..87fe326c0974 100644 --- a/nixos/modules/tasks/filesystems/btrfs.nix +++ b/nixos/modules/tasks/filesystems/btrfs.nix @@ -52,34 +52,37 @@ in config = mkMerge [ (mkIf enableBtrfs { system.fsPackages = [ pkgs.btrfs-progs ]; + }) - boot.initrd.kernelModules = mkIf inInitrd [ "btrfs" ]; - boot.initrd.availableKernelModules = mkIf inInitrd ( + (mkIf inInitrd { + boot.initrd.kernelModules = [ "btrfs" ]; + boot.initrd.availableKernelModules = [ "crc32c" ] ++ optionals (config.boot.kernelPackages.kernel.kernelAtLeast "5.5") [ # Needed for mounting filesystems with new checksums "xxhash_generic" "blake2b_generic" "sha256_generic" # Should be baked into our kernel, just to be sure - ] - ); + ]; - boot.initrd.extraUtilsCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable) + boot.initrd.extraUtilsCommands = mkIf (!config.boot.initrd.systemd.enable) '' copy_bin_and_libs ${pkgs.btrfs-progs}/bin/btrfs ln -sv btrfs $out/bin/btrfsck ln -sv btrfsck $out/bin/fsck.btrfs ''; - boot.initrd.extraUtilsCommandsTest = mkIf (inInitrd && !config.boot.initrd.systemd.enable) + boot.initrd.extraUtilsCommandsTest = mkIf (!config.boot.initrd.systemd.enable) '' $out/bin/btrfs --version ''; - boot.initrd.postDeviceCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable) + boot.initrd.postDeviceCommands = mkIf (!config.boot.initrd.systemd.enable) '' btrfs device scan ''; + + boot.initrd.systemd.initrdBin = [ pkgs.btrfs-progs ]; }) (mkIf enableAutoScrub { diff --git a/nixos/modules/tasks/filesystems/cifs.nix b/nixos/modules/tasks/filesystems/cifs.nix index 0de292a69208..837b9e19bfb9 100644 --- a/nixos/modules/tasks/filesystems/cifs.nix +++ b/nixos/modules/tasks/filesystems/cifs.nix @@ -21,5 +21,7 @@ in copy_bin_and_libs ${pkgs.cifs-utils}/sbin/mount.cifs ''; + boot.initrd.systemd.extraBin."mount.cifs" = mkIf inInitrd "${pkgs.cifs-utils}/sbin/mount.cifs"; + }; } diff --git a/nixos/modules/tasks/filesystems/ext.nix b/nixos/modules/tasks/filesystems/ext.nix index edc0efc55213..1c34ee2c7035 100644 --- a/nixos/modules/tasks/filesystems/ext.nix +++ b/nixos/modules/tasks/filesystems/ext.nix @@ -25,5 +25,7 @@ in ln -sv e2fsck $out/bin/fsck.ext4 ''; + boot.initrd.systemd.initrdBin = lib.mkIf inInitrd [ pkgs.e2fsprogs ]; + }; } diff --git a/nixos/modules/tasks/filesystems/f2fs.nix b/nixos/modules/tasks/filesystems/f2fs.nix index 035784f43df8..4f99f9a57fa6 100644 --- a/nixos/modules/tasks/filesystems/f2fs.nix +++ b/nixos/modules/tasks/filesystems/f2fs.nix @@ -16,5 +16,7 @@ in boot.initrd.extraUtilsCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable) '' copy_bin_and_libs ${pkgs.f2fs-tools}/sbin/fsck.f2fs ''; + + boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.f2fs-tools ]; }; } diff --git a/nixos/modules/tasks/filesystems/jfs.nix b/nixos/modules/tasks/filesystems/jfs.nix index 6d80c4c657da..b5132b4caa33 100644 --- a/nixos/modules/tasks/filesystems/jfs.nix +++ b/nixos/modules/tasks/filesystems/jfs.nix @@ -15,5 +15,7 @@ in boot.initrd.extraUtilsCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable) '' copy_bin_and_libs ${pkgs.jfsutils}/sbin/fsck.jfs ''; + + boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.jfsutils ]; }; } diff --git a/nixos/modules/tasks/filesystems/reiserfs.nix b/nixos/modules/tasks/filesystems/reiserfs.nix index 7b017a83db84..3c6a0f0cd917 100644 --- a/nixos/modules/tasks/filesystems/reiserfs.nix +++ b/nixos/modules/tasks/filesystems/reiserfs.nix @@ -21,5 +21,7 @@ in ln -s reiserfsck $out/bin/fsck.reiserfs ''; + boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.reiserfsprogs ]; + }; } diff --git a/nixos/modules/tasks/filesystems/vfat.nix b/nixos/modules/tasks/filesystems/vfat.nix index 5421b617b43b..e535e97759b2 100644 --- a/nixos/modules/tasks/filesystems/vfat.nix +++ b/nixos/modules/tasks/filesystems/vfat.nix @@ -21,5 +21,7 @@ in ln -sv dosfsck $out/bin/fsck.vfat ''; + boot.initrd.systemd.extraBin = mkIf inInitrd [ pkgs.dosfstools ]; + }; } diff --git a/nixos/modules/tasks/filesystems/xfs.nix b/nixos/modules/tasks/filesystems/xfs.nix index f81f58646551..76f31e660ad3 100644 --- a/nixos/modules/tasks/filesystems/xfs.nix +++ b/nixos/modules/tasks/filesystems/xfs.nix @@ -26,5 +26,7 @@ in '' sed -i -e 's,^#!.*,#!'$out/bin/sh, $out/bin/fsck.xfs ''; + + boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.xfsprogs.bin ]; }; } diff --git a/nixos/modules/tasks/filesystems/zfs.nix b/nixos/modules/tasks/filesystems/zfs.nix index 5cf863c87f27..7e7811fd3339 100644 --- a/nixos/modules/tasks/filesystems/zfs.nix +++ b/nixos/modules/tasks/filesystems/zfs.nix @@ -632,7 +632,8 @@ in targets.zfs-import.wantedBy = [ "zfs.target" ]; targets.zfs.wantedBy = [ "initrd.target" ]; extraBin = { - # zpool and zfs are already in thanks to fsPackages + zpool = "${cfgZfs.package}/sbin/zpool"; + zfs = "${cfgZfs.package}/sbin/zfs"; awk = "${pkgs.gawk}/bin/awk"; }; }; diff --git a/pkgs/build-support/kernel/make-initrd-ng/src/main.rs b/pkgs/build-support/kernel/make-initrd-ng/src/main.rs index 53096a842329..daa688976c6c 100644 --- a/pkgs/build-support/kernel/make-initrd-ng/src/main.rs +++ b/pkgs/build-support/kernel/make-initrd-ng/src/main.rs @@ -195,7 +195,7 @@ fn handle_path( .wrap_err_with(|| format!("failed to resolve symlink of {:?}", source))?; // Create the link, then push its target to the queue - if !target.exists() { + if !target.exists() && !target.is_symlink() { unix::fs::symlink(&link_target, &target).wrap_err_with(|| { format!("failed to symlink {:?} to {:?}", link_target, target) })?; From 9063eb77845953e008cb77e76c6a2dfa8022cc91 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Fri, 20 Oct 2023 02:02:50 +0000 Subject: [PATCH 060/222] syft: 0.92.0 -> 0.93.0 --- pkgs/tools/admin/syft/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/tools/admin/syft/default.nix b/pkgs/tools/admin/syft/default.nix index 3f6567b09f0c..c596c709977c 100644 --- a/pkgs/tools/admin/syft/default.nix +++ b/pkgs/tools/admin/syft/default.nix @@ -2,13 +2,13 @@ buildGoModule rec { pname = "syft"; - version = "0.92.0"; + version = "0.93.0"; src = fetchFromGitHub { owner = "anchore"; repo = pname; rev = "v${version}"; - hash = "sha256-YmzizpcAfE4+Rfq5ydQnDQBo4R+pAyudfi+fqD9EZP0="; + hash = "sha256-e8d+CK7rRbyHeRHOjK3tGFIBHuosdV4AMetUQar54E4="; # populate values that require us to use git. By doing this in postFetch we # can delete .git afterwards and maintain better reproducibility of the src. leaveDotGit = true; @@ -22,7 +22,7 @@ buildGoModule rec { }; # hash mismatch with darwin proxyVendor = true; - vendorHash = "sha256-siOZWhHqNokkYAPwuXQCs4T1yBiEWUTJzhfbH/Z2uBk="; + vendorHash = "sha256-BUCe2v80tHAqMBwa6xae3ZOTOok8msM6hFh6d9D4xZA="; nativeBuildInputs = [ installShellFiles ]; From e98a8367ecfa30b125bdf31fb5c66b137d3d31ac Mon Sep 17 00:00:00 2001 From: Markus Theil Date: Tue, 10 Oct 2023 20:56:45 +0200 Subject: [PATCH 061/222] jitterentropy-rngd: init at 1.2.8 Add jitterentropy-rngd, a tool similar to rng-tools. While not necessarily needed, it is useful for those who want to strengthen their kernel entropy input pool by periodic insertion of an independent source. The entropy source is a NIST SP800-90B compliant non-physical true RNG source on most systems. See the jitterentropy documentation for details (http://chronox.de/jent/doc/CPU-Jitter-NPTRNG.pdf). Signed-off-by: Markus Theil --- nixos/modules/module-list.nix | 1 + .../services/security/jitterentropy-rngd.nix | 18 ++++++++++ .../by-name/ji/jitterentropy-rngd/package.nix | 34 +++++++++++++++++++ 3 files changed, 53 insertions(+) create mode 100644 nixos/modules/services/security/jitterentropy-rngd.nix create mode 100644 pkgs/by-name/ji/jitterentropy-rngd/package.nix diff --git a/nixos/modules/module-list.nix b/nixos/modules/module-list.nix index 811b82f28ce1..c4056f15a24f 100644 --- a/nixos/modules/module-list.nix +++ b/nixos/modules/module-list.nix @@ -1148,6 +1148,7 @@ ./services/security/hologram-agent.nix ./services/security/hologram-server.nix ./services/security/infnoise.nix + ./services/security/jitterentropy-rngd.nix ./services/security/kanidm.nix ./services/security/munge.nix ./services/security/nginx-sso.nix diff --git a/nixos/modules/services/security/jitterentropy-rngd.nix b/nixos/modules/services/security/jitterentropy-rngd.nix new file mode 100644 index 000000000000..7bfacb5ddc5d --- /dev/null +++ b/nixos/modules/services/security/jitterentropy-rngd.nix @@ -0,0 +1,18 @@ +{ lib, config, pkgs, ... }: +let + cfg = config.services.jitterentropy-rngd; +in +{ + options.services.jitterentropy-rngd = { + enable = + lib.mkEnableOption (lib.mdDoc "jitterentropy-rngd service configuration"); + package = lib.mkPackageOptionMD pkgs "jitterentropy-rngd" { }; + }; + + config = lib.mkIf cfg.enable { + systemd.packages = [ cfg.package ]; + systemd.services."jitterentropy".wantedBy = [ "basic.target" ]; + }; + + meta.maintainers = with lib.maintainers; [ thillux ]; +} diff --git a/pkgs/by-name/ji/jitterentropy-rngd/package.nix b/pkgs/by-name/ji/jitterentropy-rngd/package.nix new file mode 100644 index 000000000000..feb7d1e2fb12 --- /dev/null +++ b/pkgs/by-name/ji/jitterentropy-rngd/package.nix @@ -0,0 +1,34 @@ +{ lib, stdenv, fetchFromGitHub }: + +stdenv.mkDerivation rec { + pname = "jitterentropy-rngd"; + version = "1.2.8"; + + src = fetchFromGitHub { + owner = "smuellerDD"; + repo = pname; + rev = "v${version}"; + hash = "sha256-LDym636ss3B1G/vrqatu9g5vbVEeDX0JQcxZ/IxGeY0="; + }; + + enableParallelBuilding = true; + + installPhase = '' + runHook preInstall + + mkdir -p $out + make install DESTDIR= PREFIX=$out UNITDIR=$out/lib/systemd/system + + runHook postInstall + ''; + + meta = with lib; { + description = ''A random number generator, which injects entropy to the kernel''; + homepage = "https://github.com/smuellerDD/jitterentropy-rngd"; + changelog = "https://github.com/smuellerDD/jitterentropy-rngd/releases/tag/v${version}"; + license = [ licenses.gpl2Only licenses.bsd3 ]; + platforms = platforms.linux; + maintainers = with maintainers; [ thillux ]; + mainProgram = "jitterentropy-rngd"; + }; +} From aae51697be9fa00dbf2acef28b82efbb2287f01b Mon Sep 17 00:00:00 2001 From: natsukium Date: Fri, 20 Oct 2023 17:06:09 +0900 Subject: [PATCH 062/222] bowtie2: refactor --- .../science/biology/bowtie2/default.nix | 22 ++++++++++++++----- 1 file changed, 16 insertions(+), 6 deletions(-) diff --git a/pkgs/applications/science/biology/bowtie2/default.nix b/pkgs/applications/science/biology/bowtie2/default.nix index e5c9c2864225..3e902e607db8 100644 --- a/pkgs/applications/science/biology/bowtie2/default.nix +++ b/pkgs/applications/science/biology/bowtie2/default.nix @@ -1,13 +1,21 @@ -{ lib, stdenv, fetchFromGitHub, cmake, tbb, zlib, python3, perl }: +{ lib +, stdenv +, fetchFromGitHub +, cmake +, perl +, python3 +, tbb +, zlib +}: -stdenv.mkDerivation rec { +stdenv.mkDerivation (finalAttrs: { pname = "bowtie2"; version = "2.5.2"; src = fetchFromGitHub { owner = "BenLangmead"; - repo = pname; - rev = "v${version}"; + repo = "bowtie2"; + rev = "refs/tags/v${finalAttrs.version}"; sha256 = "sha256-Bem4SHY/74suZPDbw/rwKMLBn3bRq5ooHbBoVnKuYk0="; }; @@ -17,10 +25,12 @@ stdenv.mkDerivation rec { meta = with lib; { description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences"; - license = licenses.gpl3; + license = licenses.gpl3Plus; homepage = "http://bowtie-bio.sf.net/bowtie2"; + changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}"; maintainers = with maintainers; [ rybern ]; platforms = platforms.all; broken = stdenv.isAarch64; # only x86 is supported + mainProgram = "bowtie2"; }; -} +}) From 13fe1effaf0b3aded4939568b6b0115392e4e2ae Mon Sep 17 00:00:00 2001 From: natsukium Date: Fri, 20 Oct 2023 17:07:39 +0900 Subject: [PATCH 063/222] bowtie2: fix build on aarch64 --- .../science/biology/bowtie2/default.nix | 14 ++++++++++++-- 1 file changed, 12 insertions(+), 2 deletions(-) diff --git a/pkgs/applications/science/biology/bowtie2/default.nix b/pkgs/applications/science/biology/bowtie2/default.nix index 3e902e607db8..268775fc0b34 100644 --- a/pkgs/applications/science/biology/bowtie2/default.nix +++ b/pkgs/applications/science/biology/bowtie2/default.nix @@ -16,13 +16,24 @@ stdenv.mkDerivation (finalAttrs: { owner = "BenLangmead"; repo = "bowtie2"; rev = "refs/tags/v${finalAttrs.version}"; - sha256 = "sha256-Bem4SHY/74suZPDbw/rwKMLBn3bRq5ooHbBoVnKuYk0="; + fetchSubmodules = true; + hash = "sha256-rWeopeYuCk9ZhJX2SFCcxZWcjXjjTiVRiwkzLQcIgd0="; }; + # because of this flag, gcc on aarch64 cannot find the Threads + # Could NOT find Threads (missing: Threads_FOUND) + # TODO: check with other distros and report upstream + postPatch = '' + substituteInPlace CMakeLists.txt \ + --replace "-m64" "" + ''; + nativeBuildInputs = [ cmake ]; buildInputs = [ tbb zlib python3 perl ]; + cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"]; + meta = with lib; { description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences"; license = licenses.gpl3Plus; @@ -30,7 +41,6 @@ stdenv.mkDerivation (finalAttrs: { changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}"; maintainers = with maintainers; [ rybern ]; platforms = platforms.all; - broken = stdenv.isAarch64; # only x86 is supported mainProgram = "bowtie2"; }; }) From 056f9e21c08d2573a39d7ba3777bc968cb88ded5 Mon Sep 17 00:00:00 2001 From: natsukium Date: Fri, 20 Oct 2023 17:08:20 +0900 Subject: [PATCH 064/222] bowtie2: enable tests --- .../science/biology/bowtie2/default.nix | 16 ++++++++++++++++ 1 file changed, 16 insertions(+) diff --git a/pkgs/applications/science/biology/bowtie2/default.nix b/pkgs/applications/science/biology/bowtie2/default.nix index 268775fc0b34..356e90555f8d 100644 --- a/pkgs/applications/science/biology/bowtie2/default.nix +++ b/pkgs/applications/science/biology/bowtie2/default.nix @@ -6,6 +6,8 @@ , python3 , tbb , zlib +, runCommand +, bowtie2 }: stdenv.mkDerivation (finalAttrs: { @@ -34,6 +36,20 @@ stdenv.mkDerivation (finalAttrs: { cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"]; + # ctest fails because of missing dependencies between tests + doCheck = false; + + passthru.tests = { + ctest = runCommand "${finalAttrs.pname}-test" { } '' + mkdir $out + ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10 + ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small + ${bowtie2}/bin/bowtie2-inspect-s $out/small + ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large + ${bowtie2}/bin/bowtie2-inspect-l $out/large + ''; + }; + meta = with lib; { description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences"; license = licenses.gpl3Plus; From 226ece481553faa9c067fedea9ae66ed2671ad2c Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Fri, 20 Oct 2023 08:51:11 +0000 Subject: [PATCH 065/222] flix: 0.40.0 -> 0.41.0 --- pkgs/development/compilers/flix/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/compilers/flix/default.nix b/pkgs/development/compilers/flix/default.nix index 47a84a6e5f2d..9ce582623fe1 100644 --- a/pkgs/development/compilers/flix/default.nix +++ b/pkgs/development/compilers/flix/default.nix @@ -2,11 +2,11 @@ stdenvNoCC.mkDerivation rec { pname = "flix"; - version = "0.40.0"; + version = "0.41.0"; src = fetchurl { url = "https://github.com/flix/flix/releases/download/v${version}/flix.jar"; - sha256 = "sha256-NVQY2TgIR9ROy4x8PWxCjuaOkNx0bcUA4oZHjpQbHc4="; + sha256 = "sha256-bDeqwk+grkCxmGE9H8Ks7Q8KvLxNCzaLe44DlR6E7YE="; }; dontUnpack = true; From e7408f884e3dec7224e42477f49ca221c6c88dfc Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Fri, 20 Oct 2023 10:28:54 +0000 Subject: [PATCH 066/222] nerdfix: 0.3.1 -> 0.4.0 --- pkgs/tools/text/nerdfix/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/tools/text/nerdfix/default.nix b/pkgs/tools/text/nerdfix/default.nix index 91a34796518d..8bb9113f013a 100644 --- a/pkgs/tools/text/nerdfix/default.nix +++ b/pkgs/tools/text/nerdfix/default.nix @@ -5,16 +5,16 @@ rustPlatform.buildRustPackage rec { pname = "nerdfix"; - version = "0.3.1"; + version = "0.4.0"; src = fetchFromGitHub { owner = "loichyan"; repo = "nerdfix"; rev = "v${version}"; - hash = "sha256-cqTaup/MrtLcBIoY+1vQLLlU+Cmu3iODH4jmZImjGrg="; + hash = "sha256-V9f39/9k9kYjngYOSXJYblaKDABPCZbVWxD0p3ZWzlY="; }; - cargoHash = "sha256-V/M70ARqOyN0f/uudWPHc4bGc3WXK3PpcM8r2MBEWAs="; + cargoHash = "sha256-PkUQZPLzvVJ7s1D9TkMmgIVQiR/E79BRCYmjZVcHIv8="; meta = with lib; { description = "Nerdfix helps you to find/fix obsolete nerd font icons in your project"; From 19c8f48b5aca98f872f518fbea07aff2d3e691e2 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Fri, 20 Oct 2023 11:56:43 +0000 Subject: [PATCH 067/222] openxr-loader: 1.0.30 -> 1.0.31 --- pkgs/development/libraries/openxr-loader/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/libraries/openxr-loader/default.nix b/pkgs/development/libraries/openxr-loader/default.nix index 1abc8a2633c6..53bfa41a8e25 100644 --- a/pkgs/development/libraries/openxr-loader/default.nix +++ b/pkgs/development/libraries/openxr-loader/default.nix @@ -2,13 +2,13 @@ stdenv.mkDerivation rec { pname = "openxr-loader"; - version = "1.0.30"; + version = "1.0.31"; src = fetchFromGitHub { owner = "KhronosGroup"; repo = "OpenXR-SDK-Source"; rev = "release-${version}"; - sha256 = "sha256-lF8Pauyi+zSNVnpHqq86J3SGUTM6AhFmnT48eyFoYco="; + sha256 = "sha256-qK8l/v6nLuMAitz7DfVDjJyVjEmkeD2jgJkG5qOMCcQ="; }; nativeBuildInputs = [ cmake python3 pkg-config ]; From 52574a4db602be666482bcf5f6827405f38df060 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Janne=20He=C3=9F?= Date: Tue, 17 Oct 2023 14:41:06 +0200 Subject: [PATCH 068/222] libspf2: 2.2.12 -> 2.2.13 and make deps strict --- pkgs/development/libraries/libspf2/default.nix | 18 +++++------------- 1 file changed, 5 insertions(+), 13 deletions(-) diff --git a/pkgs/development/libraries/libspf2/default.nix b/pkgs/development/libraries/libspf2/default.nix index b7bef2973523..997e89b82397 100644 --- a/pkgs/development/libraries/libspf2/default.nix +++ b/pkgs/development/libraries/libspf2/default.nix @@ -1,23 +1,18 @@ -{ lib, stdenv, fetchFromGitHub, autoreconfHook, fetchpatch }: +{ lib, stdenv, fetchFromGitHub, autoreconfHook }: stdenv.mkDerivation rec { pname = "libspf2"; - version = "2.2.12"; + version = "2.2.13"; src = fetchFromGitHub { owner = "helsinki-systems"; repo = "libspf2"; rev = "v${version}"; - sha256 = "03iiaafdcwh220pqignk407h6klrakwz0zkb8iwk6nkwipkwvhsx"; + hash = "sha256-tkCHP3B1sBb0+scHBjX5lCvaeSrZryfaGKye02LFlYs="; }; - patches = [ - # glibc-2.34 compat - (fetchpatch { - url = "https://raw.githubusercontent.com/gentoo/gentoo/dbb8a5c9f749cc11e61cfe558f164b165cbc30cb/mail-filter/libspf2/files/libspf2-1.2.11-undefined-dn_.patch"; - sha256 = "sha256-6JVVkVGCcFJsNeBdVTPcLhW4KoHLY4ai/KXDMliXgPA="; - }) - ]; + nativeBuildInputs = [ autoreconfHook ]; + strictDeps = true; postPatch = '' # disable static bins compilation @@ -28,9 +23,6 @@ stdenv.mkDerivation rec { -e '/bin_PROGRAMS/s/spf_example_static//' src/spf_example/Makefile.am ''; - # autoreconf necessary because we modified automake files - nativeBuildInputs = [ autoreconfHook ]; - doCheck = true; meta = with lib; { From 06d24ae5572171457a54d7a5728177e6503e785f Mon Sep 17 00:00:00 2001 From: Misaka13514 Date: Fri, 20 Oct 2023 21:08:09 +0800 Subject: [PATCH 069/222] nuclei: 3.0.0 -> 3.0.1 Diff: https://github.com/projectdiscovery/nuclei/compare/v3.0.0...v3.0.1 Changelog: https://github.com/projectdiscovery/nuclei/releases/tag/v3.0.1 --- pkgs/tools/security/nuclei/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/tools/security/nuclei/default.nix b/pkgs/tools/security/nuclei/default.nix index 0797b739ea58..ae6e1d78f6fa 100644 --- a/pkgs/tools/security/nuclei/default.nix +++ b/pkgs/tools/security/nuclei/default.nix @@ -5,16 +5,16 @@ buildGoModule rec { pname = "nuclei"; - version = "3.0.0"; + version = "3.0.1"; src = fetchFromGitHub { owner = "projectdiscovery"; repo = pname; rev = "refs/tags/v${version}"; - hash = "sha256-0/eyMDEE6RGkvGwreMkbv0kk48U6yi0NCCz8kfA8svk="; + hash = "sha256-5Z40wc8ihN2UR3DyMCaD0MOKpgbUQX0OJMyZw2gVNYM="; }; - vendorHash = "sha256-9BNmrg5gaILlb9V7A/oHe74CHxwkCBP6ybkzYVFqNUk="; + vendorHash = "sha256-CaeYAw7QU/KySFDSkUr4oHrG3wyPHxty3KCZ6zlPqIk="; subPackages = [ "cmd/nuclei/" From d0e54f342fb846839c740278ed7632dabaf6551e Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Fri, 20 Oct 2023 13:35:53 +0000 Subject: [PATCH 070/222] python311Packages.peaqevcore: 19.5.4 -> 19.5.5 --- pkgs/development/python-modules/peaqevcore/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/peaqevcore/default.nix b/pkgs/development/python-modules/peaqevcore/default.nix index 38397535c01f..33e65661f92e 100644 --- a/pkgs/development/python-modules/peaqevcore/default.nix +++ b/pkgs/development/python-modules/peaqevcore/default.nix @@ -6,14 +6,14 @@ buildPythonPackage rec { pname = "peaqevcore"; - version = "19.5.4"; + version = "19.5.5"; format = "setuptools"; disabled = pythonOlder "3.7"; src = fetchPypi { inherit pname version; - hash = "sha256-AkVUYUZobQsnSfMfciiSbPwo0HCnlO3NLoUA1+wqBt4="; + hash = "sha256-AgJT/VfNHcSuJhypBwqJkgXuvYDBlZ7eQp4nGva4z6U="; }; postPatch = '' From 121a0a4c443f92fa035503406d6b63f81209751f Mon Sep 17 00:00:00 2001 From: Zach Mitchell Date: Thu, 19 Oct 2023 19:56:50 -0600 Subject: [PATCH 071/222] flip: init at 1.2 --- pkgs/by-name/fl/flip/package.nix | 32 ++++++++++++++++++++++++++++++++ 1 file changed, 32 insertions(+) create mode 100644 pkgs/by-name/fl/flip/package.nix diff --git a/pkgs/by-name/fl/flip/package.nix b/pkgs/by-name/fl/flip/package.nix new file mode 100644 index 000000000000..f7957c0990b0 --- /dev/null +++ b/pkgs/by-name/fl/flip/package.nix @@ -0,0 +1,32 @@ +{ + stdenv, + lib, + fetchFromGitHub, + cmake +}: + +stdenv.mkDerivation { + pname = "flip"; + version = "1.2"; + + src = fetchFromGitHub { + owner = "NVlabs"; + repo = "flip"; + rev = "8303adb2060d69423d040453995f4ad1a030a1cc"; + hash = "sha256-jSB79qOtnW/cjApIDcLRqGabnzCIwS7saA+aF1TcyV0="; + }; + + nativeBuildInputs = [ + cmake + ]; + + enableParallelBuilding = true; + + meta = with lib; { + description = "A tool for visualizing and communicating the errors in rendered images."; + license = licenses.bsd3; + platforms = platforms.unix; + maintainers = with maintainers; [ zmitchell ]; + mainProgram = "flip"; + }; +} From c0a381b20a6f4eb7d89f3e2a628ec4a3e3d0d067 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Fri, 20 Oct 2023 14:06:41 +0000 Subject: [PATCH 072/222] python311Packages.pyduotecno: 2023.10.0 -> 2023.10.1 --- pkgs/development/python-modules/pyduotecno/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/pyduotecno/default.nix b/pkgs/development/python-modules/pyduotecno/default.nix index e61e725a80a1..17fd2d78885c 100644 --- a/pkgs/development/python-modules/pyduotecno/default.nix +++ b/pkgs/development/python-modules/pyduotecno/default.nix @@ -8,7 +8,7 @@ buildPythonPackage rec { pname = "pyduotecno"; - version = "2023.10.0"; + version = "2023.10.1"; format = "pyproject"; disabled = pythonOlder "3.9"; @@ -17,7 +17,7 @@ buildPythonPackage rec { owner = "Cereal2nd"; repo = "pyDuotecno"; rev = "refs/tags/${version}"; - hash = "sha256-GxCqWgw4OdhJUMsGzCZnl6KYH7HQpGyV7zXMxbShHlg="; + hash = "sha256-fDooQb1i9rgzDZBzZ+lYb0WUYC8JNPEYk5DJ9wtS2Dg="; }; nativeBuildInputs = [ From 424b94c7d56b285063516a6be4b9a335c7ecabcd Mon Sep 17 00:00:00 2001 From: The Galaxy Date: Fri, 20 Oct 2023 22:08:49 +0800 Subject: [PATCH 073/222] maintainers: add galaxy --- maintainers/maintainer-list.nix | 10 ++++++++++ 1 file changed, 10 insertions(+) diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix index 87687572f3f0..9d8297a0b234 100644 --- a/maintainers/maintainer-list.nix +++ b/maintainers/maintainer-list.nix @@ -6190,6 +6190,16 @@ githubId = 45048741; name = "Alwanga Oyango"; }; + galaxy = { + email = "galaxy@dmc.chat"; + matrix = "@galaxy:mozilla.org"; + name = "The Galaxy"; + github = "ga1aksy"; + githubId = 148551648; + keys = [{ + fingerprint = "48CA 3873 9E9F CA8E 76A0 835A E3DE CF85 4212 E1EA"; + }]; + }; gal_bolle = { email = "florent.becker@ens-lyon.org"; github = "FlorentBecker"; From 632b1982335b46586b17ee3825ee1989a42bfb59 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Fri, 20 Oct 2023 14:41:06 +0000 Subject: [PATCH 074/222] python311Packages.wallbox: 0.4.14 -> 0.5.1 --- pkgs/development/python-modules/wallbox/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/wallbox/default.nix b/pkgs/development/python-modules/wallbox/default.nix index 4fe26418ef83..a53344a76fd1 100644 --- a/pkgs/development/python-modules/wallbox/default.nix +++ b/pkgs/development/python-modules/wallbox/default.nix @@ -9,14 +9,14 @@ buildPythonPackage rec { pname = "wallbox"; - version = "0.4.14"; + version = "0.5.1"; format = "setuptools"; disabled = pythonOlder "3.7"; src = fetchPypi { inherit pname version; - hash = "sha256-HKlq5DPG3HD9i9LLTJdlzEFim+2hBdSfKl43BojhEf8="; + hash = "sha256-EDEB7/CkrfYSNcSh55Itrj6rThsNKeuj8lHLAY+Qml4="; }; propagatedBuildInputs = [ From 58ba0a5c25abda7100b8ffd03a9d0144a8631d77 Mon Sep 17 00:00:00 2001 From: Weijia Wang <9713184+wegank@users.noreply.github.com> Date: Fri, 20 Oct 2023 17:02:07 +0200 Subject: [PATCH 075/222] maintainers: add massimogengarelli --- maintainers/maintainer-list.nix | 6 ++++++ 1 file changed, 6 insertions(+) diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix index ce498371a21a..fb0601679667 100644 --- a/maintainers/maintainer-list.nix +++ b/maintainers/maintainer-list.nix @@ -10828,6 +10828,12 @@ githubId = 29855073; name = "Michael Colicchia"; }; + massimogengarelli = { + email = "massimo.gengarelli@gmail.com"; + github = "massix"; + githubId = 585424; + name = "Massimo Gengarelli"; + }; matejc = { email = "cotman.matej@gmail.com"; github = "matejc"; From f980f790f32ca04d8a5977c2e31871c18f6fdbe1 Mon Sep 17 00:00:00 2001 From: Massimo Gengarelli Date: Sun, 17 Sep 2023 12:24:18 +0200 Subject: [PATCH 076/222] onedriver: init at 0.13.0-2 --- pkgs/by-name/on/onedriver/package.nix | 64 +++++++++++++++++++++++++++ 1 file changed, 64 insertions(+) create mode 100644 pkgs/by-name/on/onedriver/package.nix diff --git a/pkgs/by-name/on/onedriver/package.nix b/pkgs/by-name/on/onedriver/package.nix new file mode 100644 index 000000000000..f4087401ea92 --- /dev/null +++ b/pkgs/by-name/on/onedriver/package.nix @@ -0,0 +1,64 @@ +{ buildGoModule +, fetchFromGitHub +, lib +, pkg-config +, webkitgtk +, glib +, fuse +, installShellFiles +}: +let + pname = "onedriver"; + version = "0.13.0-2"; + + src = fetchFromGitHub { + owner = "jstaf"; + repo = "onedriver"; + rev = "v${version}"; + hash = "sha256-Bcjgmx9a4pTRhkzR3tbOB6InjvuH71qomv4t+nRNc+w="; + }; +in +buildGoModule { + inherit pname version src; + vendorHash = "sha256-OOiiKtKb+BiFkoSBUQQfqm4dMfDW3Is+30Kwcdg8LNA="; + + nativeBuildInputs = [ pkg-config installShellFiles ]; + buildInputs = [ webkitgtk glib fuse ]; + + ldflags = [ "-X github.com/jstaf/onedriver/cmd/common.commit=v${version}" ]; + + subPackages = [ + "cmd/onedriver" + "cmd/onedriver-launcher" + ]; + + postInstall = '' + echo "Running postInstall" + install -Dm644 ./resources/onedriver.svg $out/share/icons/onedriver/onedriver.svg + install -Dm644 ./resources/onedriver.png $out/share/icons/onedriver/onedriver.png + install -Dm644 ./resources/onedriver-128.png $out/share/icons/onedriver/onedriver-128.png + + install -Dm644 ./resources/onedriver.desktop $out/share/applications/onedriver.desktop + + mkdir -p $out/share/man/man1 + installManPage ./resources/onedriver.1 + + substituteInPlace $out/share/applications/onedriver.desktop \ + --replace "/usr/bin/onedriver-launcher" "$out/bin/onedriver-launcher" \ + --replace "/usr/share/icons" "$out/share/icons" + ''; + + meta = with lib; { + description = "A network filesystem for Linux"; + longDescription = '' + onedriver is a network filesystem that gives your computer direct access to your files on Microsoft OneDrive. + This is not a sync client. Instead of syncing files, onedriver performs an on-demand download of files when + your computer attempts to use them. onedriver allows you to use files on OneDrive as if they were files on + your local computer. + ''; + inherit (src.meta) homepage; + license = licenses.gpl3Plus; + maintainers = [ maintainers.massimogengarelli ]; + platforms = platforms.linux; + }; +} From 3a6cad3f8ef200b33ea20a9f1d18d55c67f5ae42 Mon Sep 17 00:00:00 2001 From: Weijia Wang <9713184+wegank@users.noreply.github.com> Date: Fri, 20 Oct 2023 17:08:13 +0200 Subject: [PATCH 077/222] maintainers: add tochiaha --- maintainers/maintainer-list.nix | 6 ++++++ 1 file changed, 6 insertions(+) diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix index bfbf5aa4ccaf..29e6c4b2d41a 100644 --- a/maintainers/maintainer-list.nix +++ b/maintainers/maintainer-list.nix @@ -17664,6 +17664,12 @@ githubId = 858790; name = "Tobias Mayer"; }; + tochiaha = { + email = "tochiahan@proton.me"; + github = "Tochiaha"; + githubId = 74688871; + name = "Tochukwu Ahanonu"; + }; tokudan = { email = "git@danielfrank.net"; github = "tokudan"; From 9873a6d4548f5f4c7481e4cc6db22872893b5efb Mon Sep 17 00:00:00 2001 From: Tochiaha Date: Tue, 17 Oct 2023 03:37:32 +0100 Subject: [PATCH 078/222] firewalk: init at 5.0 --- pkgs/by-name/fi/firewalk/package.nix | 27 +++++++++++++++++++++++++++ 1 file changed, 27 insertions(+) create mode 100644 pkgs/by-name/fi/firewalk/package.nix diff --git a/pkgs/by-name/fi/firewalk/package.nix b/pkgs/by-name/fi/firewalk/package.nix new file mode 100644 index 000000000000..8909a61062c7 --- /dev/null +++ b/pkgs/by-name/fi/firewalk/package.nix @@ -0,0 +1,27 @@ +{ lib +, stdenv +, fetchurl +, libnet +, libpcap +, libdnet +}: + +stdenv.mkDerivation (finalAttrs: { + pname = "firewalk"; + version = "5.0"; + + src = fetchurl { + url = "https://salsa.debian.org/pkg-security-team/firewalk/-/archive/upstream/${finalAttrs.version}/firewalk-upstream-${finalAttrs.version}.tar.gz"; + hash = "sha256-f0sHzcH3faeg7epfpWXbgaHrRWaWBKMEqLdy38+svGo="; + }; + + buildInputs = [ libnet libpcap libdnet ]; + + meta = with lib; { + description = "Gateway ACL scanner"; + homepage = "http://packetfactory.openwall.net/projects/firewalk/"; + license = licenses.bsd2; + maintainers = with maintainers; [ tochiaha ]; + platforms = platforms.linux; + }; +}) From e5134fbf6370dc660e49a9fd4e1a46ab5df2b611 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Fri, 20 Oct 2023 17:22:58 +0200 Subject: [PATCH 079/222] python311Packages.toonapi: 0.2.1 -> 0.3.0 Diff: https://github.com/frenck/python-toonapi/compare/v0.2.1...v0.3.0 --- pkgs/development/python-modules/toonapi/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/toonapi/default.nix b/pkgs/development/python-modules/toonapi/default.nix index 8df8fa89a2ca..126a94265477 100644 --- a/pkgs/development/python-modules/toonapi/default.nix +++ b/pkgs/development/python-modules/toonapi/default.nix @@ -8,13 +8,13 @@ buildPythonPackage rec { pname = "toonapi"; - version = "0.2.1"; + version = "0.3.0"; src = fetchFromGitHub { owner = "frenck"; repo = "python-toonapi"; rev = "v${version}"; - sha256 = "10jh6p0ww51cb9f8amd9jq3lmvby6n2k08qwcr2n8ijbbgyp0ibf"; + sha256 = "sha256-RaN9ppqJbTik1/vNX0/YLoBawrqjyQWU6+FLTspIxug="; }; propagatedBuildInputs = [ From d1e9e2acf0add6b27dedd2701d6c2f960a971ec2 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Fri, 20 Oct 2023 17:26:47 +0200 Subject: [PATCH 080/222] python311Packages.toonapi: add changelog to meta --- pkgs/development/python-modules/toonapi/default.nix | 1 + 1 file changed, 1 insertion(+) diff --git a/pkgs/development/python-modules/toonapi/default.nix b/pkgs/development/python-modules/toonapi/default.nix index 126a94265477..b26169c9beb9 100644 --- a/pkgs/development/python-modules/toonapi/default.nix +++ b/pkgs/development/python-modules/toonapi/default.nix @@ -30,6 +30,7 @@ buildPythonPackage rec { meta = with lib; { description = "Python client for the Quby ToonAPI"; homepage = "https://github.com/frenck/python-toonapi"; + changelog = "https://github.com/frenck/python-toonapi/releases/tag/v${version}"; license = with licenses; [ mit ]; maintainers = with maintainers; [ fab ]; }; From dc74894d46e5b3cf0f6490f2211c98630e50efc8 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Fri, 20 Oct 2023 17:28:50 +0200 Subject: [PATCH 081/222] python311Packages.toonapi: add format - disable on unsupported Python releases --- pkgs/development/python-modules/toonapi/default.nix | 13 ++++++++++--- 1 file changed, 10 insertions(+), 3 deletions(-) diff --git a/pkgs/development/python-modules/toonapi/default.nix b/pkgs/development/python-modules/toonapi/default.nix index b26169c9beb9..ac51cae1c805 100644 --- a/pkgs/development/python-modules/toonapi/default.nix +++ b/pkgs/development/python-modules/toonapi/default.nix @@ -3,18 +3,22 @@ , backoff , buildPythonPackage , fetchFromGitHub +, pythonOlder , yarl }: buildPythonPackage rec { pname = "toonapi"; version = "0.3.0"; + format = "setuptools"; + + disabled = pythonOlder "3.8"; src = fetchFromGitHub { owner = "frenck"; repo = "python-toonapi"; - rev = "v${version}"; - sha256 = "sha256-RaN9ppqJbTik1/vNX0/YLoBawrqjyQWU6+FLTspIxug="; + rev = "refs/tags/v${version}"; + hash = "sha256-RaN9ppqJbTik1/vNX0/YLoBawrqjyQWU6+FLTspIxug="; }; propagatedBuildInputs = [ @@ -25,7 +29,10 @@ buildPythonPackage rec { # Project has no tests doCheck = false; - pythonImportsCheck = [ "toonapi" ]; + + pythonImportsCheck = [ + "toonapi" + ]; meta = with lib; { description = "Python client for the Quby ToonAPI"; From 1911f897bc087586f4ee4606c12717dfc14d1a19 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Fri, 20 Oct 2023 17:56:42 +0200 Subject: [PATCH 082/222] checkov: 2.5.14 -> 2.5.15 Diff: https://github.com/bridgecrewio/checkov/compare/refs/tags/2.5.14...2.5.15 Changelog: https://github.com/bridgecrewio/checkov/releases/tag/2.5.15 --- pkgs/development/tools/analysis/checkov/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/tools/analysis/checkov/default.nix b/pkgs/development/tools/analysis/checkov/default.nix index f9655b201746..34bb4303724b 100644 --- a/pkgs/development/tools/analysis/checkov/default.nix +++ b/pkgs/development/tools/analysis/checkov/default.nix @@ -22,14 +22,14 @@ with py.pkgs; buildPythonApplication rec { pname = "checkov"; - version = "2.5.14"; + version = "2.5.15"; format = "setuptools"; src = fetchFromGitHub { owner = "bridgecrewio"; repo = pname; rev = "refs/tags/${version}"; - hash = "sha256-4F8cGcQJy8cbCE0wxM6B4qGjuc+SjeL7DMr6RdSkXBM="; + hash = "sha256-PVx66Ipvf+rISkuu9dw2ecFXXmuzITg2PogqRktFh5M="; }; patches = [ From 479739b03e5cad880eb3e1416a7db77d64b8d658 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Sandro=20J=C3=A4ckel?= Date: Fri, 20 Oct 2023 17:44:28 +0200 Subject: [PATCH 083/222] nginxModules.zstd: 25d88c262be47462cf90015ee7ebf6317b6848f9 -> 0.1.0 --- pkgs/servers/http/nginx/modules.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/servers/http/nginx/modules.nix b/pkgs/servers/http/nginx/modules.nix index 13c8bd7e7c75..2ffb65a3a9f1 100644 --- a/pkgs/servers/http/nginx/modules.nix +++ b/pkgs/servers/http/nginx/modules.nix @@ -1022,8 +1022,8 @@ let self = { name = "zstd"; owner = "tokers"; repo = "zstd-nginx-module"; - rev = "25d88c262be47462cf90015ee7ebf6317b6848f9"; - sha256 = "sha256-YRluKekhx1tb6e5IL1FPK05jPtzfQPaHI47cdada928="; + rev = "0.1.0"; + hash = "sha256-8SBU9hJnKtNrwbpioy+Z/mfiVuqAx+U1t64m5tfEy6o="; }; inputs = [ zstd ]; From d0af0e77ce0ed0211eac25d0914fcfea7416cff5 Mon Sep 17 00:00:00 2001 From: Phillip Seeber Date: Fri, 20 Oct 2023 18:04:41 +0200 Subject: [PATCH 084/222] pyscf: 2.3.0 -> 2.4.0 --- pkgs/development/python-modules/pyscf/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/pyscf/default.nix b/pkgs/development/python-modules/pyscf/default.nix index 29f795560d41..5089e19c2264 100644 --- a/pkgs/development/python-modules/pyscf/default.nix +++ b/pkgs/development/python-modules/pyscf/default.nix @@ -16,13 +16,13 @@ buildPythonPackage rec { pname = "pyscf"; - version = "2.3.0"; + version = "2.4.0"; src = fetchFromGitHub { owner = "pyscf"; repo = pname; rev = "v${version}"; - hash = "sha256-x693NB0oc9X7SuDZlV3VKOmgnIgKA39O9yswDM0outk="; + hash = "sha256-+dZsXiLqqyRWr1eOEVSHZ1KMM760hrDaT07ylZUcGmo="; }; # setup.py calls Cmake and passes the arguments in CMAKE_CONFIGURE_ARGS to cmake. From 0221bfa10820b8db2ca02e97f97b32913096fe18 Mon Sep 17 00:00:00 2001 From: Phillip Seeber Date: Fri, 20 Oct 2023 18:30:47 +0200 Subject: [PATCH 085/222] fypp: 3.1 -> 3.2 --- pkgs/development/python-modules/fypp/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/fypp/default.nix b/pkgs/development/python-modules/fypp/default.nix index 9504a5839e73..a75e141361a8 100644 --- a/pkgs/development/python-modules/fypp/default.nix +++ b/pkgs/development/python-modules/fypp/default.nix @@ -2,13 +2,13 @@ buildPythonApplication rec { pname = "fypp"; - version = "3.1"; + version = "3.2"; src = fetchFromGitHub { owner = "aradi"; repo = pname; rev = version; - hash = "sha256-iog5Gdcd1F230Nl4JDrKoyYr8JualVgNZQzHLzd4xe8="; + hash = "sha256-MgGVlOqOIrIVoDfBMVpFLT26mhYndxans2hfo/+jdoA="; }; meta = with lib; { From f32cdb9e842b8c51eccffd2d6d458d201fea41a8 Mon Sep 17 00:00:00 2001 From: YMSTNT <21342713+YMSTNT@users.noreply.github.com> Date: Wed, 18 Oct 2023 21:06:55 +0200 Subject: [PATCH 086/222] hifile: init at 0.9.9.5 --- pkgs/by-name/hi/hifile/package.nix | 41 ++++++++++++++++++++++++++++++ 1 file changed, 41 insertions(+) create mode 100644 pkgs/by-name/hi/hifile/package.nix diff --git a/pkgs/by-name/hi/hifile/package.nix b/pkgs/by-name/hi/hifile/package.nix new file mode 100644 index 000000000000..bf2bda5100dc --- /dev/null +++ b/pkgs/by-name/hi/hifile/package.nix @@ -0,0 +1,41 @@ +{ lib, appimageTools, fetchurl }: + +let + version = "0.9.9.5"; + pname = "hifile"; + + src = fetchurl { + url = "https://www.hifile.app/files/HiFile-${version}.AppImage"; + hash = "sha256-Ks/NLPm5loo9q8pT0LdtfcrC38203beNE74sbEpyuJM="; + }; + + appimageContents = appimageTools.extractType2 { + inherit pname version src; + }; + +in +appimageTools.wrapType2 rec { + inherit pname version src; + + extraInstallCommands = '' + mv $out/bin/${pname}-${version} $out/bin/${pname} + + install -m 444 -D ${appimageContents}/HiFile.desktop $out/share/applications/HiFile.desktop + install -m 444 -D ${appimageContents}/HiFile.png $out/share/icons/hicolor/512x512/apps/HiFile.png + substituteInPlace $out/share/applications/HiFile.desktop \ + --replace 'Exec=HiFile' 'Exec=${pname}' + ''; + + meta = with lib; { + description = "Dual-pane graphical file manager for Windows, macOS and Linux"; + longDescription = '' + HiFile is the next evolution of file managers. Its mission is to increase your productivity whenever you work with files or folders. It aims to be better in every way - more convenient, more versatile, more efficient, more elegant, more customizable, and more fun. + ''; + homepage = "https://www.hifile.app/"; + downloadPage = "https://www.hifile.app/download"; + license = licenses.unfree; + sourceProvenance = with sourceTypes; [ binaryNativeCode ]; + maintainers = with maintainers; [ ymstnt ]; + platforms = [ "x86_64-linux" ]; + }; +} From 3e7dae992bf426912f896283b71c6097d69d3751 Mon Sep 17 00:00:00 2001 From: Phillip Seeber Date: Fri, 20 Oct 2023 18:47:33 +0200 Subject: [PATCH 087/222] toml-f: 0.3.1 -> 0.4.1 --- pkgs/development/libraries/toml-f/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/libraries/toml-f/default.nix b/pkgs/development/libraries/toml-f/default.nix index d28447c40046..696e41ac71cc 100644 --- a/pkgs/development/libraries/toml-f/default.nix +++ b/pkgs/development/libraries/toml-f/default.nix @@ -8,13 +8,13 @@ stdenv.mkDerivation rec { pname = "toml-f"; - version = "0.3.1"; + version = "0.4.1"; src = fetchFromGitHub { owner = pname; repo = pname; rev = "v${version}"; - hash = "sha256-8FbnUkeJUP4fiuJCroAVDo6U2M7ZkFLpG2OYrapMYtU="; + hash = "sha256-sCU0uMdcXIA5O964hlK37cOrLTlk1CJeTcWD9FhevOs="; }; nativeBuildInputs = [ gfortran cmake ]; From 196341508c5b38ee54aefe79e1fc91f35b7b9072 Mon Sep 17 00:00:00 2001 From: Phillip Seeber Date: Fri, 20 Oct 2023 18:47:52 +0200 Subject: [PATCH 088/222] tblite: toml-f 0.4 compatibility --- .../libraries/science/chemistry/tblite/default.nix | 9 +++++++++ 1 file changed, 9 insertions(+) diff --git a/pkgs/development/libraries/science/chemistry/tblite/default.nix b/pkgs/development/libraries/science/chemistry/tblite/default.nix index 0f05315b9d88..7cc64937dc13 100644 --- a/pkgs/development/libraries/science/chemistry/tblite/default.nix +++ b/pkgs/development/libraries/science/chemistry/tblite/default.nix @@ -1,6 +1,7 @@ { stdenv , lib , fetchFromGitHub +, fetchpatch , cmake , gfortran , blas @@ -26,6 +27,14 @@ stdenv.mkDerivation rec { hash = "sha256-R7CAFG/x55k5Ieslxeq+DWq1wPip4cI+Yvn1cBbeVNs="; }; + patches = [ + # toml-f 0.4 compatibility + (fetchpatch { + url = "https://github.com/tblite/tblite/commit/da759fd02b8fbf470a5c6d3df9657cca6b1d0a9a.diff"; + hash = "sha256-VaeA2VyK+Eas432HMSpJ0lXxHBBNGpfkUO1eHeWpYl0="; + }) + ]; + nativeBuildInputs = [ cmake gfortran ]; buildInputs = [ From 99b53c5e7d2792733b7b4205f29991373765a505 Mon Sep 17 00:00:00 2001 From: Pol Dellaiera Date: Fri, 20 Oct 2023 18:59:06 +0200 Subject: [PATCH 089/222] bashly: init at 1.1.1 --- pkgs/by-name/ba/bashly/Gemfile | 2 + pkgs/by-name/ba/bashly/Gemfile.lock | 59 +++++++ pkgs/by-name/ba/bashly/gemset.nix | 231 ++++++++++++++++++++++++++++ pkgs/by-name/ba/bashly/package.nix | 38 +++++ 4 files changed, 330 insertions(+) create mode 100644 pkgs/by-name/ba/bashly/Gemfile create mode 100644 pkgs/by-name/ba/bashly/Gemfile.lock create mode 100644 pkgs/by-name/ba/bashly/gemset.nix create mode 100644 pkgs/by-name/ba/bashly/package.nix diff --git a/pkgs/by-name/ba/bashly/Gemfile b/pkgs/by-name/ba/bashly/Gemfile new file mode 100644 index 000000000000..b5d29f5f4c59 --- /dev/null +++ b/pkgs/by-name/ba/bashly/Gemfile @@ -0,0 +1,2 @@ +source 'https://rubygems.org' +gem 'bashly' diff --git a/pkgs/by-name/ba/bashly/Gemfile.lock b/pkgs/by-name/ba/bashly/Gemfile.lock new file mode 100644 index 000000000000..0021014b3728 --- /dev/null +++ b/pkgs/by-name/ba/bashly/Gemfile.lock @@ -0,0 +1,59 @@ +GEM + remote: https://rubygems.org/ + specs: + bashly (1.1.1) + colsole (>= 0.8.1, < 2) + completely (~> 0.6.1) + filewatcher (~> 2.0) + gtx (~> 0.1) + lp (~> 0.2) + mister_bin (~> 0.7) + psych (>= 3.3.2, < 7) + tty-markdown (~> 0.7) + colsole (1.0.0) + completely (0.6.1) + colsole (>= 0.8.1, < 2) + mister_bin (~> 0.7) + docopt_ng (0.7.1) + filewatcher (2.1.0) + module_methods (~> 0.1.0) + gtx (0.1.0) + kramdown (2.4.0) + rexml + lp (0.2.1) + mister_bin (0.7.6) + colsole (>= 0.8.1, < 2) + docopt_ng (~> 0.7, >= 0.7.1) + module_methods (0.1.0) + pastel (0.8.0) + tty-color (~> 0.5) + psych (5.1.1.1) + stringio + rexml (3.2.6) + rouge (4.1.3) + stringio (3.0.8) + strings (0.2.1) + strings-ansi (~> 0.2) + unicode-display_width (>= 1.5, < 3.0) + unicode_utils (~> 1.4) + strings-ansi (0.2.0) + tty-color (0.6.0) + tty-markdown (0.7.2) + kramdown (>= 1.16.2, < 3.0) + pastel (~> 0.8) + rouge (>= 3.14, < 5.0) + strings (~> 0.2.0) + tty-color (~> 0.5) + tty-screen (~> 0.8) + tty-screen (0.8.1) + unicode-display_width (2.5.0) + unicode_utils (1.4.0) + +PLATFORMS + x86_64-linux + +DEPENDENCIES + bashly + +BUNDLED WITH + 2.3.26 diff --git a/pkgs/by-name/ba/bashly/gemset.nix b/pkgs/by-name/ba/bashly/gemset.nix new file mode 100644 index 000000000000..e24c0b3483d7 --- /dev/null +++ b/pkgs/by-name/ba/bashly/gemset.nix @@ -0,0 +1,231 @@ +{ + bashly = { + dependencies = ["colsole" "completely" "filewatcher" "gtx" "lp" "mister_bin" "psych" "tty-markdown"]; + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "1rhzbpv8j5qcm5a84m4vzrryb0j8z90q6djbpid4ay2fr492kvkq"; + type = "gem"; + }; + version = "1.1.1"; + }; + colsole = { + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "1fvf6dz2wsvjk7q24z0dm8lajq3p2l6i5ywf3mxj683rmhwq49bg"; + type = "gem"; + }; + version = "1.0.0"; + }; + completely = { + dependencies = ["colsole" "mister_bin"]; + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "01nk1cigb09z6rjy41qrhqf58cgpqm43xwjdkz33mfmwrnz04cw1"; + type = "gem"; + }; + version = "0.6.1"; + }; + docopt_ng = { + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "0rsnl5s7k2s1gl4n4dg68ssg577kf11sl4a4l2lb2fpswj718950"; + type = "gem"; + }; + version = "0.7.1"; + }; + filewatcher = { + dependencies = ["module_methods"]; + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "03f9v57c5zag09mi10yjhdx7y0vv2w5wrnwzbij9hhkwh43rk077"; + type = "gem"; + }; + version = "2.1.0"; + }; + gtx = { + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "10hfhicvv371gy1i16x6vry1xglvxl0zh7qr6f14pqsx32qih6ff"; + type = "gem"; + }; + version = "0.1.0"; + }; + kramdown = { + dependencies = ["rexml"]; + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "1ic14hdcqxn821dvzki99zhmcy130yhv5fqfffkcf87asv5mnbmn"; + type = "gem"; + }; + version = "2.4.0"; + }; + lp = { + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "0ns1aza32n929w7smg1dsn4g6qlfi7k1jrvssyn35cicmwn0gyyr"; + type = "gem"; + }; + version = "0.2.1"; + }; + mister_bin = { + dependencies = ["colsole" "docopt_ng"]; + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "0xx8cxvzcn47zsnshcllf477x4rbssrchvp76929qnsg5k9q7fas"; + type = "gem"; + }; + version = "0.7.6"; + }; + module_methods = { + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "1886wjscfripgzlmyvcd0jmlzwr6hxvklm2a5rm32dw5bf7bvjki"; + type = "gem"; + }; + version = "0.1.0"; + }; + pastel = { + dependencies = ["tty-color"]; + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "0xash2gj08dfjvq4hy6l1z22s5v30fhizwgs10d6nviggpxsj7a8"; + type = "gem"; + }; + version = "0.8.0"; + }; + psych = { + dependencies = ["stringio"]; + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "0wjzrkssjfjpynij5dpycyflhqbjvi1gc2j73xgq3b196s1d3c24"; + type = "gem"; + }; + version = "5.1.1.1"; + }; + rexml = { + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "05i8518ay14kjbma550mv0jm8a6di8yp5phzrd8rj44z9qnrlrp0"; + type = "gem"; + }; + version = "3.2.6"; + }; + rouge = { + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "19drl3x8fw65v3mpy7fk3cf3dfrywz5alv98n2rm4pp04vdn71lw"; + type = "gem"; + }; + version = "4.1.3"; + }; + stringio = { + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "0ix96dxbjqlpymdigb4diwrifr0bq7qhsrng95fkkp18av326nqk"; + type = "gem"; + }; + version = "3.0.8"; + }; + strings = { + dependencies = ["strings-ansi" "unicode-display_width" "unicode_utils"]; + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "1yynb0qhhhplmpzavfrrlwdnd1rh7rkwzcs4xf0mpy2wr6rr6clk"; + type = "gem"; + }; + version = "0.2.1"; + }; + strings-ansi = { + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "120wa6yjc63b84lprglc52f40hx3fx920n4dmv14rad41rv2s9lh"; + type = "gem"; + }; + version = "0.2.0"; + }; + tty-color = { + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "0aik4kmhwwrmkysha7qibi2nyzb4c8kp42bd5vxnf8sf7b53g73g"; + type = "gem"; + }; + version = "0.6.0"; + }; + tty-markdown = { + dependencies = ["kramdown" "pastel" "rouge" "strings" "tty-color" "tty-screen"]; + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "04f599zn5rfndq4d9l0acllfpc041bzdkkz2h6x0dl18f2wivn0y"; + type = "gem"; + }; + version = "0.7.2"; + }; + tty-screen = { + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "18jr6s1cg8yb26wzkqa6874q0z93rq0y5aw092kdqazk71y6a235"; + type = "gem"; + }; + version = "0.8.1"; + }; + unicode-display_width = { + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "1d0azx233nags5jx3fqyr23qa2rhgzbhv8pxp46dgbg1mpf82xky"; + type = "gem"; + }; + version = "2.5.0"; + }; + unicode_utils = { + groups = ["default"]; + platforms = []; + source = { + remotes = ["https://rubygems.org"]; + sha256 = "0h1a5yvrxzlf0lxxa1ya31jcizslf774arnsd89vgdhk4g7x08mr"; + type = "gem"; + }; + version = "1.4.0"; + }; +} diff --git a/pkgs/by-name/ba/bashly/package.nix b/pkgs/by-name/ba/bashly/package.nix new file mode 100644 index 000000000000..5a3d6661caa2 --- /dev/null +++ b/pkgs/by-name/ba/bashly/package.nix @@ -0,0 +1,38 @@ +{ lib +, stdenvNoCC +, bundlerApp +}: + +let + bashlyBundlerApp = bundlerApp { + pname = "bashly"; + gemdir = ./.; + exes = [ "bashly" ]; + }; +in +stdenvNoCC.mkDerivation (finalAttrs: { + name = "bashly"; + + dontUnpack = true; + + installPhase = '' + runHook preInstall + + mkdir $out; + cd $out; + + mkdir bin; pushd bin; + ln -vs ${bashlyBundlerApp}/bin/bashly; + + runHook postInstall + ''; + + meta = { + description = "Bash command line framework and CLI generator"; + homepage = "https://github.com/DannyBen/bashly"; + license = lib.licenses.mit; + mainProgram = "bashly"; + maintainers = with lib.maintainers; [ drupol ]; + platforms = lib.platforms.unix; + }; +}) From 9d193512a7cb020c8a16e275f95347706df0d56b Mon Sep 17 00:00:00 2001 From: Tomkoid Date: Thu, 19 Oct 2023 07:36:00 +0200 Subject: [PATCH 090/222] maintainers: add tomkoid --- maintainers/maintainer-list.nix | 4 ++++ 1 file changed, 4 insertions(+) diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix index c8b31eccbea3..096be9dc8cc8 100644 --- a/maintainers/maintainer-list.nix +++ b/maintainers/maintainer-list.nix @@ -17745,6 +17745,10 @@ githubId = 13155277; name = "Tom Houle"; }; + tomkoid = { + email = "tomaszierl@outlook.com"; + name = "Tomkoid"; + }; tomodachi94 = { email = "tomodachi94+nixpkgs@protonmail.com"; matrix = "@tomodachi94:matrix.org"; From 3c85721e86962283ddf1a24e05b95a9ec64f46b7 Mon Sep 17 00:00:00 2001 From: Tomkoid Date: Tue, 17 Oct 2023 18:35:24 +0200 Subject: [PATCH 091/222] mdhtml: init at 0.2.2 --- pkgs/tools/text/mdhtml/default.nix | 28 ++++++++++++++++++++++++++++ pkgs/top-level/all-packages.nix | 2 ++ 2 files changed, 30 insertions(+) create mode 100644 pkgs/tools/text/mdhtml/default.nix diff --git a/pkgs/tools/text/mdhtml/default.nix b/pkgs/tools/text/mdhtml/default.nix new file mode 100644 index 000000000000..b5d12e7b3dcf --- /dev/null +++ b/pkgs/tools/text/mdhtml/default.nix @@ -0,0 +1,28 @@ +{ lib +, buildGoModule +, fetchFromGitea +}: + +buildGoModule rec { + pname = "mdhtml"; + version = "0.2.2"; + + src = fetchFromGitea { + domain = "codeberg.org"; + owner = "Tomkoid"; + repo = pname; + rev = version; + hash = "sha256-893pqrrTftzKqPYZgukV/yx2gkukVZWDTgg7ufx1MsY="; + }; + + vendorHash = null; + + meta = with lib; { + description = "Really simple CLI Markdown to HTML converter with styling support"; + homepage = "https://codeberg.org/Tomkoid/mdhtml"; + license = licenses.mit; + changelog = "https://codeberg.org/Tomkoid/mdhtml/releases"; + maintainers = with maintainers; [ tomkoid ]; + mainProgram = "mdhtml"; + }; +} diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index e8040cd4fad1..c3d369cfdd30 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -42084,4 +42084,6 @@ with pkgs; }; code-maat = callPackage ../development/tools/code-maat {}; + + mdhtml = callPackage ../tools/text/mdhtml { }; } From 3b4df3d62e73be34c391bb79c9bb0551979edd73 Mon Sep 17 00:00:00 2001 From: henkery Date: Fri, 20 Oct 2023 20:41:18 +0200 Subject: [PATCH 092/222] starsector: 0.96a-RC8 -> 0.96a-RC10 --- pkgs/games/starsector/default.nix | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/pkgs/games/starsector/default.nix b/pkgs/games/starsector/default.nix index 3951f36f83bf..e1bc4a8dbbcf 100644 --- a/pkgs/games/starsector/default.nix +++ b/pkgs/games/starsector/default.nix @@ -13,11 +13,11 @@ stdenv.mkDerivation rec { pname = "starsector"; - version = "0.96a-RC8"; + version = "0.96a-RC10"; src = fetchzip { - url = "https://s3.amazonaws.com/fractalsoftworks/starsector/starsector_linux-${version}.zip"; - sha256 = "sha256-RDXqFqiWpBG3kasofzbOl7Zp0a9LiMpJKsHcFaJtm2Y="; + url = "https://f005.backblazeb2.com/file/fractalsoftworks/release/starsector_linux-${version}.zip"; + sha256 = "sha256-RBSnms+QlKgTOhm3t2hDfv7OcMrQCk1rfkz9GaM74WM="; }; nativeBuildInputs = [ copyDesktopItems makeWrapper ]; @@ -82,7 +82,7 @@ stdenv.mkDerivation rec { #!/usr/bin/env nix-shell #!nix-shell -i bash -p curl gnugrep common-updater-scripts set -eou pipefail; - version=$(curl -s https://fractalsoftworks.com/preorder/ | grep -oP "https://s3.amazonaws.com/fractalsoftworks/starsector/starsector_linux-\K.*?(?=\.zip)" | head -1) + version=$(curl -s https://fractalsoftworks.com/preorder/ | grep -oP "https://f005.backblazeb2.com/file/fractalsoftworks/release/starsector_linux-\K.*?(?=\.zip)" | head -1) update-source-version ${pname} "$version" --file=./pkgs/games/starsector/default.nix ''; } From 97df2b05136da2d2cd13c85e1be43550562e7ad3 Mon Sep 17 00:00:00 2001 From: Anton Mosich Date: Fri, 20 Oct 2023 20:51:59 +0200 Subject: [PATCH 093/222] minify: 2.12.9 -> 2.19.10 See https://github.com/tdewolff/minify/releases/tag/v2.19.10 --- pkgs/development/web/minify/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/development/web/minify/default.nix b/pkgs/development/web/minify/default.nix index 1c832bb456db..86ef8a4759f2 100644 --- a/pkgs/development/web/minify/default.nix +++ b/pkgs/development/web/minify/default.nix @@ -9,16 +9,16 @@ buildGoModule rec { pname = "minify"; - version = "2.12.9"; + version = "2.19.10"; src = fetchFromGitHub { owner = "tdewolff"; repo = pname; rev = "v${version}"; - hash = "sha256-+NBYn+gEsoclROnq2msNB4knviGn/XA9vNAuB0JZNek="; + hash = "sha256-/OfNHhWbRZI7nRhBnjXfxL4Gf011ydlwEMDadCptFJY="; }; - vendorHash = "sha256-/Pw7fHVXWsovxfyzkWfb6UiRDBmiua82667N4Scl5+A="; + vendorHash = "sha256-ZtQbhhdt9mGRbTpgm6O4wnSPoKF9bAEswppmK+Urqhs="; nativeBuildInputs = [ installShellFiles ]; From e851b85178f6705064eb0be3921ab27476d7ce9f Mon Sep 17 00:00:00 2001 From: makefu Date: Fri, 20 Oct 2023 22:03:26 +0200 Subject: [PATCH 094/222] dex2jar: 2.1 -> 2.4 --- pkgs/development/tools/java/dex2jar/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/development/tools/java/dex2jar/default.nix b/pkgs/development/tools/java/dex2jar/default.nix index 97fa2298b051..e0ce19dc8d2f 100644 --- a/pkgs/development/tools/java/dex2jar/default.nix +++ b/pkgs/development/tools/java/dex2jar/default.nix @@ -8,11 +8,11 @@ stdenvNoCC.mkDerivation (finalAttrs: { pname = "dex2jar"; - version = "2.1"; + version = "2.4"; src = fetchurl { - url = "https://github.com/pxb1988/dex2jar/releases/download/v${finalAttrs.version}/dex2jar-${finalAttrs.version}.zip"; - hash = "sha256-epvfhD1D3k0elOwue29VglAXsMSn7jn/gmYOJJOkbwg="; + url = "https://github.com/pxb1988/dex2jar/releases/download/v${finalAttrs.version}/dex-tools-v${finalAttrs.version}.zip"; + hash = "sha256-7nxF6zwdJHSmFF2NRH5lGnNqItlmS209O+WlqBfdojo="; }; nativeBuildInputs = [ makeWrapper unzip ]; From 07c9c7effb1e596c65c6d293c5beace6e8e3bdc4 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Fri, 20 Oct 2023 20:03:38 +0000 Subject: [PATCH 095/222] terraform-providers.project: 1.3.2 -> 1.3.3 --- .../networking/cluster/terraform-providers/providers.json | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/applications/networking/cluster/terraform-providers/providers.json b/pkgs/applications/networking/cluster/terraform-providers/providers.json index 32f29dea87ca..91b368877e6b 100644 --- a/pkgs/applications/networking/cluster/terraform-providers/providers.json +++ b/pkgs/applications/networking/cluster/terraform-providers/providers.json @@ -953,11 +953,11 @@ "vendorHash": null }, "project": { - "hash": "sha256-D+UBv6JEbJKGfwTJU7/W5N6otOLW2lq6+euUKpoJ+To=", + "hash": "sha256-UO9GBBoOzA1stMq8naXWtxomme6CVdlngVCLQlbZDv0=", "homepage": "https://registry.terraform.io/providers/jfrog/project", "owner": "jfrog", "repo": "terraform-provider-project", - "rev": "v1.3.2", + "rev": "v1.3.3", "spdx": "Apache-2.0", "vendorHash": "sha256-Tj+NefCIacwpPS9rNPPxV2lLeKsXJMZhf9Xo+Rzz6gI=" }, From 16954e2097dc84a3462dc7d67094bb29b0173286 Mon Sep 17 00:00:00 2001 From: Mikael Fangel <34864484+MikaelFangel@users.noreply.github.com> Date: Fri, 20 Oct 2023 22:06:34 +0200 Subject: [PATCH 096/222] presenterm: 0.2.0 -> 0.2.1 --- pkgs/by-name/pr/presenterm/package.nix | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/pkgs/by-name/pr/presenterm/package.nix b/pkgs/by-name/pr/presenterm/package.nix index e3c42056a275..6e09e86f2059 100644 --- a/pkgs/by-name/pr/presenterm/package.nix +++ b/pkgs/by-name/pr/presenterm/package.nix @@ -2,16 +2,16 @@ rustPlatform.buildRustPackage rec { pname = "presenterm"; - version = "0.2.0"; + version = "0.2.1"; src = fetchFromGitHub { owner = "mfontanini"; repo = "presenterm"; - rev = version; - hash = "sha256-mNWnUUezKIffh5gMgMMdvApNZZTxxB8XrL0jFLyBxuk="; + rev = "v${version}"; + hash = "sha256-sXVMVU34gxZKGNye6hoyv07a7N7f6UbivA6thbSOeZA="; }; - cargoHash = "sha256-JLPJLhWN/yXpPIHa+FJ2aQ/GDUFKtZ7t+/8rvR8WNKM="; + cargoHash = "sha256-PsDaXMws/8hEvAZwClQ4okGuryg1iKg0IBr7Xp2QYBE="; meta = with lib; { description = "A terminal based slideshow tool"; From 3c0bf35c62231630cae7bd807ff3e9150bd38211 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Fri, 20 Oct 2023 22:18:15 +0200 Subject: [PATCH 097/222] python311Packages.aioelectricitymaps: init at 0.1.3 Module for interacting with Electricity maps "https://github.com/jpbede/aioelectricitymaps --- .../aioelectricitymaps/default.nix | 55 +++++++++++++++++++ pkgs/top-level/python-packages.nix | 2 + 2 files changed, 57 insertions(+) create mode 100644 pkgs/development/python-modules/aioelectricitymaps/default.nix diff --git a/pkgs/development/python-modules/aioelectricitymaps/default.nix b/pkgs/development/python-modules/aioelectricitymaps/default.nix new file mode 100644 index 000000000000..502363de13c3 --- /dev/null +++ b/pkgs/development/python-modules/aioelectricitymaps/default.nix @@ -0,0 +1,55 @@ +{ lib +, aiohttp +, aresponses +, buildPythonPackage +, dataclasses-json +, fetchFromGitHub +, poetry-core +, pytest-asyncio +, pytestCheckHook +, pythonOlder +, syrupy +}: + +buildPythonPackage rec { + pname = "aioelectricitymaps"; + version = "0.1.3"; + pyproject = true; + + disabled = pythonOlder "3.10"; + + src = fetchFromGitHub { + owner = "jpbede"; + repo = "aioelectricitymaps"; + rev = "refs/tags/v${version}"; + hash = "sha256-2Ou3obpGRJ/iUPuaoBGlmDTJLx6+S8ivK9PbrbSvYyg="; + }; + + nativeBuildInputs = [ + poetry-core + ]; + + propagatedBuildInputs = [ + aiohttp + dataclasses-json + ]; + + nativeCheckInputs = [ + aresponses + pytest-asyncio + pytestCheckHook + syrupy + ]; + + pythonImportsCheck = [ + "aioelectricitymaps" + ]; + + meta = with lib; { + description = "Module for interacting with Electricity maps"; + homepage = "https://github.com/jpbede/aioelectricitymaps"; + changelog = "https://github.com/jpbede/aioelectricitymaps/releases/tag/v${version}"; + license = licenses.mit; + maintainers = with maintainers; [ fab ]; + }; +} diff --git a/pkgs/top-level/python-packages.nix b/pkgs/top-level/python-packages.nix index 800ee49e8b00..8853200ee36d 100644 --- a/pkgs/top-level/python-packages.nix +++ b/pkgs/top-level/python-packages.nix @@ -198,6 +198,8 @@ self: super: with self; { aioecowitt = callPackage ../development/python-modules/aioecowitt { }; + aioelectricitymaps = callPackage ../development/python-modules/aioelectricitymaps { }; + aioemonitor = callPackage ../development/python-modules/aioemonitor { }; aioesphomeapi = callPackage ../development/python-modules/aioesphomeapi { }; From 0fffb95d11bda5ed4c7eb1be9d47675b7405d746 Mon Sep 17 00:00:00 2001 From: Robert Timis <65460527+TimisRobert@users.noreply.github.com> Date: Fri, 20 Oct 2023 18:34:17 +0200 Subject: [PATCH 098/222] flink: fix, remove extra " --- pkgs/applications/networking/cluster/flink/default.nix | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/pkgs/applications/networking/cluster/flink/default.nix b/pkgs/applications/networking/cluster/flink/default.nix index f0547dcf5609..70c70d9ead43 100644 --- a/pkgs/applications/networking/cluster/flink/default.nix +++ b/pkgs/applications/networking/cluster/flink/default.nix @@ -22,7 +22,7 @@ stdenv.mkDerivation rec { --prefix PATH : ${jre}/bin cat <> $out/opt/flink/conf/flink-conf.yaml - env.java.home: ${jre}" + env.java.home: ${jre} env.log.dir: /tmp/flink-logs EOF ''; From acb0bfe16e6e90db9919416b6bb11d7a8b3092f7 Mon Sep 17 00:00:00 2001 From: Alessio <35380179+AlecsFerra@users.noreply.github.com> Date: Fri, 20 Oct 2023 22:52:25 +0200 Subject: [PATCH 099/222] albert: make albert run correctly under wayland closes #246841 --- pkgs/applications/misc/albert/default.nix | 2 ++ 1 file changed, 2 insertions(+) diff --git a/pkgs/applications/misc/albert/default.nix b/pkgs/applications/misc/albert/default.nix index a9008283dd28..ceb74f7b0a32 100644 --- a/pkgs/applications/misc/albert/default.nix +++ b/pkgs/applications/misc/albert/default.nix @@ -10,6 +10,7 @@ , qtscxml , qtsvg , qtdeclarative +, qtwayland , qt5compat , wrapQtAppsHook , nix-update-script @@ -42,6 +43,7 @@ stdenv.mkDerivation (finalAttrs: { qtscxml qtsvg qtdeclarative + qtwayland qt5compat ] ++ (with python3Packages; [ python pybind11 ]); From 543ba76c68b45076bbd48c7398093b9c81efa96e Mon Sep 17 00:00:00 2001 From: Mikael Fangel <34864484+MikaelFangel@users.noreply.github.com> Date: Fri, 20 Oct 2023 23:12:13 +0200 Subject: [PATCH 100/222] zkg: drop --- pkgs/tools/package-management/zkg/default.nix | 42 ------------------- pkgs/top-level/aliases.nix | 1 + pkgs/top-level/all-packages.nix | 2 - 3 files changed, 1 insertion(+), 44 deletions(-) delete mode 100644 pkgs/tools/package-management/zkg/default.nix diff --git a/pkgs/tools/package-management/zkg/default.nix b/pkgs/tools/package-management/zkg/default.nix deleted file mode 100644 index 9d6700469722..000000000000 --- a/pkgs/tools/package-management/zkg/default.nix +++ /dev/null @@ -1,42 +0,0 @@ -{ lib -, python3 -, fetchFromGitHub -, pkgs -}: - -python3.pkgs.buildPythonApplication rec { - pname = "zkg"; - version = "2.14.0"; - format = "setuptools"; - - src = fetchFromGitHub { - owner = "zeek"; - repo = "package-manager"; - rev = "refs/tags/v${version}"; - hash = "sha256-HdOzxSU3XWz1ZH96woDWrHzKbpJW3/IKkpc2tGfyi9o="; - }; - - propagatedBuildInputs = with python3.pkgs; [ - btest - gitpython - semantic-version - sphinx - sphinx-rtd-theme - pkgs.bash - ]; - - # No tests available - doCheck = false; - - pythonImportsCheck = [ - "zeekpkg" - ]; - - meta = with lib; { - description = "Package manager for Zeek"; - homepage = "https://github.com/zeek/package-manager"; - changelog = "https://github.com/zeek/package-manager/blob/${version}/CHANGES"; - license = licenses.ncsa; - maintainers = with maintainers; [ fab ]; - }; -} diff --git a/pkgs/top-level/aliases.nix b/pkgs/top-level/aliases.nix index 9d2e755ca144..c20c9e414595 100644 --- a/pkgs/top-level/aliases.nix +++ b/pkgs/top-level/aliases.nix @@ -973,6 +973,7 @@ mapAliases ({ ### Z ### zinc = zincsearch; # Added 2023-05-28 + zkg = throw "'zkg' has been replaced by 'zeek'"; zq = zed.overrideAttrs (old: { meta = old.meta // { mainProgram = "zq"; }; }); # Added 2023-02-06 ### UNSORTED ### diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index 860a152807e2..20366904d9e3 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -41488,8 +41488,6 @@ with pkgs; xbps = callPackage ../tools/package-management/xbps { }; - zkg = callPackage ../tools/package-management/zkg { }; - xcftools = callPackage ../tools/graphics/xcftools { }; xhyve = callPackage ../applications/virtualization/xhyve { From 1b3831f1e64ec4c50ced27e52658349ddfad8819 Mon Sep 17 00:00:00 2001 From: Artturin Date: Sat, 21 Oct 2023 00:26:57 +0300 Subject: [PATCH 101/222] stdenv: fix typo --- pkgs/stdenv/linux/default.nix | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/pkgs/stdenv/linux/default.nix b/pkgs/stdenv/linux/default.nix index 5c03312cc75f..35cdb6311df3 100644 --- a/pkgs/stdenv/linux/default.nix +++ b/pkgs/stdenv/linux/default.nix @@ -68,7 +68,7 @@ mipsel-linux = import ./bootstrap-files/mipsel-unknown-linux-gnu.nix; mips64el-linux = import (if localSystem.isMips64n32 - then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix.nix + then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix else ./bootstrap-files/mips64el-unknown-linux-gnuabi64.nix); powerpc64le-linux = import ./bootstrap-files/powerpc64le-unknown-linux-gnu.nix; riscv64-linux = import ./bootstrap-files/riscv64-unknown-linux-gnu.nix; From 700044610fce095620a1bbd75fcff8e1106ddeac Mon Sep 17 00:00:00 2001 From: K900 Date: Sat, 21 Oct 2023 00:55:54 +0300 Subject: [PATCH 102/222] steam: allow setting extraBwrapArgs, remove unshare* options matching defaults --- pkgs/games/steam/fhsenv.nix | 15 ++++----------- 1 file changed, 4 insertions(+), 11 deletions(-) diff --git a/pkgs/games/steam/fhsenv.nix b/pkgs/games/steam/fhsenv.nix index a6734b640638..78c669614c07 100644 --- a/pkgs/games/steam/fhsenv.nix +++ b/pkgs/games/steam/fhsenv.nix @@ -3,6 +3,7 @@ , extraPkgs ? pkgs: [ ] # extra packages to add to targetPkgs , extraLibraries ? pkgs: [ ] # extra packages to add to multiPkgs , extraProfile ? "" # string to append to profile +, extraBwrapArgs ? [ ] # extra arguments to pass to bubblewrap , extraArgs ? "" # arguments to always pass to steam , extraEnv ? { } # Environment variables to pass to Steam , withGameSpecificLibraries ? true # include game specific libraries @@ -277,6 +278,8 @@ in buildFHSEnv rec { exec steam ${extraArgs} "$@" ''; + inherit extraBwrapArgs; + meta = if steam != null then @@ -287,21 +290,11 @@ in buildFHSEnv rec { description = "Steam dependencies (dummy package, do not use)"; }; - # allows for some gui applications to share IPC - # this fixes certain issues where they don't render correctly - unshareIpc = false; - - # Some applications such as Natron need access to MIT-SHM or other - # shared memory mechanisms. Unsharing the pid namespace - # breaks the ability for application to reference shared memory. - unsharePid = false; - passthru.run = buildFHSEnv { name = "steam-run"; targetPkgs = commonTargetPkgs; - inherit multiArch multiPkgs profile extraInstallCommands; - inherit unshareIpc unsharePid; + inherit multiArch multiPkgs profile extraInstallCommands extraBwrapArgs; runScript = writeShellScript "steam-run" '' run="$1" From 562a77f9421b1c06f0df5be841286770a6ebe384 Mon Sep 17 00:00:00 2001 From: Martin Weinelt Date: Sat, 21 Oct 2023 00:17:30 +0200 Subject: [PATCH 103/222] python311Packages.async-upnp-client: 0.36.1 -> 0.36.2 https://github.com/StevenLooman/async_upnp_client/blob/0.36.2/CHANGES.rst --- pkgs/development/python-modules/async-upnp-client/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/async-upnp-client/default.nix b/pkgs/development/python-modules/async-upnp-client/default.nix index 03b7e8664c46..c51c99d00f0b 100644 --- a/pkgs/development/python-modules/async-upnp-client/default.nix +++ b/pkgs/development/python-modules/async-upnp-client/default.nix @@ -15,7 +15,7 @@ buildPythonPackage rec { pname = "async-upnp-client"; - version = "0.36.1"; + version = "0.36.2"; format = "setuptools"; disabled = pythonOlder "3.8"; @@ -24,7 +24,7 @@ buildPythonPackage rec { owner = "StevenLooman"; repo = "async_upnp_client"; rev = "refs/tags/${version}"; - hash = "sha256-NFSJlBRVgeuhK7IXjNz2g6SbSgveSjaJpSQrxSACG04="; + hash = "sha256-f3x5adxLHT/C5dXfdBH6stKv0y2nuhbpe8jkJex1DKU="; }; propagatedBuildInputs = [ From a316aa58d9cdbe01220e2e740dd94a6a6d3b3689 Mon Sep 17 00:00:00 2001 From: Janik H Date: Tue, 12 Sep 2023 03:20:02 +0200 Subject: [PATCH 104/222] nixos/networkmanager: add declarative profiles --- .../services/networking/networkmanager.nix | 93 +++++++++++++++++++ 1 file changed, 93 insertions(+) diff --git a/nixos/modules/services/networking/networkmanager.nix b/nixos/modules/services/networking/networkmanager.nix index 53c847ee3ca2..d32712c8243d 100644 --- a/nixos/modules/services/networking/networkmanager.nix +++ b/nixos/modules/services/networking/networkmanager.nix @@ -4,6 +4,7 @@ with lib; let cfg = config.networking.networkmanager; + ini = pkgs.formats.ini { }; delegateWireless = config.networking.wireless.enable == true && cfg.unmanaged != [ ]; @@ -379,6 +380,74 @@ in https://modemmanager.org/docs/modemmanager/fcc-unlock/#integration-with-third-party-fcc-unlock-tools. ''; }; + ensureProfiles = { + profiles = with lib.types; mkOption { + type = attrsOf (submodule { + freeformType = ini.type; + + options = { + connection = { + id = lib.mkOption { + type = str; + description = "This is the name that will be displayed by NetworkManager and GUIs."; + }; + type = lib.mkOption { + type = str; + description = "The connection type defines the connection kind, like vpn, wireguard, gsm, wifi and more."; + example = "vpn"; + }; + }; + }; + }); + apply = (lib.filterAttrsRecursive (n: v: v != { })); + default = { }; + example = { + home-wifi = { + connection = { + id = "home-wifi"; + type = "wifi"; + permissions = ""; + }; + wifi = { + mac-address-blacklist = ""; + mode = "infrastructure"; + ssid = "Home Wi-Fi"; + }; + wifi-security = { + auth-alg = "open"; + key-mgmt = "wpa-psk"; + psk = "$HOME_WIFI_PASSWORD"; + }; + ipv4 = { + dns-search = ""; + method = "auto"; + }; + ipv6 = { + addr-gen-mode = "stable-privacy"; + dns-search = ""; + method = "auto"; + }; + }; + }; + description = lib.mdDoc '' + Declaratively define NetworkManager profiles. You can find information about the generated file format [here](https://networkmanager.dev/docs/api/latest/nm-settings-keyfile.html) and [here](https://access.redhat.com/documentation/en-us/red_hat_enterprise_linux/8/html/configuring_and_managing_networking/assembly_networkmanager-connection-profiles-in-keyfile-format_configuring-and-managing-networking). + You current profiles which are most likely stored in `/etc/NetworkManager/system-connections` and there is [a tool](https://github.com/janik-haag/nm2nix) to convert them to the needed nix code. + If you add a new ad-hoc connection via a GUI or nmtui or anything similar it should just work together with the declarative ones. + And if you edit a declarative profile NetworkManager will move it to the persistent storage and treat it like a ad-hoc one, + but there will be two profiles as soon as the systemd unit from this option runs again which can be confusing since NetworkManager tools will start displaying two profiles with the same name and probably a bit different settings depending on what you edited. + A profile won't be deleted even if it's removed from the config until the system reboots because that's when NetworkManager clears it's temp directory. + ''; + }; + environmentFiles = mkOption { + default = []; + type = types.listOf types.path; + example = [ "/run/secrets/network-manager.env" ]; + description = lib.mdDoc '' + Files to load as environment file. Environment variables from this file + will be substituted into the static configuration file using [envsubst](https://github.com/a8m/envsubst). + ''; + }; + }; }; }; @@ -507,6 +576,30 @@ in aliases = [ "dbus-org.freedesktop.nm-dispatcher.service" ]; }; + systemd.services.NetworkManager-ensure-profiles = mkIf (cfg.ensureProfiles.profiles != { }) { + description = "Ensure that NetworkManager declarative profiles are created"; + wantedBy = [ "multi-user.target" ]; + before = [ "network-online.target" ]; + script = let + path = id: "/run/NetworkManager/system-connections/${id}.nmconnection"; + in '' + mkdir -p /run/NetworkManager/system-connections + '' + lib.concatMapStringsSep "\n" + (profile: '' + ${pkgs.envsubst}/bin/envsubst -i ${ini.generate (lib.escapeShellArg profile.n) profile.v} > ${path (lib.escapeShellArg profile.n)} + '') (lib.mapAttrsToList (n: v: { inherit n v; }) cfg.ensureProfiles.profiles) + + '' + if systemctl is-active --quiet NetworkManager; then + ${pkgs.networkmanager}/bin/nmcli connection reload + fi + ''; + serviceConfig = { + EnvironmentFile = cfg.ensureProfiles.environmentFiles; + UMask = "0177"; + Type = "oneshot"; + }; + }; + # Turn off NixOS' network management when networking is managed entirely by NetworkManager networking = mkMerge [ (mkIf (!delegateWireless) { From d3a20dccd64859816dd38c44fd7651df713d9a5f Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Fri, 20 Oct 2023 22:28:30 +0000 Subject: [PATCH 105/222] terraform-providers.vultr: 2.16.3 -> 2.16.4 --- .../networking/cluster/terraform-providers/providers.json | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/applications/networking/cluster/terraform-providers/providers.json b/pkgs/applications/networking/cluster/terraform-providers/providers.json index 32f29dea87ca..7804dca70da5 100644 --- a/pkgs/applications/networking/cluster/terraform-providers/providers.json +++ b/pkgs/applications/networking/cluster/terraform-providers/providers.json @@ -1279,11 +1279,11 @@ "vendorHash": "sha256-4ulRYzb4bzk0TztT04CwqlnMGw8tp7YnoCm2/NqGN7Y=" }, "vultr": { - "hash": "sha256-65QWogqHR5RYUXBYjM50PNQSuVWYGtqtULTGNy1ivag=", + "hash": "sha256-8pj+udTNTjT/tXggOaIOThRQkYoI3v68rEssSUojM2A=", "homepage": "https://registry.terraform.io/providers/vultr/vultr", "owner": "vultr", "repo": "terraform-provider-vultr", - "rev": "v2.16.3", + "rev": "v2.16.4", "spdx": "MPL-2.0", "vendorHash": null }, From 559561a66da345597261e5f6e97b1a620c021bdb Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Fri, 20 Oct 2023 22:31:43 +0000 Subject: [PATCH 106/222] terragrunt: 0.52.1 -> 0.52.3 --- pkgs/applications/networking/cluster/terragrunt/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/applications/networking/cluster/terragrunt/default.nix b/pkgs/applications/networking/cluster/terragrunt/default.nix index 1e6c86915acd..65cddcbc34d4 100644 --- a/pkgs/applications/networking/cluster/terragrunt/default.nix +++ b/pkgs/applications/networking/cluster/terragrunt/default.nix @@ -5,16 +5,16 @@ buildGoModule rec { pname = "terragrunt"; - version = "0.52.1"; + version = "0.52.3"; src = fetchFromGitHub { owner = "gruntwork-io"; repo = pname; rev = "refs/tags/v${version}"; - hash = "sha256-t1GAcOZAYdfrI0lsyKUEBbnJaGzuFP0+Mz3Yrv4Bmik="; + hash = "sha256-o/4L7TBdFFHuPOKAO/wP0IBixQtZHGr1GSNlsEpq710="; }; - vendorHash = "sha256-NSrZVLQ3Qbnp94qCV7NbrEav/7LCRbTov+B2vzbuvdM="; + vendorHash = "sha256-RmzSKt5qt9Qb4GDrfs4dJEhGQW/jFbXPn+AOLzEyo6c="; doCheck = false; From 63ecebe2a3ffe0aaa2c9b371d1bb52aee0aa6496 Mon Sep 17 00:00:00 2001 From: dadada Date: Sun, 9 Jul 2023 02:16:56 +0200 Subject: [PATCH 107/222] soft-serve: fix shell hook This adds bash to the PATH of soft-serve. This is required for the hooks to work, since they are implemented in bash. --- pkgs/servers/soft-serve/default.nix | 6 ++++-- 1 file changed, 4 insertions(+), 2 deletions(-) diff --git a/pkgs/servers/soft-serve/default.nix b/pkgs/servers/soft-serve/default.nix index 5072869c39b6..01a5ea9d6dd0 100644 --- a/pkgs/servers/soft-serve/default.nix +++ b/pkgs/servers/soft-serve/default.nix @@ -1,4 +1,4 @@ -{ lib, buildGoModule, fetchFromGitHub, makeWrapper, git }: +{ lib, buildGoModule, fetchFromGitHub, makeWrapper, git, bash }: buildGoModule rec { pname = "soft-serve"; @@ -20,8 +20,10 @@ buildGoModule rec { nativeBuildInputs = [ makeWrapper ]; postInstall = '' + # Soft-serve generates git-hooks at run-time. + # The scripts require git and bash inside the path. wrapProgram $out/bin/soft \ - --prefix PATH : "${lib.makeBinPath [ git ]}" + --prefix PATH : "${lib.makeBinPath [ git bash ]}" ''; meta = with lib; { From 916f5582f082babcafa629a79dcd3a0c4905fa84 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Sandro=20J=C3=A4ckel?= Date: Sat, 21 Oct 2023 01:21:25 +0200 Subject: [PATCH 108/222] golangci-lint: 1.54.2 -> 1.55.0 Diff: https://github.com/golangci/golangci-lint/compare/v1.54.2...v1.55.0 Changelog: https://github.com/golangci/golangci-lint/blob/v1.55.0/CHANGELOG.md --- pkgs/development/tools/golangci-lint/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/development/tools/golangci-lint/default.nix b/pkgs/development/tools/golangci-lint/default.nix index 5bfb0996e660..62aaf9973c8b 100644 --- a/pkgs/development/tools/golangci-lint/default.nix +++ b/pkgs/development/tools/golangci-lint/default.nix @@ -2,16 +2,16 @@ buildGoModule rec { pname = "golangci-lint"; - version = "1.54.2"; + version = "1.55.0"; src = fetchFromGitHub { owner = "golangci"; repo = "golangci-lint"; rev = "v${version}"; - hash = "sha256-7nbgiUrp7S7sXt7uFXX8NHYbIRLZZQcg+18IdwAZBfE="; + hash = "sha256-77bhXeABkV6WZCzoGnRS447pEVcJyj4AF+wihJe62fc="; }; - vendorHash = "sha256-IyH5lG2a4zjsg/MUonCUiAgMl4xx8zSflRyzNgk8MR0="; + vendorHash = "sha256-3aHLilu+AZ6376bn9eS8kmSfo6fXikOFJKDRCYu+4a0="; subPackages = [ "cmd/golangci-lint" ]; From fb2ee503c162c5a3933c369abb44828d494d235a Mon Sep 17 00:00:00 2001 From: The Galaxy Date: Sat, 21 Oct 2023 07:35:34 +0800 Subject: [PATCH 109/222] konbucase: init at 4.1.1 --- pkgs/by-name/ko/konbucase/package.nix | 52 +++++++++++++++++++++++++++ 1 file changed, 52 insertions(+) create mode 100644 pkgs/by-name/ko/konbucase/package.nix diff --git a/pkgs/by-name/ko/konbucase/package.nix b/pkgs/by-name/ko/konbucase/package.nix new file mode 100644 index 000000000000..75876d990661 --- /dev/null +++ b/pkgs/by-name/ko/konbucase/package.nix @@ -0,0 +1,52 @@ +{ lib +, stdenv +, fetchFromGitHub +, meson +, ninja +, vala +, pkg-config +, wrapGAppsHook +, pantheon +, gtksourceview5 +}: + +stdenv.mkDerivation (finalAttrs: { + pname = "konbucase"; + version = "4.1.1"; + + src = fetchFromGitHub { + owner = "ryonakano"; + repo = "konbucase"; + rev = finalAttrs.version; + hash = "sha256-g3EDa9EXymi6c8dRHFZYGEAT7k8M2TXUAzZVKTnLzyk="; + fetchSubmodules = true; + }; + + nativeBuildInputs = [ + meson + ninja + vala + pkg-config + wrapGAppsHook + ]; + + buildInputs = [ + pantheon.granite7 + gtksourceview5 + ]; + + postInstall = '' + mv $out/bin/com.github.ryonakano.konbucase $out/bin/konbucase + substituteInPlace $out/share/applications/com.github.ryonakano.konbucase.desktop \ + --replace 'Exec=com.github.ryonakano.konbucase' 'Exec=${placeholder "out"}/bin/konbucase' + ''; + + meta = with lib; { + homepage = "https://github.com/ryonakano/konbucase"; + description = "A case converting app suitable for coding or typing"; + license = licenses.gpl3Only; + maintainers = with maintainers; [ galaxy ]; + platforms = platforms.linux; + mainProgram = "konbucase"; + }; +}) From 216b2bdf7f22c3051c6204ce0f4555cdbf307601 Mon Sep 17 00:00:00 2001 From: h7x4 Date: Fri, 20 Oct 2023 21:26:19 +0200 Subject: [PATCH 110/222] CONTRIBUTING.md: fix a missing sentence ending --- CONTRIBUTING.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md index 32201333c37b..06b9c10dfec6 100644 --- a/CONTRIBUTING.md +++ b/CONTRIBUTING.md @@ -565,7 +565,7 @@ Names of files and directories should be in lowercase, with dashes between words - Do not use tab characters, i.e. configure your editor to use soft tabs. For instance, use `(setq-default indent-tabs-mode nil)` in Emacs. Everybody has different tab settings so it’s asking for trouble. -- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [](#sec-package-naming). +- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [package naming](./pkgs/README.md#package-naming). - Function calls with attribute set arguments are written as From 63a7e4f3e709bf3db0bc84fbc17d374caecaf6d5 Mon Sep 17 00:00:00 2001 From: Mikael Fangel <34864484+MikaelFangel@users.noreply.github.com> Date: Sat, 21 Oct 2023 02:08:32 +0200 Subject: [PATCH 111/222] jetbrains: 2023.2.2 -> 2023.2.3 jetbrains.phpstorm: 2023.2.2 -> 2023.2.3 jetbrains.pycharm-community: 2023.2.2 -> 2023.2.3 jetbrains.pycharm-professional: 2023.2.2 -> 2023.2.3 --- .../editors/jetbrains/versions.json | 96 +++++++++---------- 1 file changed, 48 insertions(+), 48 deletions(-) diff --git a/pkgs/applications/editors/jetbrains/versions.json b/pkgs/applications/editors/jetbrains/versions.json index c95feebdb674..5bbbd9dfc7b6 100644 --- a/pkgs/applications/editors/jetbrains/versions.json +++ b/pkgs/applications/editors/jetbrains/versions.json @@ -67,27 +67,27 @@ "phpstorm": { "update-channel": "PhpStorm RELEASE", "url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}.tar.gz", - "version": "2023.2.2", - "sha256": "5e3dd021b82dcad0f51bded677aa87680dcc3f5d843951c48848a9191141bf1d", - "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2.tar.gz", - "build_number": "232.9921.55", + "version": "2023.2.3", + "sha256": "dd8d771508b277ab2a713b8f546c2ec6dbb261ba8c23072e46ec6ce2ea9ab2a0", + "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3.tar.gz", + "build_number": "232.10072.32", "version-major-minor": "2022.3" }, "pycharm-community": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-community-{version}.tar.gz", - "version": "2023.2.2", - "sha256": "2bb4f73d041b818a7b631feb3fee77036de764543c669efe9cf6766510a68e3f", - "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2.tar.gz", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "d59dd88c1eb51cdd756433d415588c573ca944ebf6f08844b8ac8cd2e3d9937b", + "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3.tar.gz", + "build_number": "232.10072.31" }, "pycharm-professional": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}.tar.gz", - "version": "2023.2.2", - "sha256": "f7263b17e2456efcb5efab1eac53aafb6a0be1a7f9fbf25a419c9d7b447f6ded", - "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2.tar.gz", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "e625fea80b72c9e12f986a8eb918425c6ef1d3f7b31117b40d122e3ce76046b1", + "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3.tar.gz", + "build_number": "232.10072.31" }, "rider": { "update-channel": "Rider RELEASE", @@ -190,27 +190,27 @@ "phpstorm": { "update-channel": "PhpStorm RELEASE", "url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}-aarch64.tar.gz", - "version": "2023.2.2", - "sha256": "b3067ffa32fab0880ffce8dff000d463b86bef9b30f53fc4d41f5d4e518c7528", - "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2-aarch64.tar.gz", - "build_number": "232.9921.55", + "version": "2023.2.3", + "sha256": "577bea15c1208e0b842bcdb2ff0f0205144a8800fcadf87f873af7c067e0ce73", + "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3-aarch64.tar.gz", + "build_number": "232.10072.32", "version-major-minor": "2022.3" }, "pycharm-community": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-community-{version}-aarch64.tar.gz", - "version": "2023.2.2", - "sha256": "7d15908f9261ee7905b61d83d4a048fee1e3a2fea9465ada1fc459b2ea0e4d5f", - "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2-aarch64.tar.gz", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "6fdc5238ffa4767834b11b52b650107f1c64d6a53d0e2bbc23581b6c90b67ab5", + "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3-aarch64.tar.gz", + "build_number": "232.10072.31" }, "pycharm-professional": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}-aarch64.tar.gz", - "version": "2023.2.2", - "sha256": "2cf259859847f7a979565f31faa60148d571206c78c9309dcdf867b76c16ef25", - "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2-aarch64.tar.gz", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "578ecbd059ccb010682cf602e959454b296ec2e741202f236fbdb38897b296dd", + "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3-aarch64.tar.gz", + "build_number": "232.10072.31" }, "rider": { "update-channel": "Rider RELEASE", @@ -313,27 +313,27 @@ "phpstorm": { "update-channel": "PhpStorm RELEASE", "url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}.dmg", - "version": "2023.2.2", - "sha256": "99a9bb313a5c141ecd1810306deaca3cf52d338edf206362b3f9d9337a27890e", - "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2.dmg", - "build_number": "232.9921.55", + "version": "2023.2.3", + "sha256": "7ce4ff6b344ff8ce18ef8a821ba3fd1d222f9222a9b3e65744a796379d92417e", + "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3.dmg", + "build_number": "232.10072.32", "version-major-minor": "2022.3" }, "pycharm-community": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-community-{version}.dmg", - "version": "2023.2.2", - "sha256": "f482b6d451efec897764487b116f7bf09d507a5ebfb841c33e2abd2441c3b3a7", - "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2.dmg", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "b914bd3c0018f951bef5da9c04907355a88546ce983dcf4115bbf11556015ec7", + "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3.dmg", + "build_number": "232.10072.31" }, "pycharm-professional": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}.dmg", - "version": "2023.2.2", - "sha256": "830f590d63199b389bbaa955c8602fa027bc1eb25bd8ce5636474eec72745b58", - "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2.dmg", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "b33bbd30222363cdc3091aee923ed1c309edba799616a3a681cd9a1ca94e822a", + "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3.dmg", + "build_number": "232.10072.31" }, "rider": { "update-channel": "Rider RELEASE", @@ -436,27 +436,27 @@ "phpstorm": { "update-channel": "PhpStorm RELEASE", "url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}-aarch64.dmg", - "version": "2023.2.2", - "sha256": "a31daeddae532324436b2d11acbd5fb657721883f17c7ef4457ac76a51bd4189", - "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2-aarch64.dmg", - "build_number": "232.9921.55", + "version": "2023.2.3", + "sha256": "68d543fb2a79cd0b07ddb94a4c00d8c0c1aca7f604bc838ac92e232e763489b3", + "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3-aarch64.dmg", + "build_number": "232.10072.32", "version-major-minor": "2022.3" }, "pycharm-community": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-community-{version}-aarch64.dmg", - "version": "2023.2.2", - "sha256": "2bcddf3e58902578745dd1803f17ebd18f4c98dc76bf48b0945afbc7bae45832", - "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2-aarch64.dmg", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "08c45adbb0dca219955f511993ca8150dcca235bdba3ac24c67ae035c68ba992", + "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3-aarch64.dmg", + "build_number": "232.10072.31" }, "pycharm-professional": { "update-channel": "PyCharm RELEASE", "url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}-aarch64.dmg", - "version": "2023.2.2", - "sha256": "5d4292dd0e40db35199ebcd6472d4b46c505d3357d2324690338758355e0f092", - "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2-aarch64.dmg", - "build_number": "232.9921.89" + "version": "2023.2.3", + "sha256": "63d68b20963575f76937ca0ce18a8150639c47b8cf8f3d6e96fa3306191cd076", + "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3-aarch64.dmg", + "build_number": "232.10072.31" }, "rider": { "update-channel": "Rider RELEASE", From 9b4751604bfbfcc2637160e35a19a57c4f2a3f20 Mon Sep 17 00:00:00 2001 From: Mikael Fangel <34864484+MikaelFangel@users.noreply.github.com> Date: Sat, 21 Oct 2023 02:08:48 +0200 Subject: [PATCH 112/222] jetbrains.plugins: update --- .../editors/jetbrains/plugins/plugins.json | 97 ++++++++++--------- 1 file changed, 49 insertions(+), 48 deletions(-) diff --git a/pkgs/applications/editors/jetbrains/plugins/plugins.json b/pkgs/applications/editors/jetbrains/plugins/plugins.json index d93a243b0a37..353d4a5d4b0b 100644 --- a/pkgs/applications/editors/jetbrains/plugins/plugins.json +++ b/pkgs/applications/editors/jetbrains/plugins/plugins.json @@ -22,10 +22,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", "232.10072.27": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", "232.10072.28": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", "232.9921.42": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", "232.9921.83": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip", "233.8264.22": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip" }, "name": "ideavim" @@ -61,10 +61,10 @@ "232.10072.21": null, "232.10072.27": null, "232.10072.28": null, + "232.10072.31": null, + "232.10072.32": null, "232.9921.42": null, - "232.9921.55": null, "232.9921.83": null, - "232.9921.89": null, "233.8264.22": null }, "name": "kotlin" @@ -87,14 +87,14 @@ ], "builds": { "223.8836.1185": null, - "232.10072.15": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", - "232.10072.21": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", - "232.10072.27": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", - "232.10072.28": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", + "232.10072.15": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip", + "232.10072.21": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip", + "232.10072.27": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip", + "232.10072.28": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip", "232.9921.42": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", "232.9921.83": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip", "233.8264.22": "https://plugins.jetbrains.com/files/6981/407738/ini-233.8264.9.zip" }, "name": "ini" @@ -105,8 +105,8 @@ "phpstorm" ], "builds": { - "232.10072.27": "https://plugins.jetbrains.com/files/7219/408569/Symfony_Plugin-2022.1.258.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/7219/408569/Symfony_Plugin-2022.1.258.zip" + "232.10072.27": "https://plugins.jetbrains.com/files/7219/419684/Symfony_Plugin-2022.1.259.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/7219/419684/Symfony_Plugin-2022.1.259.zip" }, "name": "symfony-support" }, @@ -117,7 +117,7 @@ ], "builds": { "232.10072.27": "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip" + "232.10072.32": "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip" }, "name": "php-annotations" }, @@ -158,10 +158,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", "232.10072.27": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", "232.10072.28": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", "232.9921.42": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", - "232.9921.83": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip" + "232.9921.83": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip" }, "name": "-deprecated-rust" }, @@ -186,10 +186,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", "232.10072.27": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", "232.10072.28": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", "232.9921.42": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", - "232.9921.83": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip" + "232.9921.83": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip" }, "name": "-deprecated-rust-beta" }, @@ -207,7 +207,7 @@ "232.10072.21": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip", "232.10072.27": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip", "232.10072.28": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip" + "232.10072.31": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip" }, "name": "ide-features-trainer" }, @@ -233,10 +233,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", "232.10072.27": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", "232.10072.28": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", "232.9921.42": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", "232.9921.83": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip", "233.8264.22": null }, "name": "nixidea" @@ -267,16 +267,16 @@ "webstorm" ], "builds": { - "223.8836.1185": "https://plugins.jetbrains.com/files/10037/358812/CSVEditor-3.2.1-223.zip", - "232.10072.15": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.10072.21": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.10072.27": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.10072.28": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.9921.42": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.9921.83": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip", - "233.8264.22": "https://plugins.jetbrains.com/files/10037/243092/CSV-2.21.0.zip" + "223.8836.1185": "https://plugins.jetbrains.com/files/10037/417700/CSVEditor-3.2.2-223.zip", + "232.10072.15": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.10072.21": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.10072.27": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.10072.28": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.9921.42": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "232.9921.83": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip", + "233.8264.22": "https://plugins.jetbrains.com/files/10037/417702/CSVEditor-3.2.2-233.zip" }, "name": "csv-editor" }, @@ -302,10 +302,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", "232.10072.27": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", "232.10072.28": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", "232.9921.42": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", "232.9921.83": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip", "233.8264.22": "https://plugins.jetbrains.com/files/12062/405118/keymap-vscode-233.8264.3.zip" }, "name": "vscode-keymap" @@ -332,10 +332,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", "232.10072.27": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", "232.10072.28": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", "232.9921.42": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", "232.9921.83": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip", "233.8264.22": "https://plugins.jetbrains.com/files/12559/405631/keymap-eclipse-233.8264.9.zip" }, "name": "eclipse-keymap" @@ -362,10 +362,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", "232.10072.27": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", "232.10072.28": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", "232.9921.42": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", "232.9921.83": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip", "233.8264.22": "https://plugins.jetbrains.com/files/13017/405636/keymap-visualStudio-233.8264.9.zip" }, "name": "visual-studio-keymap" @@ -392,10 +392,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", "232.10072.27": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", "232.10072.28": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", + "232.10072.31": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", + "232.10072.32": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", "232.9921.42": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", - "232.9921.55": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", "232.9921.83": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", - "232.9921.89": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar", "233.8264.22": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar" }, "name": "darcula-pitch-black" @@ -422,10 +422,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", "232.10072.27": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", "232.10072.28": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", "232.9921.42": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", "232.9921.83": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip", "233.8264.22": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip" }, "name": "github-copilot" @@ -452,10 +452,10 @@ "232.10072.21": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", "232.10072.27": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", "232.10072.28": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", + "232.10072.31": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", + "232.10072.32": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", "232.9921.42": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", - "232.9921.55": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", "232.9921.83": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", - "232.9921.89": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip", "233.8264.22": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip" }, "name": "netbeans-6-5-keymap" @@ -475,9 +475,9 @@ } }, "files": { - "https://plugins.jetbrains.com/files/10037/243092/CSV-2.21.0.zip": "sha256-Mfo8z2pjn+Gk1uumw5xpZQwpkqLRVqAu2Z07zjn2N1M=", - "https://plugins.jetbrains.com/files/10037/358812/CSVEditor-3.2.1-223.zip": "sha256-l8xq7XXQheZYcP+kdnLXAO7FhfPJYwIh+ZffbttBI9s=", - "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip": "sha256-m9ocJSFWparZLrX1MQA0IlSH5LHodmzzVmGZ6eHml24=", + "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip": "sha256-3bHSRhzvVO07mvuD6tpkiKFXTF66zCK/wpXFVb8IkfY=", + "https://plugins.jetbrains.com/files/10037/417700/CSVEditor-3.2.2-223.zip": "sha256-4Y/DZpCWKljaslJFsaqItq1DVJVVRlQjWpM6GLRo8QA=", + "https://plugins.jetbrains.com/files/10037/417702/CSVEditor-3.2.2-233.zip": "sha256-n4psF9fFFU8ohtbOndRx6i20EntjEzL3BvMObAZyOOw=", "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip": "sha256-q5i1eAANK+6uBYrtioKLzvJf5ALUB0K4d31Ut0vT/lE=", "https://plugins.jetbrains.com/files/12062/405118/keymap-vscode-233.8264.3.zip": "sha256-cB3DTeWhDgAwHlxwYogd0/DuYBzo5DqaRtBvEC/p8I4=", "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip": "sha256-eRCsivZbDNrc+kesa9jVsOoMFFz+WpYfSMXxPCCjWjw=", @@ -495,7 +495,8 @@ "https://plugins.jetbrains.com/files/6954/381727/kotlin-plugin-223-1.9.10-release-459-IJ8836.35.zip": "sha256-gHkNQyWh6jtY1986aI7Qo6ZNrniPy+Yq4XLLA0pKJkA=", "https://plugins.jetbrains.com/files/6981/407738/ini-233.8264.9.zip": "sha256-E3xWjwTxtLkOtm9748BbkKGaS4l8SlZOkj3w6VgqlFQ=", "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip": "sha256-XIdhTQMxl/nJnntfQlHLlcyA79IS3hnGEGrXhKBFgY0=", - "https://plugins.jetbrains.com/files/7219/408569/Symfony_Plugin-2022.1.258.zip": "sha256-O4ARifSoeL5kXnFQTs6YoLcJvdg5VHks5LIgnwwUAeQ=", + "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip": "sha256-eC5Zs6ph/4C3Xf6e07DfyqhBmsG3bAFLnvae1JiFzpE=", + "https://plugins.jetbrains.com/files/7219/419684/Symfony_Plugin-2022.1.259.zip": "sha256-3UxSPvEXXhAf3zYg2H/jja4F5fuDFWQ6SWFRvcWJ0Iw=", "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip": "sha256-hT5K4w4lhvNwDzDMDSvsIDGj9lyaRqglfOhlbNdqpWs=", "https://plugins.jetbrains.com/files/7322/401058/python-ce-232.9921.77.zip": "sha256-cr4LxSz8xVzC+Zm+6LnWGLbF6aGBVLW56crCIQOawhc=", "https://plugins.jetbrains.com/files/7322/405773/python-ce-233.8264.8.zip": "sha256-LjN0BkcnX8mVHh2dPULddVwooi9fcABkrRVhTPA7XSo=", From 28ab1815cfdc7fb44a3b778892f48c58bf42e76c Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Sandro=20J=C3=A4ckel?= Date: Sat, 21 Oct 2023 02:21:49 +0200 Subject: [PATCH 113/222] topgrade: 12.0.2 -> 13.0.0 Diff: https://github.com/topgrade-rs/topgrade/compare/v12.0.2...v13.0.0 Changelog: https://github.com/topgrade-rs/topgrade/releases/tag/v13.0.0 --- pkgs/tools/misc/topgrade/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/tools/misc/topgrade/default.nix b/pkgs/tools/misc/topgrade/default.nix index f900eafaacd1..757cb69cbb0b 100644 --- a/pkgs/tools/misc/topgrade/default.nix +++ b/pkgs/tools/misc/topgrade/default.nix @@ -10,16 +10,16 @@ rustPlatform.buildRustPackage rec { pname = "topgrade"; - version = "12.0.2"; + version = "13.0.0"; src = fetchFromGitHub { owner = "topgrade-rs"; repo = "topgrade"; rev = "v${version}"; - hash = "sha256-PfrtTegJULzPAmKUk/6P9rD+ttPJOhaf2505og64C0Y="; + hash = "sha256-BuYwLD8HlmFjCpR8043GhrYK3XWffeqEaeEDqWhxZVI="; }; - cargoHash = "sha256-S6jSI/KuHocYD2dhg3o1NSyA8Q04Xo215TWl8Y1C7g8="; + cargoHash = "sha256-+kSvA9AC0peXeFLVjenATRfnIS9qaOr/f1ozPbifiPI="; nativeBuildInputs = [ installShellFiles From 7f94b9e9c6ee43233269ea42cc9863abd38254dd Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Sandro=20J=C3=A4ckel?= Date: Sat, 21 Oct 2023 02:33:09 +0200 Subject: [PATCH 114/222] nixos/fail2ban: change bantime default to not be config breaking --- nixos/modules/services/security/fail2ban.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/nixos/modules/services/security/fail2ban.nix b/nixos/modules/services/security/fail2ban.nix index 7059284850a5..235f29ab8a6a 100644 --- a/nixos/modules/services/security/fail2ban.nix +++ b/nixos/modules/services/security/fail2ban.nix @@ -103,9 +103,9 @@ in }; bantime = mkOption { - default = null; - type = types.nullOr types.str; - example = "10m"; + default = "10m"; + type = types.str; + example = "1h"; description = lib.mdDoc "Number of seconds that a host is banned."; }; From 49493c3891cad7f6fdd52e97436094b7203910a7 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 00:54:19 +0000 Subject: [PATCH 115/222] tgt: 1.0.87 -> 1.0.88 --- pkgs/tools/networking/tgt/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/tools/networking/tgt/default.nix b/pkgs/tools/networking/tgt/default.nix index e47478b9206b..4030e3d14ec1 100644 --- a/pkgs/tools/networking/tgt/default.nix +++ b/pkgs/tools/networking/tgt/default.nix @@ -4,13 +4,13 @@ stdenv.mkDerivation rec { pname = "tgt"; - version = "1.0.87"; + version = "1.0.88"; src = fetchFromGitHub { owner = "fujita"; repo = pname; rev = "v${version}"; - sha256 = "sha256-nDYNXQJqCtwlm4HTPTMuUbn6FA8JRYEqxbYUAev2R3o="; + sha256 = "sha256-tLc+viPufR6P5texDs9lU8wsOTzrjSK0Qz/r4/L8M5k="; }; nativeBuildInputs = [ libxslt docbook_xsl makeWrapper ]; From cb017b476114c49c396a4c41090f6e1325e1526e Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 01:54:55 +0000 Subject: [PATCH 116/222] timer: 1.3.0 -> 1.4.1 --- pkgs/tools/misc/timer/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/tools/misc/timer/default.nix b/pkgs/tools/misc/timer/default.nix index 29e087c86581..962ad1a6dd69 100644 --- a/pkgs/tools/misc/timer/default.nix +++ b/pkgs/tools/misc/timer/default.nix @@ -2,16 +2,16 @@ buildGoModule rec { pname = "timer"; - version = "1.3.0"; + version = "1.4.1"; src = fetchFromGitHub { owner = "caarlos0"; repo = "timer"; rev = "v${version}"; - hash = "sha256-9p/L3Hj3VqlNiyY3lfUAhCjwTl1iSTegWxaVEGB4qHM="; + hash = "sha256-8BVzijAXsJ8Q8BhDmhzFbEQ23fUEBdmbUsCPxfpXyBA="; }; - vendorHash = "sha256-j7Xik0te6GdjfhXHT7DRf+MwM+aKjfgTGvroxnlD3MM="; + vendorHash = "sha256-1n5vZKlOWoB2SFdDdv+pPWLybzCIJG/wdBYqLMatjNA="; ldflags = [ "-s" "-w" "-X main.version=${version}" ]; From fc91b8aa1c702b35067c3975ebf2da13fa381d8b Mon Sep 17 00:00:00 2001 From: Hubble the Wolverine Date: Fri, 20 Oct 2023 19:09:11 -0700 Subject: [PATCH 117/222] maintainers: add email to hubble --- maintainers/maintainer-list.nix | 1 + 1 file changed, 1 insertion(+) diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix index 5406d49cd69d..1523eddf83a9 100644 --- a/maintainers/maintainer-list.nix +++ b/maintainers/maintainer-list.nix @@ -7219,6 +7219,7 @@ }; hubble = { name = "Hubble the Wolverine"; + email = "hubblethewolverine@gmail.com"; matrix = "@hubofeverything:bark.lgbt"; github = "the-furry-hubofeverything"; githubId = 53921912; From 897f39db93cbcd5d16014b7696ff712acfd615fd Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 02:24:06 +0000 Subject: [PATCH 118/222] timescaledb-tune: 0.14.3 -> 0.14.4 --- pkgs/development/tools/database/timescaledb-tune/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/tools/database/timescaledb-tune/default.nix b/pkgs/development/tools/database/timescaledb-tune/default.nix index 1fa12861d921..0236a5f51f3d 100644 --- a/pkgs/development/tools/database/timescaledb-tune/default.nix +++ b/pkgs/development/tools/database/timescaledb-tune/default.nix @@ -2,13 +2,13 @@ buildGoModule rec { pname = "timescaledb-tune"; - version = "0.14.3"; + version = "0.14.4"; src = fetchFromGitHub { owner = "timescale"; repo = pname; rev = "v${version}"; - sha256 = "sha256-MQi8A7eWOShP/VhxuX4Uhz1ueLtKvOi1x4E7aFXEsQo="; + sha256 = "sha256-lCbxGW6+/r5AnsSXvrE7jYL1ZywcTlb4RK3MurL1JWg="; }; vendorHash = "sha256-yXWeINubvfZ2S+3gVFsrzeVO3XXIiZ14qfK+9Bj3SV4="; From 30e5f80a769813111a4734ae0aba2b61ca606ed1 Mon Sep 17 00:00:00 2001 From: oluceps Date: Sat, 21 Oct 2023 10:54:33 +0800 Subject: [PATCH 119/222] hysteria: 2.0.3 -> 2.1.1 Diff: https://github.com/apernet/hysteria/compare/app/v2.0.3...app/v2.1.1 --- pkgs/tools/networking/hysteria/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/tools/networking/hysteria/default.nix b/pkgs/tools/networking/hysteria/default.nix index 9885066397b6..80b12b6d6d67 100644 --- a/pkgs/tools/networking/hysteria/default.nix +++ b/pkgs/tools/networking/hysteria/default.nix @@ -4,16 +4,16 @@ }: buildGo121Module rec { pname = "hysteria"; - version = "2.0.3"; + version = "2.1.1"; src = fetchFromGitHub { owner = "apernet"; repo = pname; rev = "app/v${version}"; - hash = "sha256-0ekw92T9yWrKu5MxSssOCXlUFubiVLoH6ZLEMDFkcis="; + hash = "sha256-CvhDOtXyGxnTy8m7qN5lmQxOxwkExfW+1ZT3LrLjsmo="; }; - vendorHash = "sha256-Hf+Jx/z+hJ6jqWLJHGK7umNgNzNKYgQtCdAosdrqvPg="; + vendorHash = "sha256-Io7EN+Cza7drMLB9JF4nRDxq+eVxW5sYj45WWvXtDsY="; proxyVendor = true; ldflags = [ From faa428aa7192ad1253ae07098ee1c05e04b3d52d Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 03:05:46 +0000 Subject: [PATCH 120/222] tomcat-native: 2.0.5 -> 2.0.6 --- pkgs/servers/http/tomcat/tomcat-native.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/servers/http/tomcat/tomcat-native.nix b/pkgs/servers/http/tomcat/tomcat-native.nix index 5f9ea8a1665d..bd05943ac71f 100644 --- a/pkgs/servers/http/tomcat/tomcat-native.nix +++ b/pkgs/servers/http/tomcat/tomcat-native.nix @@ -2,11 +2,11 @@ stdenv.mkDerivation rec { pname = "tomcat-native"; - version = "2.0.5"; + version = "2.0.6"; src = fetchurl { url = "mirror://apache/tomcat/tomcat-connectors/native/${version}/source/${pname}-${version}-src.tar.gz"; - hash = "sha256-lY0fEhZRwQxhVW133J0NQfO1OYiiGVRC3krG9MuHg4g="; + hash = "sha256-vmF8V26SO2B50LdSBtcG2ifdBDzr9Qv7leOpwKodGjU="; }; sourceRoot = "${pname}-${version}-src/native"; From 190f3903bb70c1c7b6cfb89bb75b24824d6162ec Mon Sep 17 00:00:00 2001 From: illustris Date: Sat, 21 Oct 2023 08:37:13 +0530 Subject: [PATCH 121/222] hadoop: remove duplicate `finalAttrs` Co-authored-by: Peder Bergebakken Sundt --- .../networking/cluster/hadoop/containerExecutor.nix | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix b/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix index 83f2fe971d41..7d5d2918e9b9 100644 --- a/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix +++ b/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix @@ -5,7 +5,7 @@ stdenv.mkDerivation (finalAttrs: { inherit version; src = fetchurl { - url = with finalAttrs; "mirror://apache/hadoop/common/hadoop-${finalAttrs.version}/hadoop-${finalAttrs.version}-src.tar.gz"; + url = "mirror://apache/hadoop/common/hadoop-${finalAttrs.version}/hadoop-${finalAttrs.version}-src.tar.gz"; hash = platformAttrs.${stdenv.system}.srcHash; }; sourceRoot = "hadoop-${finalAttrs.version}-src/hadoop-yarn-project/hadoop-yarn/" From 392adcbabc71c21a747fcdaf70f7a645d34f453a Mon Sep 17 00:00:00 2001 From: Austin Horstman Date: Fri, 20 Oct 2023 22:15:37 -0500 Subject: [PATCH 122/222] nwg-displays: 0.3.7 -> 0.3.8 --- pkgs/applications/misc/nwg-displays/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/applications/misc/nwg-displays/default.nix b/pkgs/applications/misc/nwg-displays/default.nix index f0fc2b1bb368..18ba079088af 100644 --- a/pkgs/applications/misc/nwg-displays/default.nix +++ b/pkgs/applications/misc/nwg-displays/default.nix @@ -14,13 +14,13 @@ python310Packages.buildPythonApplication rec { pname = "nwg-displays"; - version = "0.3.7"; + version = "0.3.8"; src = fetchFromGitHub { owner = "nwg-piotr"; repo = "nwg-displays"; rev = "v${version}"; - hash = "sha256-Y405ZeOSpc1aPKEzFdvlgJgpGAi9HUR+Hvx63uYdp88="; + hash = "sha256-9v5TQTliUEnynoGDf1UXsQ9Ym7x2gPmx4QiRJH5BId4="; }; nativeBuildInputs = [ From 7f057fcfa68c72ff9de158aaebf261bd8b3e5f39 Mon Sep 17 00:00:00 2001 From: Austin Horstman Date: Fri, 20 Oct 2023 22:16:47 -0500 Subject: [PATCH 123/222] nwg-panel: 0.9.13 -> 0.9.14 --- pkgs/applications/misc/nwg-panel/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/applications/misc/nwg-panel/default.nix b/pkgs/applications/misc/nwg-panel/default.nix index a4d333e594c3..90864dee69ba 100644 --- a/pkgs/applications/misc/nwg-panel/default.nix +++ b/pkgs/applications/misc/nwg-panel/default.nix @@ -15,13 +15,13 @@ python3Packages.buildPythonApplication rec { pname = "nwg-panel"; - version = "0.9.13"; + version = "0.9.14"; src = fetchFromGitHub { owner = "nwg-piotr"; repo = "nwg-panel"; rev = "v${version}"; - hash = "sha256-dP/FbMrjPextwedQeLJHM6f/a+EuZ+hQSLrH/rF2XOg="; + hash = "sha256-ThcB/BhnJbBHUoRh120iqN6LMGOnkekzALTTgd8uUx4="; }; # No tests From 97215d850931b7660177e585653a8f48beae73ad Mon Sep 17 00:00:00 2001 From: Austin Horstman Date: Fri, 20 Oct 2023 22:37:03 -0500 Subject: [PATCH 124/222] lazydocker: 0.23.0 -> 0.23.1 --- pkgs/tools/misc/lazydocker/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/tools/misc/lazydocker/default.nix b/pkgs/tools/misc/lazydocker/default.nix index 1fdb0ef0d44b..353402658db9 100644 --- a/pkgs/tools/misc/lazydocker/default.nix +++ b/pkgs/tools/misc/lazydocker/default.nix @@ -2,13 +2,13 @@ buildGoModule rec { pname = "lazydocker"; - version = "0.23.0"; + version = "0.23.1"; src = fetchFromGitHub { owner = "jesseduffield"; repo = "lazydocker"; rev = "v${version}"; - sha256 = "sha256-BxIv0HCdrR9U9mmJnBdQqiUf/vbK+XEnL8ALPkuap0M="; + sha256 = "sha256-nW3eaSisXLqoWZ+5YLLCfC1k4lTXWd5ZqY2xTM/I0PY="; }; vendorHash = null; From 83362e21cdd8703a23ace788d9ab50fd19a8861a Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Fri, 20 Oct 2023 23:55:26 +0000 Subject: [PATCH 125/222] texlab: 5.10.0 -> 5.10.1 --- pkgs/development/tools/misc/texlab/default.nix | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/pkgs/development/tools/misc/texlab/default.nix b/pkgs/development/tools/misc/texlab/default.nix index e33a288286ee..9bc36338ff2e 100644 --- a/pkgs/development/tools/misc/texlab/default.nix +++ b/pkgs/development/tools/misc/texlab/default.nix @@ -15,16 +15,16 @@ let in rustPlatform.buildRustPackage rec { pname = "texlab"; - version = "5.10.0"; + version = "5.10.1"; src = fetchFromGitHub { owner = "latex-lsp"; repo = "texlab"; rev = "refs/tags/v${version}"; - hash = "sha256-MTWaGgDIDo3CaRHyHWqliKsPdbU/TZPsyfF7SoHTnhk="; + hash = "sha256-ACdiFkV138jDIrRe+baYo+r9vCO4cyRyO2ck7OKakFY="; }; - cargoHash = "sha256-8Vrp4d5luf91pKpUC4wWn4otsanqopCHwCjcnfTzyLk="; + cargoHash = "sha256-bEeQOOucXd4HNTR6SmidAfDkZ1tT7ORmUxrNx+3FNRw="; outputs = [ "out" ] ++ lib.optional (!isCross) "man"; @@ -41,7 +41,7 @@ rustPlatform.buildRustPackage rec { # generate the man page postInstall = lib.optionalString (!isCross) '' # TexLab builds man page separately in CI: - # https://github.com/latex-lsp/texlab/blob/v5.9.2/.github/workflows/publish.yml#L117-L121 + # https://github.com/latex-lsp/texlab/blob/v5.10.1/.github/workflows/publish.yml#L117-L121 help2man --no-info "$out/bin/texlab" > texlab.1 installManPage texlab.1 ''; From fba68a9b964e961307237d7da745121f9bc00fa8 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 04:25:09 +0000 Subject: [PATCH 126/222] trealla: 2.28.12 -> 2.29.36 --- pkgs/by-name/tr/trealla/package.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/by-name/tr/trealla/package.nix b/pkgs/by-name/tr/trealla/package.nix index 1a9d5569f235..6aee9c1598b9 100644 --- a/pkgs/by-name/tr/trealla/package.nix +++ b/pkgs/by-name/tr/trealla/package.nix @@ -17,13 +17,13 @@ assert lib.elem lineEditingLibrary [ "isocline" "readline" ]; stdenv.mkDerivation (finalAttrs: { pname = "trealla"; - version = "2.28.12"; + version = "2.29.36"; src = fetchFromGitHub { owner = "trealla-prolog"; repo = "trealla"; rev = "v${finalAttrs.version}"; - hash = "sha256-uWCpCjYFtK2pNeHHZWhWI6YZ+cllQpkKz//nHracl5s="; + hash = "sha256-tQp2DOBW71Wm1aQqspW9tuH8aM8ir+ilZiENdElB/+0="; }; postPatch = '' From fdf6dc4604c5145181db839bb7ac45db4f498b83 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 04:54:39 +0000 Subject: [PATCH 127/222] tremotesf: 2.4.0 -> 2.5.0 --- pkgs/applications/networking/p2p/tremotesf/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/applications/networking/p2p/tremotesf/default.nix b/pkgs/applications/networking/p2p/tremotesf/default.nix index 6880d8472167..4cd7358d2b77 100644 --- a/pkgs/applications/networking/p2p/tremotesf/default.nix +++ b/pkgs/applications/networking/p2p/tremotesf/default.nix @@ -15,13 +15,13 @@ stdenv.mkDerivation (finalAttrs: { pname = "tremotesf"; - version = "2.4.0"; + version = "2.5.0"; src = fetchFromGitHub { owner = "equeim"; repo = "tremotesf2"; rev = finalAttrs.version; - hash = "sha256-TKtBgMpCWIUl1bohAKCbTcZX2uaPmzeWut/OeNs/rME="; + hash = "sha256-mxk2BRUuet3XSNaKt2Dnnxe5dliazd1ArRSnKyoAp1s="; # We need this for src/libtremotesf fetchSubmodules = true; }; From f4a7133a3773ffbf8b90ca7a21b1d9c716224e4c Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Robert=20Sch=C3=BCtz?= Date: Fri, 20 Oct 2023 21:55:53 -0700 Subject: [PATCH 128/222] python310Packages.python-myq: rename from pymyq --- .../python-modules/{pymyq => python-myq}/default.nix | 2 +- pkgs/top-level/python-aliases.nix | 1 + pkgs/top-level/python-packages.nix | 2 +- 3 files changed, 3 insertions(+), 2 deletions(-) rename pkgs/development/python-modules/{pymyq => python-myq}/default.nix (97%) diff --git a/pkgs/development/python-modules/pymyq/default.nix b/pkgs/development/python-modules/python-myq/default.nix similarity index 97% rename from pkgs/development/python-modules/pymyq/default.nix rename to pkgs/development/python-modules/python-myq/default.nix index 91c691f843a3..f596828e6f9f 100644 --- a/pkgs/development/python-modules/pymyq/default.nix +++ b/pkgs/development/python-modules/python-myq/default.nix @@ -9,7 +9,7 @@ }: buildPythonPackage rec { - pname = "pymyq"; + pname = "python-myq"; version = "3.1.13"; pyproject = true; diff --git a/pkgs/top-level/python-aliases.nix b/pkgs/top-level/python-aliases.nix index 66be4900a11b..4e679de15084 100644 --- a/pkgs/top-level/python-aliases.nix +++ b/pkgs/top-level/python-aliases.nix @@ -290,6 +290,7 @@ mapAliases ({ pymc3 = pymc; # added 2022-06-05, module was rename starting with 4.0.0 pymssql = throw "pymssql has been abandoned upstream."; # added 2020-05-04 PyMVGLive = pymvglive; # added 2023-02-19 + pymyq = python-myq; # added 2023-10-20 pyqt4 = throw "pyqt4 has been removed, because it depended on the long EOL qt4"; # added 2022-06-09 pyramid_beaker = pyramid-beaker; # added 2023-08-23 pyramid_chameleon = pyramid-chameleon; # added 2023-08-23 diff --git a/pkgs/top-level/python-packages.nix b/pkgs/top-level/python-packages.nix index 2ae3133dc39c..8bb9405337fd 100644 --- a/pkgs/top-level/python-packages.nix +++ b/pkgs/top-level/python-packages.nix @@ -10452,7 +10452,7 @@ self: super: with self; { pymvglive = callPackage ../development/python-modules/pymvglive { }; - pymyq = callPackage ../development/python-modules/pymyq { }; + python-myq = callPackage ../development/python-modules/python-myq { }; pymysensors = callPackage ../development/python-modules/pymysensors { }; From da3bf40c6c71e357d1e493dfc5ed93602e6660d0 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Robert=20Sch=C3=BCtz?= Date: Fri, 20 Oct 2023 21:57:19 -0700 Subject: [PATCH 129/222] home-assistant: support myq component --- pkgs/servers/home-assistant/component-packages.nix | 4 +++- 1 file changed, 3 insertions(+), 1 deletion(-) diff --git a/pkgs/servers/home-assistant/component-packages.nix b/pkgs/servers/home-assistant/component-packages.nix index 128f20777fe2..79195bd7152e 100644 --- a/pkgs/servers/home-assistant/component-packages.nix +++ b/pkgs/servers/home-assistant/component-packages.nix @@ -2771,7 +2771,8 @@ sqlalchemy ]; "myq" = ps: with ps; [ - ]; # missing inputs: python-myq + python-myq + ]; "mysensors" = ps: with ps; [ aiohttp-cors janus @@ -5405,6 +5406,7 @@ "mullvad" "mutesync" "my" + "myq" "mysensors" "mystrom" "mythicbeastsdns" From 5816ae9603348a4a4c2ecfcd976cf51daa26f7f4 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Christina=20S=C3=B8rensen?= Date: Sat, 21 Oct 2023 07:56:37 +0200 Subject: [PATCH 130/222] fd: 8.7.0 -> 8.7.1 MIME-Version: 1.0 Content-Type: text/plain; charset=UTF-8 Content-Transfer-Encoding: 8bit Signed-off-by: Christina Sørensen --- pkgs/tools/misc/fd/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/tools/misc/fd/default.nix b/pkgs/tools/misc/fd/default.nix index 0f78b752de00..3e256b460b26 100644 --- a/pkgs/tools/misc/fd/default.nix +++ b/pkgs/tools/misc/fd/default.nix @@ -2,16 +2,16 @@ rustPlatform.buildRustPackage rec { pname = "fd"; - version = "8.7.0"; + version = "8.7.1"; src = fetchFromGitHub { owner = "sharkdp"; repo = "fd"; rev = "v${version}"; - hash = "sha256-y7IrwMLQnvz1PeKt8BE9hbEBwQBiUXM4geYbiTjMymw="; + hash = "sha256-euQiMVPKE1/YG04VKMFUA27OtoGENNhqeE0iiF/X7uc="; }; - cargoHash = "sha256-AstE8KGICgPhqRKlJecrE9iPUUWaOvca6ocWf85IzNo="; + cargoHash = "sha256-doeZTjFPXmxIPYX3IBtetePoNkIHnl6oPJFtXD1tgZY="; nativeBuildInputs = [ installShellFiles ]; From 6e05e10fd9074833d1094d84f5300b20356ade31 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Nguy=E1=BB=85n=20Gia=20Phong?= Date: Sat, 21 Oct 2023 08:10:40 +0900 Subject: [PATCH 131/222] python3Packages.formbox: 0.4.1 -> 0.4.3 --- .../python-modules/formbox/default.nix | 16 +++++++--------- 1 file changed, 7 insertions(+), 9 deletions(-) diff --git a/pkgs/development/python-modules/formbox/default.nix b/pkgs/development/python-modules/formbox/default.nix index 098d13e87c98..418cd3d958cd 100644 --- a/pkgs/development/python-modules/formbox/default.nix +++ b/pkgs/development/python-modules/formbox/default.nix @@ -1,26 +1,24 @@ -{ lib, buildPythonPackage, pythonOlder, fetchFromSourcehut, flit-core, bleach, markdown }: +{ lib, buildPythonPackage, pythonOlder, fetchzip, flit-core, mistune, nh3 }: buildPythonPackage rec { pname = "formbox"; - version = "0.4.1"; + version = "0.4.3"; format = "pyproject"; disabled = pythonOlder "3.6"; - src = fetchFromSourcehut { - owner = "~cnx"; - repo = pname; - rev = version; - hash = "sha256-zOvXmSeBiwc0Z5mRMwMsHLU3A/iP7rpjXm0T0I2gUTk="; + src = fetchzip { + url = "https://trong.loang.net/~cnx/formbox/snapshot/formbox-${version}.tar.gz"; + hash = "sha256-sRu0otyeYpxot/Fyiz3wyQJsJvl8nsgIVitzT8frxLE="; }; nativeBuildInputs = [ flit-core ]; - propagatedBuildInputs = [ bleach markdown ]; + propagatedBuildInputs = [ mistune nh3 ]; doCheck = false; # there's no test pythonImportsCheck = [ "formbox" ]; meta = with lib; { description = "A script to format mbox as HTML/XML"; - homepage = "https://sr.ht/~cnx/formbox"; + homepage = "https://trong.loang.net/~cnx/formbox"; license = licenses.agpl3Plus; maintainers = [ maintainers.McSinyx ]; }; From 806f4b63c021d62bb12200f2f2f907072b355cd2 Mon Sep 17 00:00:00 2001 From: Rob <86313040+robert-manchester@users.noreply.github.com> Date: Fri, 20 Oct 2023 23:58:29 -0700 Subject: [PATCH 132/222] duckdb: disable non-deterministic test_connection_interrupt --- pkgs/development/python-modules/duckdb/default.nix | 2 ++ 1 file changed, 2 insertions(+) diff --git a/pkgs/development/python-modules/duckdb/default.nix b/pkgs/development/python-modules/duckdb/default.nix index 37ddad2cd045..5ff995684992 100644 --- a/pkgs/development/python-modules/duckdb/default.nix +++ b/pkgs/development/python-modules/duckdb/default.nix @@ -56,6 +56,8 @@ buildPythonPackage rec { disabledTests = [ # tries to make http request "test_install_non_existent_extension" + # test is racy and interrupt can be delivered before or after target point + "test_connection_interrupt" ]; preCheck = '' From 08e185fd2fc2bfe41719b0121b8d57e7ba0d36e1 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 07:31:19 +0000 Subject: [PATCH 133/222] clj-kondo: 2023.09.07 -> 2023.10.20 --- pkgs/development/tools/clj-kondo/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/tools/clj-kondo/default.nix b/pkgs/development/tools/clj-kondo/default.nix index 20f905a50ec9..dc78761cc256 100644 --- a/pkgs/development/tools/clj-kondo/default.nix +++ b/pkgs/development/tools/clj-kondo/default.nix @@ -2,11 +2,11 @@ buildGraalvmNativeImage rec { pname = "clj-kondo"; - version = "2023.09.07"; + version = "2023.10.20"; src = fetchurl { url = "https://github.com/clj-kondo/${pname}/releases/download/v${version}/${pname}-${version}-standalone.jar"; - sha256 = "sha256-F7ePdITYKkGB6nsR3EFJ7zLDCUoT0g3i+AAjXzBd624="; + sha256 = "sha256-f9u/pk3CEEmiLgnS2biaUHpsMHjVEwZL2jyB/1PiZUY="; }; extraNativeImageBuildArgs = [ From 5ed19a8d2ad73db58d84f51d474abce96ee3fd96 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 07:57:40 +0000 Subject: [PATCH 134/222] cloudfoundry-cli: 8.7.3 -> 8.7.4 --- .../networking/cluster/cloudfoundry-cli/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/applications/networking/cluster/cloudfoundry-cli/default.nix b/pkgs/applications/networking/cluster/cloudfoundry-cli/default.nix index 0371e8c813bd..2204a9405027 100644 --- a/pkgs/applications/networking/cluster/cloudfoundry-cli/default.nix +++ b/pkgs/applications/networking/cluster/cloudfoundry-cli/default.nix @@ -2,15 +2,15 @@ buildGoModule rec { pname = "cloudfoundry-cli"; - version = "8.7.3"; + version = "8.7.4"; src = fetchFromGitHub { owner = "cloudfoundry"; repo = "cli"; rev = "v${version}"; - sha256 = "sha256-2ABsxoGRRUfa09tVPmn1IXDR2IXIewg/b/fmQnaKLoY="; + sha256 = "sha256-W4+2ugRSSP3HgmyQJKGCPMX7cmE7Fk3iovBOgBen+q8="; }; - vendorHash = "sha256-k2NI9zyeQM4PJo2wE3WkG5sntJGISwmz4xqQVChu8WQ="; + vendorHash = "sha256-klbKL/c7L7kHPadDa/FkpuAgHYQmuLQK6yFhph52KsU="; subPackages = [ "." ]; From e28a6e9de352295d0548fd13aede58854ce6f55a Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:22:39 +0200 Subject: [PATCH 135/222] uncover: 1.0.6 -> 1.0.7 Diff: https://github.com/projectdiscovery/uncover/compare/refs/tags/v1.0.6...v1.0.7 Changelog: https://github.com/projectdiscovery/uncover/releases/tag/v1.0.7 --- pkgs/tools/security/uncover/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/tools/security/uncover/default.nix b/pkgs/tools/security/uncover/default.nix index 1ea2f4144780..f0ee8aa23757 100644 --- a/pkgs/tools/security/uncover/default.nix +++ b/pkgs/tools/security/uncover/default.nix @@ -5,16 +5,16 @@ buildGoModule rec { pname = "uncover"; - version = "1.0.6"; + version = "1.0.7"; src = fetchFromGitHub { owner = "projectdiscovery"; repo = pname; rev = "refs/tags/v${version}"; - hash = "sha256-FJtd73z6Cc56+nBderYncjrac3xRydDeoiJqn8xW29U="; + hash = "sha256-CJA+rDLubghaQT+yb0zQY3y8hF0/5ISH9YFvIQHwH2Y="; }; - vendorHash = "sha256-mpojOzGedkTthD+fHl9Uhul7tOCN1EGIin+7USoaNmE="; + vendorHash = "sha256-A7XPsl27Q5CaQXQUEvNB05B2M3mFGz/yZ4sOnOHxhw8="; meta = with lib; { description = "API wrapper to search for exposed hosts"; From 57dba9f9c10b06d98e0a01cfd2e19e5ec2068dfd Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:22:45 +0200 Subject: [PATCH 136/222] python311Packages.plugwise: 0.33.1 -> 0.33.2 Diff: https://github.com/plugwise/python-plugwise/compare/refs/tags/v0.33.1...v0.33.2 Changelog: https://github.com/plugwise/python-plugwise/releases/tag/v0.33.2 --- pkgs/development/python-modules/plugwise/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/plugwise/default.nix b/pkgs/development/python-modules/plugwise/default.nix index 8876eea828af..22e0a6282762 100644 --- a/pkgs/development/python-modules/plugwise/default.nix +++ b/pkgs/development/python-modules/plugwise/default.nix @@ -20,7 +20,7 @@ buildPythonPackage rec { pname = "plugwise"; - version = "0.33.1"; + version = "0.33.2"; format = "setuptools"; disabled = pythonOlder "3.7"; @@ -29,7 +29,7 @@ buildPythonPackage rec { owner = pname; repo = "python-plugwise"; rev = "refs/tags/v${version}"; - hash = "sha256-uJBUim5FlS+Jw3rGEKuorksVIgI5tVRAI7tESeYnGUc="; + hash = "sha256-WTgv0bEkhLMoRCw6Xh5SlYLxnlQCv603lKTajjCETT4="; }; propagatedBuildInputs = [ From ab21c4b13794be8a54570392de8b1af983a6731b Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:23:41 +0200 Subject: [PATCH 137/222] python311Packages.guppy3: 3.1.3 -> 3.1.4 Diff: https://github.com/zhuyifei1999/guppy3/compare/v3.1.3...v3.1.4 --- pkgs/development/python-modules/guppy3/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/guppy3/default.nix b/pkgs/development/python-modules/guppy3/default.nix index c47fb6a80425..65d7c2622a8e 100644 --- a/pkgs/development/python-modules/guppy3/default.nix +++ b/pkgs/development/python-modules/guppy3/default.nix @@ -7,14 +7,14 @@ buildPythonPackage rec { pname = "guppy3"; - version = "3.1.3"; + version = "3.1.4"; disabled = pythonOlder "3.6"; src = fetchFromGitHub { owner = "zhuyifei1999"; repo = pname; rev = "v${version}"; - hash = "sha256-i3WqXlNnNhBVw9rdnxnzQISFkZHBpc/gqG+rxOWPiyc="; + hash = "sha256-RMWIP4tVSCCEQpr0kZvsN1HwL6rBcLuubfBl175eSNg="; }; propagatedBuildInputs = [ tkinter ]; From 609249054d92ff06d6c842d5b4230bdeb8617303 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:24:19 +0200 Subject: [PATCH 138/222] python311Packages.aioairzone-cloud: 0.2.4 -> 0.2.7 Diff: https://github.com/Noltari/aioairzone-cloud/compare/refs/tags/0.2.4...0.2.7 Changelog: https://github.com/Noltari/aioairzone-cloud/releases/tag/0.2.7 --- pkgs/development/python-modules/aioairzone-cloud/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/aioairzone-cloud/default.nix b/pkgs/development/python-modules/aioairzone-cloud/default.nix index bdc21d70892f..2108555b0d33 100644 --- a/pkgs/development/python-modules/aioairzone-cloud/default.nix +++ b/pkgs/development/python-modules/aioairzone-cloud/default.nix @@ -9,7 +9,7 @@ buildPythonPackage rec { pname = "aioairzone-cloud"; - version = "0.2.4"; + version = "0.2.7"; format = "pyproject"; disabled = pythonOlder "3.7"; @@ -18,7 +18,7 @@ buildPythonPackage rec { owner = "Noltari"; repo = "aioairzone-cloud"; rev = "refs/tags/${version}"; - hash = "sha256-7sjiY20jDUHtEnqAMwEHsBboK9XCH5XjE0sHR82YvEA="; + hash = "sha256-v6cK4j16BhTqjdc5J9XQWGFCa1r9f0/dto9teVTNn0c="; }; nativeBuildInputs = [ From 5e676701d9ef0ce9d4277a8ef2d2eb79ddad9be6 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:25:47 +0200 Subject: [PATCH 139/222] python311Packages.pvo: 1.0.0 -> 2.0.0 Diff: https://github.com/frenck/python-pvoutput/compare/refs/tags/v1.0.0...v2.0.0 Changelog: https://github.com/frenck/python-pvoutput/releases/tag/v2.0.0 --- pkgs/development/python-modules/pvo/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/pvo/default.nix b/pkgs/development/python-modules/pvo/default.nix index 6f3f698fe2c7..d479a7b07091 100644 --- a/pkgs/development/python-modules/pvo/default.nix +++ b/pkgs/development/python-modules/pvo/default.nix @@ -13,7 +13,7 @@ buildPythonPackage rec { pname = "pvo"; - version = "1.0.0"; + version = "2.0.0"; format = "pyproject"; disabled = pythonOlder "3.10"; @@ -22,7 +22,7 @@ buildPythonPackage rec { owner = "frenck"; repo = "python-pvoutput"; rev = "refs/tags/v${version}"; - hash = "sha256-6oVACUnK8WVlEx047CUXmSXQ0+M3xnSvyMHw5Wttk7M="; + hash = "sha256-SvsrvGwIAlj/8hdk90+rxigVrx6n3YInvF/4eux2H04="; }; nativeBuildInputs = [ From 6e80d81f28d66e40ff0ad33d5f4b1e256bde0380 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:26:39 +0200 Subject: [PATCH 140/222] python311Packages.pvo: update disabled --- pkgs/development/python-modules/pvo/default.nix | 16 ++++++++-------- 1 file changed, 8 insertions(+), 8 deletions(-) diff --git a/pkgs/development/python-modules/pvo/default.nix b/pkgs/development/python-modules/pvo/default.nix index d479a7b07091..6963d3700013 100644 --- a/pkgs/development/python-modules/pvo/default.nix +++ b/pkgs/development/python-modules/pvo/default.nix @@ -16,7 +16,7 @@ buildPythonPackage rec { version = "2.0.0"; format = "pyproject"; - disabled = pythonOlder "3.10"; + disabled = pythonOlder "3.11"; src = fetchFromGitHub { owner = "frenck"; @@ -25,6 +25,13 @@ buildPythonPackage rec { hash = "sha256-SvsrvGwIAlj/8hdk90+rxigVrx6n3YInvF/4eux2H04="; }; + postPatch = '' + # Upstream doesn't set a version for the pyproject.toml + substituteInPlace pyproject.toml \ + --replace "0.0.0" "${version}" \ + --replace "--cov" "" + ''; + nativeBuildInputs = [ poetry-core ]; @@ -41,13 +48,6 @@ buildPythonPackage rec { pytestCheckHook ]; - postPatch = '' - # Upstream doesn't set a version for the pyproject.toml - substituteInPlace pyproject.toml \ - --replace "0.0.0" "${version}" \ - --replace "--cov" "" - ''; - pythonImportsCheck = [ "pvo" ]; From ccf6a49b0112e2bb752ee2b0be6e24514ab26500 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:27:38 +0200 Subject: [PATCH 141/222] python311Packages.twentemilieu: 1.0.0 -> 2.0.0 Diff: https://github.com/frenck/python-twentemilieu/compare/v1.0.0...v2.0.0 Changelog: https://github.com/frenck/python-twentemilieu/releases/tag/v2.0.0 --- pkgs/development/python-modules/twentemilieu/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/twentemilieu/default.nix b/pkgs/development/python-modules/twentemilieu/default.nix index aa91f01686c7..b23b0d5874f2 100644 --- a/pkgs/development/python-modules/twentemilieu/default.nix +++ b/pkgs/development/python-modules/twentemilieu/default.nix @@ -12,7 +12,7 @@ buildPythonPackage rec { pname = "twentemilieu"; - version = "1.0.0"; + version = "2.0.0"; format = "pyproject"; disabled = pythonOlder "3.10"; @@ -21,7 +21,7 @@ buildPythonPackage rec { owner = "frenck"; repo = "python-twentemilieu"; rev = "v${version}"; - hash = "sha256-MTAVa5gP5e8TIE/i1DjfmwKm1zDVC/WEcYKxZSV/+Ug="; + hash = "sha256-r0LZS8TXux1mzzXBTSu+x5sxUZOCzW7poKG3dQ2A6No="; }; postPatch = '' From f9c073bdb5eab769a21f8ba2e2cbbb969e3983b9 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:28:09 +0200 Subject: [PATCH 142/222] python311Packages.twentemilieu: update disabled --- pkgs/development/python-modules/twentemilieu/default.nix | 8 +++++--- 1 file changed, 5 insertions(+), 3 deletions(-) diff --git a/pkgs/development/python-modules/twentemilieu/default.nix b/pkgs/development/python-modules/twentemilieu/default.nix index b23b0d5874f2..e52f70753f32 100644 --- a/pkgs/development/python-modules/twentemilieu/default.nix +++ b/pkgs/development/python-modules/twentemilieu/default.nix @@ -15,12 +15,12 @@ buildPythonPackage rec { version = "2.0.0"; format = "pyproject"; - disabled = pythonOlder "3.10"; + disabled = pythonOlder "3.11"; src = fetchFromGitHub { owner = "frenck"; repo = "python-twentemilieu"; - rev = "v${version}"; + rev = "refs/tags/v${version}"; hash = "sha256-r0LZS8TXux1mzzXBTSu+x5sxUZOCzW7poKG3dQ2A6No="; }; @@ -45,7 +45,9 @@ buildPythonPackage rec { pytestCheckHook ]; - pythonImportsCheck = [ "twentemilieu" ]; + pythonImportsCheck = [ + "twentemilieu" + ]; meta = with lib; { description = "Python client for Twente Milieu"; From 87ce7e3df818a49a3c0bf88f7d472f55c126a832 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:31:34 +0200 Subject: [PATCH 143/222] python311Packages.elgato: 4.0.1 -> 5.0.0 Diff: https://github.com/frenck/python-elgato/compare/refs/tags/v4.0.1...v5.0.0 --- pkgs/development/python-modules/elgato/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/elgato/default.nix b/pkgs/development/python-modules/elgato/default.nix index 92b4cad66b5c..04270cdc1524 100644 --- a/pkgs/development/python-modules/elgato/default.nix +++ b/pkgs/development/python-modules/elgato/default.nix @@ -13,7 +13,7 @@ buildPythonPackage rec { pname = "elgato"; - version = "4.0.1"; + version = "5.0.0"; format = "pyproject"; disabled = pythonOlder "3.9"; @@ -22,7 +22,7 @@ buildPythonPackage rec { owner = "frenck"; repo = "python-elgato"; rev = "refs/tags/v${version}"; - hash = "sha256-kyFnc/lMxgYy8s/gAP5vpEPV8a+dphOummr6G7deGQ4="; + hash = "sha256-TI5wu2FYVUMvgDkbktcwPLnTSD8XUSy8qwOCdrsiopk="; }; nativeBuildInputs = [ From 8422ab35834166f5f795ac81cac7e068ed06a63a Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:32:30 +0200 Subject: [PATCH 144/222] python311Packages.elgato: update disabled --- .../python-modules/elgato/default.nix | 16 ++++++++-------- 1 file changed, 8 insertions(+), 8 deletions(-) diff --git a/pkgs/development/python-modules/elgato/default.nix b/pkgs/development/python-modules/elgato/default.nix index 04270cdc1524..0fb23f2e2b9c 100644 --- a/pkgs/development/python-modules/elgato/default.nix +++ b/pkgs/development/python-modules/elgato/default.nix @@ -16,7 +16,7 @@ buildPythonPackage rec { version = "5.0.0"; format = "pyproject"; - disabled = pythonOlder "3.9"; + disabled = pythonOlder "3.11"; src = fetchFromGitHub { owner = "frenck"; @@ -25,6 +25,13 @@ buildPythonPackage rec { hash = "sha256-TI5wu2FYVUMvgDkbktcwPLnTSD8XUSy8qwOCdrsiopk="; }; + postPatch = '' + # Upstream doesn't set a version for the pyproject.toml + substituteInPlace pyproject.toml \ + --replace "0.0.0" "${version}" \ + --replace "--cov" "" + ''; + nativeBuildInputs = [ poetry-core ]; @@ -41,13 +48,6 @@ buildPythonPackage rec { pytestCheckHook ]; - postPatch = '' - # Upstream doesn't set a version for the pyproject.toml - substituteInPlace pyproject.toml \ - --replace "0.0.0" "${version}" \ - --replace "--cov" "" - ''; - pythonImportsCheck = [ "elgato" ]; From d96fa83f04b54680fca6533d5f28be7f975b2bf5 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:33:23 +0200 Subject: [PATCH 145/222] python311Packages.elgato: add changelog to meta --- pkgs/development/python-modules/elgato/default.nix | 1 + 1 file changed, 1 insertion(+) diff --git a/pkgs/development/python-modules/elgato/default.nix b/pkgs/development/python-modules/elgato/default.nix index 0fb23f2e2b9c..3aeab819b76a 100644 --- a/pkgs/development/python-modules/elgato/default.nix +++ b/pkgs/development/python-modules/elgato/default.nix @@ -55,6 +55,7 @@ buildPythonPackage rec { meta = with lib; { description = "Python client for Elgato Key Lights"; homepage = "https://github.com/frenck/python-elgato"; + changelog = "https://github.com/frenck/python-elgato/releases/tag/v${version}"; license = with licenses; [ mit ]; maintainers = with maintainers; [ fab ]; }; From 2d0b0f71ffc089adf21032fb5f20251bd248e72c Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:35:56 +0200 Subject: [PATCH 146/222] python311Packages.sensor-state-data: 2.17.1 -> 2.18.0 Diff: https://github.com/Bluetooth-Devices/sensor-state-data/compare/refs/tags/v2.17.1...v2.18.0 Changelog: https://github.com/Bluetooth-Devices/sensor-state-data/releases/tag/v2.18.0 --- pkgs/development/python-modules/sensor-state-data/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/sensor-state-data/default.nix b/pkgs/development/python-modules/sensor-state-data/default.nix index 7316256cd8aa..7802340cedef 100644 --- a/pkgs/development/python-modules/sensor-state-data/default.nix +++ b/pkgs/development/python-modules/sensor-state-data/default.nix @@ -10,7 +10,7 @@ buildPythonPackage rec { pname = "sensor-state-data"; - version = "2.17.1"; + version = "2.18.0"; format = "pyproject"; disabled = pythonOlder "3.9"; @@ -19,7 +19,7 @@ buildPythonPackage rec { owner = "Bluetooth-Devices"; repo = pname; rev = "refs/tags/v${version}"; - hash = "sha256-zfgkTBdE8UWwk+G3bLBThVjgU+m2QoPf1fzORyznEgs="; + hash = "sha256-wYYSS4lABCbIhmUU3z3Wh0+4zwpEzXl8Kk9gi6LBrbQ="; }; nativeBuildInputs = [ From 69502b3ed9d0f6e90c96d37842fdb3090a237172 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:44:21 +0200 Subject: [PATCH 147/222] python311Packages.pyenphase: 1.12.0 -> 1.13.1 Diff: https://github.com/pyenphase/pyenphase/compare/refs/tags/v1.12.0...v1.13.1 Changelog: https://github.com/pyenphase/pyenphase/blob/1.13.1/CHANGELOG.md --- pkgs/development/python-modules/pyenphase/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/pyenphase/default.nix b/pkgs/development/python-modules/pyenphase/default.nix index 360db9124175..d18160d897d3 100644 --- a/pkgs/development/python-modules/pyenphase/default.nix +++ b/pkgs/development/python-modules/pyenphase/default.nix @@ -18,7 +18,7 @@ buildPythonPackage rec { pname = "pyenphase"; - version = "1.12.0"; + version = "1.13.1"; format = "pyproject"; disabled = pythonOlder "3.11"; @@ -27,7 +27,7 @@ buildPythonPackage rec { owner = "pyenphase"; repo = "pyenphase"; rev = "refs/tags/v${version}"; - hash = "sha256-gqbRz0JAp8hjZpFUzlFzqq86UKgD0TLWSp1Z9rdrk3s="; + hash = "sha256-8wGGx7ERYm+lKvLW/NUcJeBTqEXPM0jJNOOlkj/UzYk="; }; postPatch = '' From e4ae0ebfbb91799a5d7c182708c52fd4cc95b05f Mon Sep 17 00:00:00 2001 From: "Zak B. Elep" Date: Sat, 21 Oct 2023 16:45:22 +0800 Subject: [PATCH 148/222] perlPackages.CryptHSXKPasswd: fix deps and shebang for Darwin --- pkgs/top-level/perl-packages.nix | 7 ++++++- 1 file changed, 6 insertions(+), 1 deletion(-) diff --git a/pkgs/top-level/perl-packages.nix b/pkgs/top-level/perl-packages.nix index 425ece6b7bee..ea65b3a70268 100644 --- a/pkgs/top-level/perl-packages.nix +++ b/pkgs/top-level/perl-packages.nix @@ -4954,7 +4954,12 @@ with self; { url = "mirror://cpan/authors/id/B/BA/BARTB/Crypt-HSXKPasswd-v3.6.tar.gz"; hash = "sha256-lZ3MX58BG/ALha0i31ZrerK/XqHTYrDeD7WuKfvEWLM="; }; - buildInputs = [ Clone DateTime FileHomeDir FileShare FileShareDir GetoptLong JSON ListMoreUtils MathRound Readonly TextUnidecode TypeTiny ]; + nativeBuildInputs = lib.optional stdenv.isDarwin shortenPerlShebang; + propagatedBuildInputs = [ Clone DateTime FileHomeDir FileShare FileShareDir GetoptLong JSON ListMoreUtils MathRound Readonly TextUnidecode TypeTiny ]; + postInstall = lib.optionalString stdenv.isDarwin '' + shortenPerlShebang $out/bin/hsxkpasswd + ''; + meta = { description = "A secure memorable password generator"; homepage = "http://www.bartb.ie/hsxkpasswd"; From 7806619ff6ff03f4bbcbd7f828431082484b49cf Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:45:52 +0200 Subject: [PATCH 149/222] python311Packages.asyncwhois: 1.0.8 -> 1.0.9 Diff: https://github.com/pogzyb/asyncwhois/compare/refs/tags/v1.0.8...v1.0.9 Changelog: https://github.com/pogzyb/asyncwhois/releases/tag/v1.0.9 --- pkgs/development/python-modules/asyncwhois/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/asyncwhois/default.nix b/pkgs/development/python-modules/asyncwhois/default.nix index 25cb21e7e246..e462a0d0b49c 100644 --- a/pkgs/development/python-modules/asyncwhois/default.nix +++ b/pkgs/development/python-modules/asyncwhois/default.nix @@ -12,7 +12,7 @@ buildPythonPackage rec { pname = "asyncwhois"; - version = "1.0.8"; + version = "1.0.9"; format = "setuptools"; disabled = pythonOlder "3.7"; @@ -21,7 +21,7 @@ buildPythonPackage rec { owner = "pogzyb"; repo = "asyncwhois"; rev = "refs/tags/v${version}"; - hash = "sha256-fYXxoS4bGTat5QT98ETmWk/VKXJmg9mtkUu02SZT4Eo="; + hash = "sha256-5T/h4YzODH7zFyQpG8qVZetTK7V+Ii9jc+MQFgMUA8w="; }; propagatedBuildInputs = [ From 8a8dd9ea094d29cecfa887e181e4b5f02f27af53 Mon Sep 17 00:00:00 2001 From: XYenon Date: Sat, 21 Oct 2023 09:25:48 +0000 Subject: [PATCH 150/222] globalping-cli: 1.1.0 -> 1.1.5 --- pkgs/tools/networking/globalping-cli/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/tools/networking/globalping-cli/default.nix b/pkgs/tools/networking/globalping-cli/default.nix index bc07f20a5b11..c88688bca71d 100644 --- a/pkgs/tools/networking/globalping-cli/default.nix +++ b/pkgs/tools/networking/globalping-cli/default.nix @@ -2,13 +2,13 @@ buildGoModule rec { pname = "globalping-cli"; - version = "1.1.0"; + version = "1.1.5"; src = fetchFromGitHub { owner = "jsdelivr"; repo = pname; rev = "v${version}"; - hash = "sha256-UY+SAmkE8h/K92Em5iikcMiNixkqnDVkhlrKVq1ZkVM="; + hash = "sha256-k89tqQpGvX0WiYqEwPj+tDViUKDjLR5MrkA0CQI/A+o="; }; vendorHash = "sha256-fUB7WIEAPBot8A2f7WQ5wUDtCrOydZd4nd4qDuy1vzg="; From e58455e331562da5c3359af22efd217ac6b03591 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 09:38:07 +0000 Subject: [PATCH 151/222] python311Packages.bimmer-connected: 0.14.1 -> 0.14.2 --- pkgs/development/python-modules/bimmer-connected/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/bimmer-connected/default.nix b/pkgs/development/python-modules/bimmer-connected/default.nix index 40f7ad7cf8ab..470eaf376a77 100644 --- a/pkgs/development/python-modules/bimmer-connected/default.nix +++ b/pkgs/development/python-modules/bimmer-connected/default.nix @@ -17,7 +17,7 @@ buildPythonPackage rec { pname = "bimmer-connected"; - version = "0.14.1"; + version = "0.14.2"; format = "setuptools"; disabled = pythonOlder "3.6"; @@ -26,7 +26,7 @@ buildPythonPackage rec { owner = "bimmerconnected"; repo = "bimmer_connected"; rev = "refs/tags/${version}"; - hash = "sha256-Fo30qDBqVxVuD/Ow0jsvN20Hx7Zhvie47CE+1ys1ewU="; + hash = "sha256-69H0hB+yVmyzJ5A2Cb7ZcaaoRzMt618U+TUHYQ03/cY="; }; nativeBuildInputs = [ From 19dba92eb27930c87ef52821f2bc21185607afea Mon Sep 17 00:00:00 2001 From: colin Date: Wed, 30 Nov 2022 23:56:47 +0000 Subject: [PATCH 152/222] mathjax-node-cli: init at 1.0.1 project homepage: this tool is used in tex -> web workflows. for example, the `math2svg` pandoc filter included in nixpkgs' [pandoc-lua-filters] package -- used to transform markdown documents into html pages, for example -- has an implicit runtime dependency on the `tex2svg` binary packaged here. [pandoc-lua-filters]: https://github.com/NixOS/nixpkgs/blob/nixos-unstable/pkgs/tools/misc/pandoc-lua-filters/default.nix --- .../node-packages/node-packages.json | 1 + .../node-packages/node-packages.nix | 359 ++++++++++++++++++ 2 files changed, 360 insertions(+) diff --git a/pkgs/development/node-packages/node-packages.json b/pkgs/development/node-packages/node-packages.json index 74801b581eaa..f0e9b379f429 100644 --- a/pkgs/development/node-packages/node-packages.json +++ b/pkgs/development/node-packages/node-packages.json @@ -166,6 +166,7 @@ , "markdown-link-check" , "mastodon-bot" , "mathjax" +, "mathjax-node-cli" , "meat" , "mocha" , "multi-file-swagger" diff --git a/pkgs/development/node-packages/node-packages.nix b/pkgs/development/node-packages/node-packages.nix index 2035839ec0fa..2686f65e3b21 100644 --- a/pkgs/development/node-packages/node-packages.nix +++ b/pkgs/development/node-packages/node-packages.nix @@ -19057,6 +19057,15 @@ let sha512 = "0yayqDxWQbqk3ojkYqUKqaAQ6AfNKeKWRNA8kR0WXzAsdHpP4BIaOmMAG87JGuO6qcobyW4GjxHd9PmhEd+T9w=="; }; }; + "cliui-4.1.0" = { + name = "cliui"; + packageName = "cliui"; + version = "4.1.0"; + src = fetchurl { + url = "https://registry.npmjs.org/cliui/-/cliui-4.1.0.tgz"; + sha512 = "4FG+RSG9DL7uEwRUZXZn3SS34DiDPfzP0VOiEwtUWlE+AR2EIg+hSyvrIgUUfhdgR/UkAeW2QHgeP+hWrXs7jQ=="; + }; + }; "cliui-5.0.0" = { name = "cliui"; packageName = "cliui"; @@ -32416,6 +32425,15 @@ let sha512 = "xgs2NH9AE66ucSq4cNG1nhSFghr5l6tdL15Pk+jl46bmmBapgoaY/AacXyaDznAqmGL99TiLSQgO/XazFSKYeQ=="; }; }; + "invert-kv-2.0.0" = { + name = "invert-kv"; + packageName = "invert-kv"; + version = "2.0.0"; + src = fetchurl { + url = "https://registry.npmjs.org/invert-kv/-/invert-kv-2.0.0.tgz"; + sha512 = "wPVv/y/QQ/Uiirj/vh3oP+1Ww+AWehmi1g5fFWGPF6IpCBCDVrhgHRMvrLfdYcwDh3QJbGXDW4JAuzxElLSqKA=="; + }; + }; "iota-array-1.0.0" = { name = "iota-array"; packageName = "iota-array"; @@ -34720,6 +34738,15 @@ let sha512 = "SdRK2C7jjs4k/kT2mwtO07KJN9RnjxtKn03d9JVj6c3j9WwaLcFYsICYDnLAzY0hp+wG2nxl+Cm2jWLiNVYb8g=="; }; }; + "jsdom-11.12.0" = { + name = "jsdom"; + packageName = "jsdom"; + version = "11.12.0"; + src = fetchurl { + url = "https://registry.npmjs.org/jsdom/-/jsdom-11.12.0.tgz"; + sha512 = "y8Px43oyiBM13Zc1z780FrfNLJCXTL40EWlty/LXUtcjykRBNgLlCjWXpfSPBl2iv+N7koQN+dvqszHZgT/Fjw=="; + }; + }; "jsdom-14.1.0" = { name = "jsdom"; packageName = "jsdom"; @@ -35917,6 +35944,15 @@ let sha512 = "YiGkH6EnGrDGqLMITnGjXtGmNtjoXw9SVUzcaos8RBi7Ps0VBylkq+vOcY9QE5poLasPCR849ucFUkl0UzUyOw=="; }; }; + "lcid-2.0.0" = { + name = "lcid"; + packageName = "lcid"; + version = "2.0.0"; + src = fetchurl { + url = "https://registry.npmjs.org/lcid/-/lcid-2.0.0.tgz"; + sha512 = "avPEb8P8EGnwXKClwsNUgryVjllcRqtMYa49NTsbQagYuT1DcXnl1915oxWjoyGrXR6zH/Y0Zc96xWsPcoDKeA=="; + }; + }; "ldap-filter-0.3.3" = { name = "ldap-filter"; packageName = "ldap-filter"; @@ -35971,6 +36007,15 @@ let sha512 = "IpSVCk9AYvLHo5ctcIXxOBpMWUe+4TKN3VPWAKUbJikkmsGp0VrSM8IttVc32D6J4WUsiPE6aEFRNmIoF/gdow=="; }; }; + "left-pad-1.3.0" = { + name = "left-pad"; + packageName = "left-pad"; + version = "1.3.0"; + src = fetchurl { + url = "https://registry.npmjs.org/left-pad/-/left-pad-1.3.0.tgz"; + sha512 = "XI5MPzVNApjAyhQzphX8BkmKsKUxD4LdyK24iZeQGinBN9yTQT3bFlCBy/aVx2HrNcqQGsdot8ghrjyrvMCoEA=="; + }; + }; "less-4.2.0" = { name = "less"; packageName = "less"; @@ -38528,6 +38573,33 @@ let sha512 = "rUxjysqif/BZQH2yhd5Aaq7vXMSx9NdEsQcyA07uEzIvxgI7zIr33gGsh+RU0/XjmQpCW7RsVof1vlkvQVCK5A=="; }; }; + "mathjax-2.7.9" = { + name = "mathjax"; + packageName = "mathjax"; + version = "2.7.9"; + src = fetchurl { + url = "https://registry.npmjs.org/mathjax/-/mathjax-2.7.9.tgz"; + sha512 = "NOGEDTIM9+MrsqnjPEjVGNx4q0GQxqm61yQwSK+/5S59i26wId5IC5gNu9/bu8+CCVl5p9G2IHcAl/wJa+5+BQ=="; + }; + }; + "mathjax-node-2.1.1" = { + name = "mathjax-node"; + packageName = "mathjax-node"; + version = "2.1.1"; + src = fetchurl { + url = "https://registry.npmjs.org/mathjax-node/-/mathjax-node-2.1.1.tgz"; + sha512 = "i29tvqD8yHPB2WhrGV5rvliYnKwTT8a/TO8SCnuYtatpSHxLGy3aF7lDTVLD6B1bfuVMTFB6McZu2TBxk0XGeg=="; + }; + }; + "mathjax-node-sre-3.0.3" = { + name = "mathjax-node-sre"; + packageName = "mathjax-node-sre"; + version = "3.0.3"; + src = fetchurl { + url = "https://registry.npmjs.org/mathjax-node-sre/-/mathjax-node-sre-3.0.3.tgz"; + sha512 = "SBwqD3DEgdYyPQv7vUBqH/uCr0eOI23PbffzmhelFPY8KdVANZkE2hssJA0Dfl23y7uEefsoVOryckMLEmmzaw=="; + }; + }; "mathml-tag-names-2.1.3" = { name = "mathml-tag-names"; packageName = "mathml-tag-names"; @@ -43272,6 +43344,15 @@ let sha512 = "PRT7ZORmwu2MEFt4/fv3Q+mEfN4zetKxufQrkShY2oGvUms9r8otu5HfdyIFHkYXjO7laNsoVGmM2MANfuTA8g=="; }; }; + "os-locale-3.1.0" = { + name = "os-locale"; + packageName = "os-locale"; + version = "3.1.0"; + src = fetchurl { + url = "https://registry.npmjs.org/os-locale/-/os-locale-3.1.0.tgz"; + sha512 = "Z8l3R4wYWM40/52Z+S265okfFj8Kt2cC2MKY+xNi3kFs+XGI7WXu/I309QQQYbRW4ijiZ+yxs9pqEhJh0DqW3Q=="; + }; + }; "os-paths-4.4.0" = { name = "os-paths"; packageName = "os-paths"; @@ -44271,6 +44352,15 @@ let sha512 = "rgO9Zg5LLLkfJF9E6CCmXlSE4UVceloys8JrFqCcHloC3usd/kJCyPDwH2SOlzix2j3xaP9sUX3e8+kvkuleAA=="; }; }; + "parse5-4.0.0" = { + name = "parse5"; + packageName = "parse5"; + version = "4.0.0"; + src = fetchurl { + url = "https://registry.npmjs.org/parse5/-/parse5-4.0.0.tgz"; + sha512 = "VrZ7eOd3T1Fk4XWNXMgiGBK/z0MG48BWG2uQNU4I72fkQuKUTZpl+u9k+CxEG0twMVzSmXEEz12z5Fnw1jIQFA=="; + }; + }; "parse5-5.1.0" = { name = "parse5"; packageName = "parse5"; @@ -52254,6 +52344,15 @@ let sha512 = "1klA3Gi5PD1Wv9Q0wUoOQN1IWAuPu0D1U03ThXTr0cJ20+/iq2tHSDnK7Kk/0LXJ1ztUB2/1Os0wKmfyNgUQfg=="; }; }; + "speech-rule-engine-2.4.0" = { + name = "speech-rule-engine"; + packageName = "speech-rule-engine"; + version = "2.4.0"; + src = fetchurl { + url = "https://registry.npmjs.org/speech-rule-engine/-/speech-rule-engine-2.4.0.tgz"; + sha512 = "7IXDmpGiQOJWUPVy/rcayqi1aTCrhcQ/bVACu2oyueEuiYzPW8GebYRF4LeyMROL/E0kxkO5U66t0aFWCv0QCQ=="; + }; + }; "speed-limiter-1.0.2" = { name = "speed-limiter"; packageName = "speed-limiter"; @@ -59455,6 +59554,15 @@ let sha512 = "saE57nupxk6v3HY35+jzBwYa0rKSy0XR8JSxZPwgLr7ys0IBzhGviA1/TUGJLmSVqs8pb9AnvICXEuOHLprYTw=="; }; }; + "whatwg-url-6.5.0" = { + name = "whatwg-url"; + packageName = "whatwg-url"; + version = "6.5.0"; + src = fetchurl { + url = "https://registry.npmjs.org/whatwg-url/-/whatwg-url-6.5.0.tgz"; + sha512 = "rhRZRqx/TLJQWUpQ6bmrt2UV4f0HCQ463yQuONJqC6fO2VoEb1pTYddbe59SkYq87aoM5A3bdhMZiUiVws+fzQ=="; + }; + }; "whatwg-url-7.1.0" = { name = "whatwg-url"; packageName = "whatwg-url"; @@ -59590,6 +59698,15 @@ let sha512 = "qe9UWWpkeG5yzZ0tNYxDmd7vo58HDBc39mZ0xWWpolAGADdFOzkfamWLDxkOWcvHQKVmdTyQdLD4NOfjLWTKew=="; }; }; + "wicked-good-xpath-1.3.0" = { + name = "wicked-good-xpath"; + packageName = "wicked-good-xpath"; + version = "1.3.0"; + src = fetchurl { + url = "https://registry.npmjs.org/wicked-good-xpath/-/wicked-good-xpath-1.3.0.tgz"; + sha512 = "Gd9+TUn5nXdwj/hFsPVx5cuHHiF5Bwuc30jZ4+ronF1qHK5O7HD0sgmXWSEgwKquT3ClLoKPVbO6qGwVwLzvAw=="; + }; + }; "wide-align-1.1.5" = { name = "wide-align"; packageName = "wide-align"; @@ -60094,6 +60211,15 @@ let sha512 = "61a+9LgtYZxTq1hAonhX8Xwpo2riK4IOR/BIVxioFbCfc3QFKmpE4x9dLExfLHKtUfVZigYa36tThVhO57erEw=="; }; }; + "ws-5.2.3" = { + name = "ws"; + packageName = "ws"; + version = "5.2.3"; + src = fetchurl { + url = "https://registry.npmjs.org/ws/-/ws-5.2.3.tgz"; + sha512 = "jZArVERrMsKUatIdnLzqvcfydI85dvd/Fp1u/VOpfdDWQ4c9qWXe+VIeAbQ5FrDwciAkr+lzofXLz3Kuf26AOA=="; + }; + }; "ws-6.1.4" = { name = "ws"; packageName = "ws"; @@ -60472,6 +60598,15 @@ let sha512 = "yS2uJflVQs6n+CyjHoaBmVSqIDevTAWrzMmjG1Gc7h1qQ7uVozNhEPJAwZXWyGQ/Gafo3fCwrcaokezLPupVyQ=="; }; }; + "xmldom-sre-0.1.31" = { + name = "xmldom-sre"; + packageName = "xmldom-sre"; + version = "0.1.31"; + src = fetchurl { + url = "https://registry.npmjs.org/xmldom-sre/-/xmldom-sre-0.1.31.tgz"; + sha512 = "f9s+fUkX04BxQf+7mMWAp5zk61pciie+fFLC9hX9UVvCeJQfNHRHXpeo5MPcR0EUf57PYLdt+ZO4f3Ipk2oZUw=="; + }; + }; "xmlhttprequest-https://github.com/LearnBoost/node-XMLHttpRequest/archive/0f36d0b5ebc03d85f860d42a64ae9791e1daa433.tar.gz" = { name = "xmlhttprequest"; packageName = "xmlhttprequest"; @@ -60680,6 +60815,15 @@ let sha512 = "C/FsVVhht4iPQYXOInoxUM/1ELSf9EsgKH34FofQOp6hwCPrW4vG4w5++TED3xRUo8gD7l0P1J1dLlDYzODsTQ=="; }; }; + "yargs-12.0.5" = { + name = "yargs"; + packageName = "yargs"; + version = "12.0.5"; + src = fetchurl { + url = "https://registry.npmjs.org/yargs/-/yargs-12.0.5.tgz"; + sha512 = "Lhz8TLaYnxq/2ObqHDql8dX8CJi97oHxrjUcYtzKbbykPtVW9WB+poxI+NM2UIzsMgNCZTIf0AQwsjK5yMAqZw=="; + }; + }; "yargs-13.3.2" = { name = "yargs"; packageName = "yargs"; @@ -60788,6 +60932,15 @@ let sha512 = "VCIyR1wJoEBZUqk5PA+oOBF6ypbwh5aNB3I50guxAL/quggdfs4TtNHQrSazFA3fYZ+tEqfs0zIGlv0c/rgjbQ=="; }; }; + "yargs-parser-11.1.1" = { + name = "yargs-parser"; + packageName = "yargs-parser"; + version = "11.1.1"; + src = fetchurl { + url = "https://registry.npmjs.org/yargs-parser/-/yargs-parser-11.1.1.tgz"; + sha512 = "C6kB/WJDiaxONLJQnF8ccx9SEeoTTLek8RVbaOIsrAUS8VrBEXfmeSnCZxygc+XC2sNMBIwOOnfcxiynjHsVSQ=="; + }; + }; "yargs-parser-13.1.2" = { name = "yargs-parser"; packageName = "yargs-parser"; @@ -86065,6 +86218,212 @@ in bypassCache = true; reconstructLock = true; }; + mathjax-node-cli = nodeEnv.buildNodePackage { + name = "mathjax-node-cli"; + packageName = "mathjax-node-cli"; + version = "1.0.1"; + src = fetchurl { + url = "https://registry.npmjs.org/mathjax-node-cli/-/mathjax-node-cli-1.0.1.tgz"; + sha512 = "p1OB9zalQZkKYumfx+8mSX59MysF2Ox2H88gHSUQpdjpuMISwIPfw0MQmsvcS00hntSX05uEDa3uzo+1SgSk5w=="; + }; + dependencies = [ + sources."abab-2.0.6" + sources."acorn-5.7.4" + (sources."acorn-globals-4.3.4" // { + dependencies = [ + sources."acorn-6.4.2" + ]; + }) + sources."acorn-walk-6.2.0" + sources."ajv-6.12.6" + sources."ansi-regex-3.0.1" + sources."ansi-styles-4.3.0" + sources."array-equal-1.0.0" + sources."asn1-0.2.6" + sources."assert-plus-1.0.0" + sources."async-limiter-1.0.1" + sources."asynckit-0.4.0" + sources."aws-sign2-0.7.0" + sources."aws4-1.12.0" + sources."bcrypt-pbkdf-1.0.2" + sources."browser-process-hrtime-1.0.0" + sources."camelcase-5.3.1" + sources."caseless-0.12.0" + sources."cliui-4.1.0" + sources."code-point-at-1.1.0" + sources."color-convert-2.0.1" + sources."color-name-1.1.4" + sources."combined-stream-1.0.8" + sources."commander-11.0.0" + sources."core-util-is-1.0.2" + sources."cross-spawn-6.0.5" + sources."cssom-0.3.8" + sources."cssstyle-1.4.0" + sources."dashdash-1.14.1" + (sources."data-urls-1.1.0" // { + dependencies = [ + sources."whatwg-url-7.1.0" + ]; + }) + sources."decamelize-1.2.0" + sources."deep-is-0.1.4" + sources."delayed-stream-1.0.0" + sources."domexception-1.0.1" + sources."ecc-jsbn-0.1.2" + sources."emoji-regex-8.0.0" + sources."end-of-stream-1.4.4" + sources."escalade-3.1.1" + sources."escodegen-1.14.3" + sources."esprima-4.0.1" + sources."estraverse-4.3.0" + sources."esutils-2.0.3" + sources."execa-1.0.0" + sources."extend-3.0.2" + sources."extsprintf-1.3.0" + sources."fast-deep-equal-3.1.3" + sources."fast-json-stable-stringify-2.1.0" + sources."fast-levenshtein-2.0.6" + sources."find-up-3.0.0" + sources."forever-agent-0.6.1" + sources."form-data-2.3.3" + sources."get-caller-file-1.0.3" + sources."get-stream-4.1.0" + sources."getpass-0.1.7" + sources."har-schema-2.0.0" + sources."har-validator-5.1.5" + sources."html-encoding-sniffer-1.0.2" + sources."http-signature-1.2.0" + sources."iconv-lite-0.4.24" + sources."invert-kv-2.0.0" + sources."is-fullwidth-code-point-2.0.0" + sources."is-stream-1.1.0" + sources."is-typedarray-1.0.0" + sources."isexe-2.0.0" + sources."isstream-0.1.2" + sources."jsbn-0.1.1" + sources."jsdom-11.12.0" + sources."json-schema-0.4.0" + sources."json-schema-traverse-0.4.1" + sources."json-stringify-safe-5.0.1" + sources."jsprim-1.4.2" + sources."lcid-2.0.0" + sources."left-pad-1.3.0" + sources."levn-0.3.0" + sources."locate-path-3.0.0" + sources."lodash-4.17.21" + sources."lodash.sortby-4.7.0" + sources."map-age-cleaner-0.1.3" + sources."mathjax-2.7.9" + sources."mathjax-node-2.1.1" + (sources."mathjax-node-sre-3.0.3" // { + dependencies = [ + sources."yargs-12.0.5" + ]; + }) + sources."mem-4.3.0" + sources."mime-db-1.52.0" + sources."mime-types-2.1.35" + sources."mimic-fn-2.1.0" + sources."nice-try-1.0.5" + sources."npm-run-path-2.0.2" + sources."number-is-nan-1.0.1" + sources."nwsapi-2.2.7" + sources."oauth-sign-0.9.0" + sources."once-1.4.0" + sources."optionator-0.8.3" + sources."os-locale-3.1.0" + sources."p-defer-1.0.0" + sources."p-finally-1.0.0" + sources."p-is-promise-2.1.0" + sources."p-limit-2.3.0" + sources."p-locate-3.0.0" + sources."p-try-2.2.0" + sources."parse5-4.0.0" + sources."path-exists-3.0.0" + sources."path-key-2.0.1" + sources."performance-now-2.1.0" + sources."pn-1.1.0" + sources."prelude-ls-1.1.2" + sources."psl-1.9.0" + sources."pump-3.0.0" + sources."punycode-2.3.0" + sources."qs-6.5.3" + sources."request-2.88.2" + sources."request-promise-core-1.1.4" + sources."request-promise-native-1.0.9" + sources."require-directory-2.1.1" + sources."require-main-filename-1.0.1" + sources."safe-buffer-5.2.1" + sources."safer-buffer-2.1.2" + sources."sax-1.3.0" + sources."semver-5.7.2" + sources."set-blocking-2.0.0" + sources."shebang-command-1.2.0" + sources."shebang-regex-1.0.0" + sources."signal-exit-3.0.7" + sources."source-map-0.6.1" + sources."speech-rule-engine-2.4.0" + sources."sshpk-1.17.0" + sources."stealthy-require-1.1.1" + sources."string-width-2.1.1" + sources."strip-ansi-4.0.0" + sources."strip-eof-1.0.0" + sources."symbol-tree-3.2.4" + sources."tough-cookie-2.5.0" + sources."tr46-1.0.1" + sources."tunnel-agent-0.6.0" + sources."tweetnacl-0.14.5" + sources."type-check-0.3.2" + sources."uri-js-4.4.1" + sources."uuid-3.4.0" + sources."verror-1.10.0" + sources."w3c-hr-time-1.0.2" + sources."webidl-conversions-4.0.2" + sources."whatwg-encoding-1.0.5" + sources."whatwg-mimetype-2.3.0" + sources."whatwg-url-6.5.0" + sources."which-1.3.1" + sources."which-module-2.0.1" + sources."wicked-good-xpath-1.3.0" + sources."word-wrap-1.2.5" + (sources."wrap-ansi-2.1.0" // { + dependencies = [ + sources."ansi-regex-2.1.1" + sources."is-fullwidth-code-point-1.0.0" + sources."string-width-1.0.2" + sources."strip-ansi-3.0.1" + ]; + }) + sources."wrappy-1.0.2" + sources."ws-5.2.3" + sources."xml-name-validator-3.0.0" + sources."xmldom-sre-0.1.31" + sources."y18n-4.0.3" + (sources."yargs-17.7.2" // { + dependencies = [ + sources."ansi-regex-5.0.1" + sources."cliui-8.0.1" + sources."get-caller-file-2.0.5" + sources."is-fullwidth-code-point-3.0.0" + sources."string-width-4.2.3" + sources."strip-ansi-6.0.1" + sources."wrap-ansi-7.0.0" + sources."y18n-5.0.8" + sources."yargs-parser-21.1.1" + ]; + }) + sources."yargs-parser-11.1.1" + ]; + buildInputs = globalBuildInputs; + meta = { + description = "CLI tools for calling mathjax-node"; + homepage = "https://github.com/mathjax/mathjax-node-cli#readme"; + license = "Apache-2.0"; + }; + production = true; + bypassCache = true; + reconstructLock = true; + }; meat = nodeEnv.buildNodePackage { name = "meat"; packageName = "meat"; From 77f3a6deb2c6fc4044218340cf3bcf41c48f8270 Mon Sep 17 00:00:00 2001 From: Pavol Rusnak Date: Sat, 21 Oct 2023 12:12:10 +0200 Subject: [PATCH 153/222] trezor-suite: 23.4.2 -> 23.10.1 --- pkgs/applications/blockchains/trezor-suite/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/applications/blockchains/trezor-suite/default.nix b/pkgs/applications/blockchains/trezor-suite/default.nix index c56e6da52f0f..e5f8963e921c 100644 --- a/pkgs/applications/blockchains/trezor-suite/default.nix +++ b/pkgs/applications/blockchains/trezor-suite/default.nix @@ -8,7 +8,7 @@ let pname = "trezor-suite"; - version = "23.4.2"; + version = "23.10.1"; name = "${pname}-${version}"; suffix = { @@ -19,8 +19,8 @@ let src = fetchurl { url = "https://github.com/trezor/${pname}/releases/download/v${version}/Trezor-Suite-${version}-${suffix}.AppImage"; hash = { # curl -Lfs https://github.com/trezor/trezor-suite/releases/latest/download/latest-linux{-arm64,}.yml | grep ^sha512 | sed 's/: /-/' - aarch64-linux = "sha512-+dcogzj0mENWSAVKqUG/xyF+TD/nKpA3UiNyI2M7iiCaW+tpwO5Y0uUmzb1rFRtDsKMflDPZNWe8qMJmrtaIrA=="; - x86_64-linux = "sha512-8UyPa3hDmALiYGao451ZBQLxv9H9OLbzzHiANp4zgvjBLGNhZnPFBIYM6KGyKkgRJJiTcgd7VHCgEhPpfm0qzg=="; + aarch64-linux = "sha512-MR9BYg6R+Oof3zh02KSh48V2m6J7JpsrYpi6gj5kTvKuCU5Ci5AwPEAvnTjHAR6xlappvoNQmeA5nCEoTWaL7A=="; + x86_64-linux = "sha512-BqdfhYLG4z+9B7KbJGWGPml7U2fl/RQ1nZK0vdeA/cKhG0SjH0K8er9bemg60RPBXj0AeuK80v/6vMbDtyEnRQ=="; }.${stdenv.hostPlatform.system} or (throw "Unsupported system: ${stdenv.hostPlatform.system}"); }; From 15d241a40ad8ca2f775cf2dc2791dbcf3c1f4338 Mon Sep 17 00:00:00 2001 From: Patrick Steinhardt Date: Sat, 21 Oct 2023 12:51:47 +0200 Subject: [PATCH 154/222] maintainers: add pks --- maintainers/maintainer-list.nix | 6 ++++++ 1 file changed, 6 insertions(+) diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix index 855357675a8d..82720afe2e05 100644 --- a/maintainers/maintainer-list.nix +++ b/maintainers/maintainer-list.nix @@ -13916,6 +13916,12 @@ githubId = 610615; name = "Chih-Mao Chen"; }; + pks = { + email = "ps@pks.im"; + github = "pks-t"; + githubId = 4056630; + name = "Patrick Steinhardt"; + }; plabadens = { name = "Pierre Labadens"; email = "labadens.pierre+nixpkgs@gmail.com"; From feee795c45c543638c81211e05f1a1a05581a00b Mon Sep 17 00:00:00 2001 From: Patrick Steinhardt Date: Sat, 21 Oct 2023 12:52:22 +0200 Subject: [PATCH 155/222] kodi.packages.netflix: add pks to maintainers --- pkgs/applications/video/kodi/addons/netflix/default.nix | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/pkgs/applications/video/kodi/addons/netflix/default.nix b/pkgs/applications/video/kodi/addons/netflix/default.nix index 5a3089d1936d..3352ae4c63d3 100644 --- a/pkgs/applications/video/kodi/addons/netflix/default.nix +++ b/pkgs/applications/video/kodi/addons/netflix/default.nix @@ -24,6 +24,6 @@ buildKodiAddon rec { homepage = "https://github.com/CastagnaIT/plugin.video.netflix"; description = "Netflix VOD Services Add-on"; license = licenses.mit; - maintainers = teams.kodi.members; + maintainers = teams.kodi.members ++ [ maintainers.pks ]; }; } From eeb3936722e6f31ed8e292762be1bc6645cf6c27 Mon Sep 17 00:00:00 2001 From: hacker1024 Date: Sat, 21 Oct 2023 21:54:21 +1100 Subject: [PATCH 156/222] buildDartApplication: Format with nixpkgs-fmt --- .../dart/build-dart-application/default.nix | 19 +++++++++---------- 1 file changed, 9 insertions(+), 10 deletions(-) diff --git a/pkgs/build-support/dart/build-dart-application/default.nix b/pkgs/build-support/dart/build-dart-application/default.nix index be1fd7277671..b2535123e382 100644 --- a/pkgs/build-support/dart/build-dart-application/default.nix +++ b/pkgs/build-support/dart/build-dart-application/default.nix @@ -18,11 +18,10 @@ , dartEntryPoints ? null # Used when wrapping aot, jit, kernel, and js builds. # Set to null to disable wrapping. -, dartRuntimeCommand ? - if dartOutputType == "aot-snapshot" then "${dart}/bin/dartaotruntime" - else if (dartOutputType == "jit-snapshot" || dartOutputType == "kernel") then "${dart}/bin/dart" - else if dartOutputType == "js" then "${nodejs}/bin/node" - else null +, dartRuntimeCommand ? if dartOutputType == "aot-snapshot" then "${dart}/bin/dartaotruntime" + else if (dartOutputType == "jit-snapshot" || dartOutputType == "kernel") then "${dart}/bin/dart" + else if dartOutputType == "js" then "${nodejs}/bin/node" + else null , pubspecLockFile ? null , vendorHash ? "" @@ -43,15 +42,15 @@ let inherit (dartHooks.override { inherit dart; }) dartConfigHook dartBuildHook dartInstallHook; in assert !(builtins.isString dartOutputType && dartOutputType != "") -> - throw "dartOutputType must be a non-empty string"; +throw "dartOutputType must be a non-empty string"; stdenv.mkDerivation (args // { inherit pubGetScript dartCompileCommand dartOutputType dartRuntimeCommand dartCompileFlags dartJitFlags; - dartEntryPoints = - if (dartEntryPoints != null) - then writeText "entrypoints.json" (builtins.toJSON dartEntryPoints) - else null; + dartEntryPoints = + if (dartEntryPoints != null) + then writeText "entrypoints.json" (builtins.toJSON dartEntryPoints) + else null; nativeBuildInputs = (args.nativeBuildInputs or [ ]) ++ [ dart From 64c638bfc07d05370c7f5a3833b5871f4210ef6e Mon Sep 17 00:00:00 2001 From: hacker1024 Date: Sat, 21 Oct 2023 22:02:30 +1100 Subject: [PATCH 157/222] fetchDartDeps: Disable install phase in depsListDrv --- pkgs/build-support/dart/fetch-dart-deps/default.nix | 2 ++ 1 file changed, 2 insertions(+) diff --git a/pkgs/build-support/dart/fetch-dart-deps/default.nix b/pkgs/build-support/dart/fetch-dart-deps/default.nix index e523b60797eb..51052cae18f4 100644 --- a/pkgs/build-support/dart/fetch-dart-deps/default.nix +++ b/pkgs/build-support/dart/fetch-dart-deps/default.nix @@ -169,6 +169,8 @@ let dart pub deps --json | jq .packages > $out runHook postBuild ''; + + dontInstall = true; } // (removeAttrs buildDrvInheritArgs [ "name" "pname" ])); # As of Dart 3.0.0, Pub checks the revision of cached Git-sourced packages. From 234b63b0f0668770f9136eb06c718787aed4d342 Mon Sep 17 00:00:00 2001 From: hacker1024 Date: Sat, 21 Oct 2023 22:00:54 +1100 Subject: [PATCH 158/222] buildDartApplication: Allow supplying runtime dependencies --- .../dart/build-dart-application/default.nix | 8 +++++-- .../hooks/dart-fixup-hook.sh | 21 +++++++++++++++++++ .../build-dart-application/hooks/default.nix | 3 +++ 3 files changed, 30 insertions(+), 2 deletions(-) create mode 100644 pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh diff --git a/pkgs/build-support/dart/build-dart-application/default.nix b/pkgs/build-support/dart/build-dart-application/default.nix index b2535123e382..2246c5634d27 100644 --- a/pkgs/build-support/dart/build-dart-application/default.nix +++ b/pkgs/build-support/dart/build-dart-application/default.nix @@ -23,6 +23,7 @@ else if dartOutputType == "js" then "${nodejs}/bin/node" else null +, runtimeDependencies ? [ ] , pubspecLockFile ? null , vendorHash ? "" , ... @@ -39,25 +40,28 @@ let buildDrvArgs = args; inherit pubGetScript vendorHash pubspecLockFile; }; - inherit (dartHooks.override { inherit dart; }) dartConfigHook dartBuildHook dartInstallHook; + inherit (dartHooks.override { inherit dart; }) dartConfigHook dartBuildHook dartInstallHook dartFixupHook; in assert !(builtins.isString dartOutputType && dartOutputType != "") -> throw "dartOutputType must be a non-empty string"; stdenv.mkDerivation (args // { inherit pubGetScript dartCompileCommand dartOutputType dartRuntimeCommand - dartCompileFlags dartJitFlags; + dartCompileFlags dartJitFlags runtimeDependencies; dartEntryPoints = if (dartEntryPoints != null) then writeText "entrypoints.json" (builtins.toJSON dartEntryPoints) else null; + runtimeDependencyLibraryPath = lib.makeLibraryPath runtimeDependencies; + nativeBuildInputs = (args.nativeBuildInputs or [ ]) ++ [ dart dartDeps dartConfigHook dartBuildHook dartInstallHook + dartFixupHook makeWrapper ] ++ lib.optionals stdenv.isDarwin [ darwin.sigtool diff --git a/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh b/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh new file mode 100644 index 000000000000..6e1995aebc13 --- /dev/null +++ b/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh @@ -0,0 +1,21 @@ +# shellcheck shell=bash + +dartFixupHook() { + echo "Executing dartFixupHook" + + echo "Providing runtime dependencies" + if [[ ! -z "$runtimeDependencyLibraryPath" ]]; then + # Add runtime library dependencies to the LD_LIBRARY_PATH. + # For some reason, the RUNPATH of the executable is not used to load dynamic libraries in dart:ffi with DynamicLibrary.open(). + # + # This could alternatively be fixed with patchelf --add-needed, but this would cause all the libraries to be opened immediately, + # which is not what application authors expect. + for f in "$out"/bin/*; do + wrapProgram "$f" --suffix LD_LIBRARY_PATH : "$runtimeDependencyLibraryPath" + done + fi + + echo "Finished dartFixupHook" +} + +postFixupHooks+=(dartFixupHook) \ No newline at end of file diff --git a/pkgs/build-support/dart/build-dart-application/hooks/default.nix b/pkgs/build-support/dart/build-dart-application/hooks/default.nix index 463061c54a8d..134989426d96 100644 --- a/pkgs/build-support/dart/build-dart-application/hooks/default.nix +++ b/pkgs/build-support/dart/build-dart-application/hooks/default.nix @@ -12,4 +12,7 @@ dartInstallHook = makeSetupHook { name = "dart-install-hook"; } ./dart-install-hook.sh; + dartFixupHook = makeSetupHook { + name = "dart-fixup-hook"; + } ./dart-fixup-hook.sh; } From 6298ac27745cbab2dd3895c2c25ad3a795310f78 Mon Sep 17 00:00:00 2001 From: hacker1024 Date: Sat, 21 Oct 2023 22:30:23 +1100 Subject: [PATCH 159/222] buildDartApplication: Use package override mechanism from buildFlutterApplication This allows Dart applications to benefit from the package override system, which is useful for things like FFI dependencies. --- doc/languages-frameworks/dart.section.md | 7 +- .../dart/build-dart-application/default.nix | 108 +- .../dart/package-overrides/default.nix | 3 + .../tools/misc/dart-sass/default.nix | 1 + .../tools/misc/dart-sass/deps.json | 930 ++++++++++++++++++ .../tools/protoc-gen-dart/default.nix | 1 + .../tools/protoc-gen-dart/deps.json | 549 +++++++++++ pkgs/tools/misc/domine/default.nix | 2 +- pkgs/tools/misc/domine/deps.json | 190 ++++ 9 files changed, 1755 insertions(+), 36 deletions(-) create mode 100644 pkgs/development/compilers/dart/package-overrides/default.nix create mode 100644 pkgs/development/tools/misc/dart-sass/deps.json create mode 100644 pkgs/development/tools/protoc-gen-dart/deps.json create mode 100644 pkgs/tools/misc/domine/deps.json diff --git a/doc/languages-frameworks/dart.section.md b/doc/languages-frameworks/dart.section.md index b00327b78eb2..8d9c062f4220 100644 --- a/doc/languages-frameworks/dart.section.md +++ b/doc/languages-frameworks/dart.section.md @@ -12,6 +12,8 @@ If you are packaging a Flutter desktop application, use [`buildFlutterApplicatio If the upstream source is missing a `pubspec.lock` file, you'll have to vendor one and specify it using `pubspecLockFile`. If it is needed, one will be generated for you and printed when attempting to build the derivation. +The `depsListFile` must always be provided when packaging in Nixpkgs. It will be generated and printed if the derivation is attempted to be built without one. Alternatively, `autoDepsList` may be set to `true` only when outside of Nixpkgs, as it relies on import-from-derivation. + The `dart` commands run can be overridden through `pubGetScript` and `dartCompileCommand`, you can also add flags using `dartCompileFlags` or `dartJitFlags`. Dart supports multiple [outputs types](https://dart.dev/tools/dart-compile#types-of-output), you can choose between them using `dartOutputType` (defaults to `exe`). If you want to override the binaries path or the source path they come from, you can use `dartEntryPoints`. Outputs that require a runtime will automatically be wrapped with the relevant runtime (`dartaotruntime` for `aot-snapshot`, `dart run` for `jit-snapshot` and `kernel`, `node` for `js`), this can be overridden through `dartRuntimeCommand`. @@ -31,6 +33,7 @@ buildDartApplication rec { }; pubspecLockFile = ./pubspec.lock; + depsListFile = ./deps.json; vendorHash = "sha256-Atm7zfnDambN/BmmUf4BG0yUz/y6xWzf0reDw3Ad41s="; } ``` @@ -39,9 +42,7 @@ buildDartApplication rec { The function `buildFlutterApplication` builds Flutter applications. -The deps.json file must always be provided when packaging in Nixpkgs. It will be generated and printed if the derivation is attempted to be built without one. Alternatively, `autoDepsList` may be set to `true` when outside of Nixpkgs, as it relies on import-from-derivation. - -A `pubspec.lock` file must be available. See the [Dart documentation](#ssec-dart-applications) for more details. +See the [Dart documentation](#ssec-dart-applications) for more details on required files and arguments. ```nix { flutter, fetchFromGitHub }: diff --git a/pkgs/build-support/dart/build-dart-application/default.nix b/pkgs/build-support/dart/build-dart-application/default.nix index 2246c5634d27..6992c79a37ed 100644 --- a/pkgs/build-support/dart/build-dart-application/default.nix +++ b/pkgs/build-support/dart/build-dart-application/default.nix @@ -1,4 +1,4 @@ -{ lib, stdenv, fetchDartDeps, runCommand, writeText, dartHooks, makeWrapper, dart, cacert, nodejs, darwin }: +{ lib, stdenv, callPackage, fetchDartDeps, runCommand, writeText, dartHooks, makeWrapper, dart, cacert, nodejs, darwin, jq }: { pubGetScript ? "dart pub get" @@ -24,6 +24,9 @@ else null , runtimeDependencies ? [ ] +, customPackageOverrides ? { } +, autoDepsList ? false +, depsListFile ? null , pubspecLockFile ? null , vendorHash ? "" , ... @@ -41,37 +44,78 @@ let inherit pubGetScript vendorHash pubspecLockFile; }; inherit (dartHooks.override { inherit dart; }) dartConfigHook dartBuildHook dartInstallHook dartFixupHook; + + baseDerivation = stdenv.mkDerivation (finalAttrs: args // { + inherit pubGetScript dartCompileCommand dartOutputType dartRuntimeCommand + dartCompileFlags dartJitFlags runtimeDependencies; + + dartEntryPoints = + if (dartEntryPoints != null) + then writeText "entrypoints.json" (builtins.toJSON dartEntryPoints) + else null; + + runtimeDependencyLibraryPath = lib.makeLibraryPath finalAttrs.runtimeDependencies; + + nativeBuildInputs = (args.nativeBuildInputs or [ ]) ++ [ + dart + dartDeps + dartConfigHook + dartBuildHook + dartInstallHook + dartFixupHook + makeWrapper + jq + ] ++ lib.optionals stdenv.isDarwin [ + darwin.sigtool + ]; + + preUnpack = '' + ${lib.optionalString (!autoDepsList) '' + if ! { [ '${lib.boolToString (depsListFile != null)}' = 'true' ] ${lib.optionalString (depsListFile != null) "&& cmp -s <(jq -Sc . '${depsListFile}') <(jq -Sc . '${finalAttrs.passthru.dartDeps.depsListFile}')"}; }; then + echo 1>&2 -e '\nThe dependency list file was either not given or differs from the expected result.' \ + '\nPlease choose one of the following solutions:' \ + '\n - Duplicate the following file and pass it to the depsListFile argument.' \ + '\n ${finalAttrs.passthru.dartDeps.depsListFile}' \ + '\n - Set autoDepsList to true (not supported by Hydra or permitted in Nixpkgs)'. + exit 1 + fi + ''} + ${args.preUnpack or ""} + ''; + + # When stripping, it seems some ELF information is lost and the dart VM cli + # runs instead of the expected program. Don't strip if it's an exe output. + dontStrip = args.dontStrip or (dartOutputType == "exe"); + + passthru = { inherit dartDeps; } // (args.passthru or { }); + + meta = (args.meta or { }) // { platforms = args.meta.platforms or dart.meta.platforms; }; + }); + + packageOverrideRepository = (callPackage ../../../development/compilers/dart/package-overrides { }) // customPackageOverrides; + productPackages = builtins.filter (package: package.kind != "dev") + (if autoDepsList + then lib.importJSON dartDeps.depsListFile + else + if depsListFile == null + then [ ] + else lib.importJSON depsListFile); in assert !(builtins.isString dartOutputType && dartOutputType != "") -> throw "dartOutputType must be a non-empty string"; -stdenv.mkDerivation (args // { - inherit pubGetScript dartCompileCommand dartOutputType dartRuntimeCommand - dartCompileFlags dartJitFlags runtimeDependencies; - - dartEntryPoints = - if (dartEntryPoints != null) - then writeText "entrypoints.json" (builtins.toJSON dartEntryPoints) - else null; - - runtimeDependencyLibraryPath = lib.makeLibraryPath runtimeDependencies; - - nativeBuildInputs = (args.nativeBuildInputs or [ ]) ++ [ - dart - dartDeps - dartConfigHook - dartBuildHook - dartInstallHook - dartFixupHook - makeWrapper - ] ++ lib.optionals stdenv.isDarwin [ - darwin.sigtool - ]; - - # When stripping, it seems some ELF information is lost and the dart VM cli - # runs instead of the expected program. Don't strip if it's an exe output. - dontStrip = args.dontStrip or (dartOutputType == "exe"); - - passthru = { inherit dartDeps; } // (args.passthru or { }); - - meta = (args.meta or { }) // { platforms = args.meta.platforms or dart.meta.platforms; }; -}) +builtins.foldl' + (prev: package: + if packageOverrideRepository ? ${package.name} + then + prev.overrideAttrs + (packageOverrideRepository.${package.name} { + inherit (package) + name + version + kind + source + dependencies; + }) + else prev) + baseDerivation + productPackages diff --git a/pkgs/development/compilers/dart/package-overrides/default.nix b/pkgs/development/compilers/dart/package-overrides/default.nix new file mode 100644 index 000000000000..a7237fe1cfa1 --- /dev/null +++ b/pkgs/development/compilers/dart/package-overrides/default.nix @@ -0,0 +1,3 @@ +{ callPackage }: + +{ } diff --git a/pkgs/development/tools/misc/dart-sass/default.nix b/pkgs/development/tools/misc/dart-sass/default.nix index a137f5b21ba6..6737e791f952 100644 --- a/pkgs/development/tools/misc/dart-sass/default.nix +++ b/pkgs/development/tools/misc/dart-sass/default.nix @@ -29,6 +29,7 @@ buildDartApplication rec { }; pubspecLockFile = ./pubspec.lock; + depsListFile = ./deps.json; vendorHash = "sha256-PQvY+qFXovSXH5wuc60wCrt5RiooKcaGKYzbjKSvqso="; nativeBuildInputs = [ diff --git a/pkgs/development/tools/misc/dart-sass/deps.json b/pkgs/development/tools/misc/dart-sass/deps.json new file mode 100644 index 000000000000..75548f50d900 --- /dev/null +++ b/pkgs/development/tools/misc/dart-sass/deps.json @@ -0,0 +1,930 @@ +[ + { + "name": "sass", + "version": "1.69.0", + "kind": "root", + "source": "root", + "dependencies": [ + "args", + "async", + "charcode", + "cli_pkg", + "cli_repl", + "collection", + "http", + "js", + "meta", + "native_synchronization", + "node_interop", + "package_config", + "path", + "pool", + "protobuf", + "pub_semver", + "source_maps", + "source_span", + "stack_trace", + "stream_channel", + "stream_transform", + "string_scanner", + "term_glyph", + "typed_data", + "watcher", + "analyzer", + "archive", + "crypto", + "dart_style", + "dartdoc", + "grinder", + "node_preamble", + "lints", + "protoc_plugin", + "pub_api_client", + "pubspec_parse", + "test", + "test_descriptor", + "test_process", + "yaml", + "cli_util" + ] + }, + { + "name": "cli_util", + "version": "0.4.0", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "meta", + "path" + ] + }, + { + "name": "path", + "version": "1.8.3", + "kind": "direct", + "source": "hosted", + "dependencies": [] + }, + { + "name": "meta", + "version": "1.10.0", + "kind": "direct", + "source": "hosted", + "dependencies": [] + }, + { + "name": "yaml", + "version": "3.1.2", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "collection", + "source_span", + "string_scanner" + ] + }, + { + "name": "string_scanner", + "version": "1.2.0", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "source_span" + ] + }, + { + "name": "source_span", + "version": "1.10.0", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "collection", + "path", + "term_glyph" + ] + }, + { + "name": "term_glyph", + "version": "1.2.1", + "kind": "direct", + "source": "hosted", + "dependencies": [] + }, + { + "name": "collection", + "version": "1.18.0", + "kind": "direct", + "source": "hosted", + "dependencies": [] + }, + { + "name": "test_process", + "version": "2.1.0", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "async", + "meta", + "path", + "test" + ] + }, + { + "name": "test", + "version": "1.24.6", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "analyzer", + "async", + "boolean_selector", + "collection", + "coverage", + "http_multi_server", + "io", + "js", + "matcher", + "node_preamble", + "package_config", + "path", + "pool", + "shelf", + "shelf_packages_handler", + "shelf_static", + "shelf_web_socket", + "source_span", + "stack_trace", + "stream_channel", + "test_api", + "test_core", + "typed_data", + "web_socket_channel", + "webkit_inspection_protocol", + "yaml" + ] + }, + { + "name": "webkit_inspection_protocol", + "version": "1.2.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "logging" + ] + }, + { + "name": "logging", + "version": "1.2.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "web_socket_channel", + "version": "2.4.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "crypto", + "stream_channel" + ] + }, + { + "name": "stream_channel", + "version": "2.1.2", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "async" + ] + }, + { + "name": "async", + "version": "2.11.0", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "collection", + "meta" + ] + }, + { + "name": "crypto", + "version": "3.0.3", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "typed_data" + ] + }, + { + "name": "typed_data", + "version": "1.3.2", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "collection" + ] + }, + { + "name": "test_core", + "version": "0.5.6", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "analyzer", + "args", + "async", + "boolean_selector", + "collection", + "coverage", + "frontend_server_client", + "glob", + "io", + "meta", + "package_config", + "path", + "pool", + "source_map_stack_trace", + "source_maps", + "source_span", + "stack_trace", + "stream_channel", + "test_api", + "vm_service", + "yaml" + ] + }, + { + "name": "vm_service", + "version": "11.10.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "test_api", + "version": "0.6.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "boolean_selector", + "collection", + "meta", + "source_span", + "stack_trace", + "stream_channel", + "string_scanner", + "term_glyph" + ] + }, + { + "name": "stack_trace", + "version": "1.11.1", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "path" + ] + }, + { + "name": "boolean_selector", + "version": "2.1.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "source_span", + "string_scanner" + ] + }, + { + "name": "source_maps", + "version": "0.10.12", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "source_span" + ] + }, + { + "name": "source_map_stack_trace", + "version": "2.1.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "path", + "source_maps", + "stack_trace" + ] + }, + { + "name": "pool", + "version": "1.5.1", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "async", + "stack_trace" + ] + }, + { + "name": "package_config", + "version": "2.1.0", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "path" + ] + }, + { + "name": "io", + "version": "1.0.4", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "meta", + "path", + "string_scanner" + ] + }, + { + "name": "glob", + "version": "2.1.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "collection", + "file", + "path", + "string_scanner" + ] + }, + { + "name": "file", + "version": "7.0.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "meta", + "path" + ] + }, + { + "name": "frontend_server_client", + "version": "3.2.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "path" + ] + }, + { + "name": "coverage", + "version": "1.6.3", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "args", + "logging", + "package_config", + "path", + "source_maps", + "stack_trace", + "vm_service" + ] + }, + { + "name": "args", + "version": "2.4.2", + "kind": "direct", + "source": "hosted", + "dependencies": [] + }, + { + "name": "analyzer", + "version": "5.13.0", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "_fe_analyzer_shared", + "collection", + "convert", + "crypto", + "glob", + "meta", + "package_config", + "path", + "pub_semver", + "source_span", + "watcher", + "yaml" + ] + }, + { + "name": "watcher", + "version": "1.1.0", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "async", + "path" + ] + }, + { + "name": "pub_semver", + "version": "2.1.4", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "collection", + "meta" + ] + }, + { + "name": "convert", + "version": "3.1.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "typed_data" + ] + }, + { + "name": "_fe_analyzer_shared", + "version": "61.0.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "meta" + ] + }, + { + "name": "shelf_web_socket", + "version": "1.0.4", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "shelf", + "stream_channel", + "web_socket_channel" + ] + }, + { + "name": "shelf", + "version": "1.4.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "collection", + "http_parser", + "path", + "stack_trace", + "stream_channel" + ] + }, + { + "name": "http_parser", + "version": "4.0.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection", + "source_span", + "string_scanner", + "typed_data" + ] + }, + { + "name": "shelf_static", + "version": "1.1.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "convert", + "http_parser", + "mime", + "path", + "shelf" + ] + }, + { + "name": "mime", + "version": "1.0.4", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "shelf_packages_handler", + "version": "3.0.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "path", + "shelf", + "shelf_static" + ] + }, + { + "name": "node_preamble", + "version": "2.0.2", + "kind": "dev", + "source": "hosted", + "dependencies": [] + }, + { + "name": "matcher", + "version": "0.12.16", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "meta", + "stack_trace", + "term_glyph", + "test_api" + ] + }, + { + "name": "js", + "version": "0.6.7", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "meta" + ] + }, + { + "name": "http_multi_server", + "version": "3.2.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async" + ] + }, + { + "name": "test_descriptor", + "version": "2.0.1", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "async", + "collection", + "matcher", + "meta", + "path", + "term_glyph", + "test" + ] + }, + { + "name": "pubspec_parse", + "version": "1.2.3", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "checked_yaml", + "collection", + "json_annotation", + "pub_semver", + "yaml" + ] + }, + { + "name": "json_annotation", + "version": "4.8.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "meta" + ] + }, + { + "name": "checked_yaml", + "version": "2.0.3", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "json_annotation", + "source_span", + "yaml" + ] + }, + { + "name": "pub_api_client", + "version": "2.6.0", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "collection", + "http", + "oauth2", + "path", + "pubspec" + ] + }, + { + "name": "pubspec", + "version": "2.3.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "path", + "pub_semver", + "yaml", + "uri" + ] + }, + { + "name": "uri", + "version": "1.0.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "matcher", + "quiver" + ] + }, + { + "name": "quiver", + "version": "3.2.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "matcher" + ] + }, + { + "name": "oauth2", + "version": "2.0.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection", + "crypto", + "http", + "http_parser" + ] + }, + { + "name": "http", + "version": "1.1.0", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "async", + "http_parser", + "meta" + ] + }, + { + "name": "protoc_plugin", + "version": "21.1.1", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "fixnum", + "path", + "protobuf" + ] + }, + { + "name": "protobuf", + "version": "3.1.0", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "collection", + "fixnum", + "meta" + ] + }, + { + "name": "fixnum", + "version": "1.1.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "lints", + "version": "2.1.1", + "kind": "dev", + "source": "hosted", + "dependencies": [] + }, + { + "name": "grinder", + "version": "0.9.4", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "cli_util", + "glob", + "meta", + "path", + "collection" + ] + }, + { + "name": "dartdoc", + "version": "6.3.0", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "analyzer", + "args", + "cli_util", + "collection", + "crypto", + "glob", + "html", + "logging", + "markdown", + "meta", + "package_config", + "path", + "pub_semver", + "source_span", + "yaml" + ] + }, + { + "name": "markdown", + "version": "7.1.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "args", + "meta" + ] + }, + { + "name": "html", + "version": "0.15.4", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "csslib", + "source_span" + ] + }, + { + "name": "csslib", + "version": "1.0.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "source_span" + ] + }, + { + "name": "dart_style", + "version": "2.3.2", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "analyzer", + "args", + "path", + "pub_semver", + "source_span" + ] + }, + { + "name": "archive", + "version": "3.3.9", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "crypto", + "path", + "pointycastle" + ] + }, + { + "name": "pointycastle", + "version": "3.7.3", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection", + "convert", + "js" + ] + }, + { + "name": "stream_transform", + "version": "2.1.0", + "kind": "direct", + "source": "hosted", + "dependencies": [] + }, + { + "name": "node_interop", + "version": "2.1.0", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "js" + ] + }, + { + "name": "native_synchronization", + "version": "0.2.0", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "ffi" + ] + }, + { + "name": "ffi", + "version": "2.1.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "cli_repl", + "version": "0.2.3", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "async", + "js" + ] + }, + { + "name": "cli_pkg", + "version": "2.5.0", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "archive", + "async", + "charcode", + "cli_util", + "collection", + "crypto", + "glob", + "grinder", + "http", + "js", + "meta", + "node_interop", + "node_preamble", + "package_config", + "path", + "pool", + "pub_semver", + "pubspec_parse", + "retry", + "string_scanner", + "test", + "test_process", + "xml", + "yaml" + ] + }, + { + "name": "xml", + "version": "6.4.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection", + "meta", + "petitparser" + ] + }, + { + "name": "petitparser", + "version": "6.0.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "meta" + ] + }, + { + "name": "retry", + "version": "3.1.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "charcode", + "version": "1.3.1", + "kind": "direct", + "source": "hosted", + "dependencies": [] + } +] diff --git a/pkgs/development/tools/protoc-gen-dart/default.nix b/pkgs/development/tools/protoc-gen-dart/default.nix index 29892b954fc7..fa11e1b60e80 100644 --- a/pkgs/development/tools/protoc-gen-dart/default.nix +++ b/pkgs/development/tools/protoc-gen-dart/default.nix @@ -16,6 +16,7 @@ buildDartApplication rec { sourceRoot = "${src.name}/protoc_plugin"; pubspecLockFile = ./pubspec.lock; + depsListFile = ./deps.json; vendorHash = "sha256-yNgQLCLDCbA07v9tIwPRks/xPAzLVykNtIk+8C0twYM="; meta = with lib; { diff --git a/pkgs/development/tools/protoc-gen-dart/deps.json b/pkgs/development/tools/protoc-gen-dart/deps.json new file mode 100644 index 000000000000..c00a66e0d849 --- /dev/null +++ b/pkgs/development/tools/protoc-gen-dart/deps.json @@ -0,0 +1,549 @@ +[ + { + "name": "protoc_plugin", + "version": "21.1.0", + "kind": "root", + "source": "root", + "dependencies": [ + "fixnum", + "path", + "protobuf", + "collection", + "dart_flutter_team_lints", + "matcher", + "test" + ] + }, + { + "name": "test", + "version": "1.24.6", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "analyzer", + "async", + "boolean_selector", + "collection", + "coverage", + "http_multi_server", + "io", + "js", + "matcher", + "node_preamble", + "package_config", + "path", + "pool", + "shelf", + "shelf_packages_handler", + "shelf_static", + "shelf_web_socket", + "source_span", + "stack_trace", + "stream_channel", + "test_api", + "test_core", + "typed_data", + "web_socket_channel", + "webkit_inspection_protocol", + "yaml" + ] + }, + { + "name": "yaml", + "version": "3.1.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection", + "source_span", + "string_scanner" + ] + }, + { + "name": "string_scanner", + "version": "1.2.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "source_span" + ] + }, + { + "name": "source_span", + "version": "1.10.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection", + "path", + "term_glyph" + ] + }, + { + "name": "term_glyph", + "version": "1.2.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "path", + "version": "1.8.3", + "kind": "direct", + "source": "hosted", + "dependencies": [] + }, + { + "name": "collection", + "version": "1.18.0", + "kind": "dev", + "source": "hosted", + "dependencies": [] + }, + { + "name": "webkit_inspection_protocol", + "version": "1.2.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "logging" + ] + }, + { + "name": "logging", + "version": "1.2.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "web_socket_channel", + "version": "2.4.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "crypto", + "stream_channel" + ] + }, + { + "name": "stream_channel", + "version": "2.1.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async" + ] + }, + { + "name": "async", + "version": "2.11.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection", + "meta" + ] + }, + { + "name": "meta", + "version": "1.9.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "crypto", + "version": "3.0.3", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "typed_data" + ] + }, + { + "name": "typed_data", + "version": "1.3.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection" + ] + }, + { + "name": "test_core", + "version": "0.5.6", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "analyzer", + "args", + "async", + "boolean_selector", + "collection", + "coverage", + "frontend_server_client", + "glob", + "io", + "meta", + "package_config", + "path", + "pool", + "source_map_stack_trace", + "source_maps", + "source_span", + "stack_trace", + "stream_channel", + "test_api", + "vm_service", + "yaml" + ] + }, + { + "name": "vm_service", + "version": "11.10.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "test_api", + "version": "0.6.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "boolean_selector", + "collection", + "meta", + "source_span", + "stack_trace", + "stream_channel", + "string_scanner", + "term_glyph" + ] + }, + { + "name": "stack_trace", + "version": "1.11.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "path" + ] + }, + { + "name": "boolean_selector", + "version": "2.1.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "source_span", + "string_scanner" + ] + }, + { + "name": "source_maps", + "version": "0.10.12", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "source_span" + ] + }, + { + "name": "source_map_stack_trace", + "version": "2.1.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "path", + "source_maps", + "stack_trace" + ] + }, + { + "name": "pool", + "version": "1.5.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "stack_trace" + ] + }, + { + "name": "package_config", + "version": "2.1.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "path" + ] + }, + { + "name": "io", + "version": "1.0.4", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "meta", + "path", + "string_scanner" + ] + }, + { + "name": "glob", + "version": "2.1.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "collection", + "file", + "path", + "string_scanner" + ] + }, + { + "name": "file", + "version": "7.0.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "meta", + "path" + ] + }, + { + "name": "frontend_server_client", + "version": "3.2.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "path" + ] + }, + { + "name": "coverage", + "version": "1.6.3", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "args", + "logging", + "package_config", + "path", + "source_maps", + "stack_trace", + "vm_service" + ] + }, + { + "name": "args", + "version": "2.4.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "analyzer", + "version": "6.2.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "_fe_analyzer_shared", + "collection", + "convert", + "crypto", + "glob", + "meta", + "package_config", + "path", + "pub_semver", + "source_span", + "watcher", + "yaml" + ] + }, + { + "name": "watcher", + "version": "1.1.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "path" + ] + }, + { + "name": "pub_semver", + "version": "2.1.4", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection", + "meta" + ] + }, + { + "name": "convert", + "version": "3.1.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "typed_data" + ] + }, + { + "name": "_fe_analyzer_shared", + "version": "64.0.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "meta" + ] + }, + { + "name": "shelf_web_socket", + "version": "1.0.4", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "shelf", + "stream_channel", + "web_socket_channel" + ] + }, + { + "name": "shelf", + "version": "1.4.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "collection", + "http_parser", + "path", + "stack_trace", + "stream_channel" + ] + }, + { + "name": "http_parser", + "version": "4.0.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection", + "source_span", + "string_scanner", + "typed_data" + ] + }, + { + "name": "shelf_static", + "version": "1.1.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "convert", + "http_parser", + "mime", + "path", + "shelf" + ] + }, + { + "name": "mime", + "version": "1.0.4", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "shelf_packages_handler", + "version": "3.0.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "path", + "shelf", + "shelf_static" + ] + }, + { + "name": "node_preamble", + "version": "2.0.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "matcher", + "version": "0.12.16", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "async", + "meta", + "stack_trace", + "term_glyph", + "test_api" + ] + }, + { + "name": "js", + "version": "0.6.7", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "meta" + ] + }, + { + "name": "http_multi_server", + "version": "3.2.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async" + ] + }, + { + "name": "dart_flutter_team_lints", + "version": "1.0.0", + "kind": "dev", + "source": "hosted", + "dependencies": [ + "lints" + ] + }, + { + "name": "lints", + "version": "2.1.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "protobuf", + "version": "3.1.0", + "kind": "direct", + "source": "path", + "dependencies": [ + "collection", + "fixnum", + "meta" + ] + }, + { + "name": "fixnum", + "version": "1.1.0", + "kind": "direct", + "source": "hosted", + "dependencies": [] + } +] diff --git a/pkgs/tools/misc/domine/default.nix b/pkgs/tools/misc/domine/default.nix index cd62b9bd1a74..421b49a9d4a4 100644 --- a/pkgs/tools/misc/domine/default.nix +++ b/pkgs/tools/misc/domine/default.nix @@ -12,6 +12,6 @@ buildDartApplication rec { }; pubspecLockFile = ./pubspec.lock; - + depsListFile = ./deps.json; vendorHash = "16z3paq1nxlnzs20qlljnwa2ff6xfhdqzcq8d8izkl7w1j4hyxgn"; } diff --git a/pkgs/tools/misc/domine/deps.json b/pkgs/tools/misc/domine/deps.json new file mode 100644 index 000000000000..baa466f5e2f2 --- /dev/null +++ b/pkgs/tools/misc/domine/deps.json @@ -0,0 +1,190 @@ +[ + { + "name": "domine", + "version": "1.1.0+3", + "kind": "root", + "source": "root", + "dependencies": [ + "args", + "dart_openai", + "dio", + "dio_smart_retry", + "tint", + "lints" + ] + }, + { + "name": "lints", + "version": "2.1.1", + "kind": "dev", + "source": "hosted", + "dependencies": [] + }, + { + "name": "tint", + "version": "2.0.1", + "kind": "direct", + "source": "hosted", + "dependencies": [] + }, + { + "name": "dio_smart_retry", + "version": "5.0.0", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "dio", + "http_parser", + "path" + ] + }, + { + "name": "path", + "version": "1.8.3", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "http_parser", + "version": "4.0.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection", + "source_span", + "string_scanner", + "typed_data" + ] + }, + { + "name": "typed_data", + "version": "1.3.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection" + ] + }, + { + "name": "collection", + "version": "1.17.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "string_scanner", + "version": "1.2.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "source_span" + ] + }, + { + "name": "source_span", + "version": "1.10.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection", + "path", + "term_glyph" + ] + }, + { + "name": "term_glyph", + "version": "1.2.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "dio", + "version": "5.3.2", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "async", + "http_parser", + "meta", + "path" + ] + }, + { + "name": "meta", + "version": "1.9.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [] + }, + { + "name": "async", + "version": "2.11.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "collection", + "meta" + ] + }, + { + "name": "dart_openai", + "version": "4.0.0", + "kind": "direct", + "source": "hosted", + "dependencies": [ + "http", + "meta", + "collection", + "fetch_client" + ] + }, + { + "name": "fetch_client", + "version": "1.0.2", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "fetch_api", + "http" + ] + }, + { + "name": "http", + "version": "1.1.0", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "async", + "http_parser", + "meta" + ] + }, + { + "name": "fetch_api", + "version": "1.0.1", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "js" + ] + }, + { + "name": "js", + "version": "0.6.7", + "kind": "transitive", + "source": "hosted", + "dependencies": [ + "meta" + ] + }, + { + "name": "args", + "version": "2.4.2", + "kind": "direct", + "source": "hosted", + "dependencies": [] + } +] From 9079318a9a29cefa7e74718c2b7552629bbd69d6 Mon Sep 17 00:00:00 2001 From: John Garcia Date: Thu, 28 Sep 2023 21:20:34 +0100 Subject: [PATCH 160/222] codebraid: 0.5.0 -> 0.11.0 --- pkgs/tools/misc/codebraid/default.nix | 8 +++++--- 1 file changed, 5 insertions(+), 3 deletions(-) diff --git a/pkgs/tools/misc/codebraid/default.nix b/pkgs/tools/misc/codebraid/default.nix index 0ecde80c238d..f4d8fa4940f0 100644 --- a/pkgs/tools/misc/codebraid/default.nix +++ b/pkgs/tools/misc/codebraid/default.nix @@ -2,15 +2,17 @@ python3Packages.buildPythonApplication rec { pname = "codebraid"; - version = "0.5.0-unstable-2020-08-14"; + version = "0.11.0"; + format = "pyproject"; src = fetchFromGitHub { owner = "gpoore"; repo = pname; - rev = "526a223c4fc32c37d6c5c9133524dfa0e1811ca4"; - sha256 = "0qkqaj49k584qzgx9jlsf5vlv4lq7x403s1kig8v87i0kgh55p56"; + rev = "v${version}"; + hash = "sha256-E9vzGK9ZEVwF+UBpSkdM+hm6vINen/A+LgnnPpc77QQ="; }; + nativeBuildInputs = with python3Packages; [ setuptools ]; propagatedBuildInputs = with python3Packages; [ bespon ]; # unfortunately upstream doesn't contain tests checkPhase = '' From af47e214ceb04979bdd33750334d229d845f8845 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 11:36:39 +0000 Subject: [PATCH 161/222] cargo-codspeed: 2.2.0 -> 2.3.0 --- pkgs/development/tools/rust/cargo-codspeed/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/development/tools/rust/cargo-codspeed/default.nix b/pkgs/development/tools/rust/cargo-codspeed/default.nix index f2a9376e2fa3..d27f17bfac2f 100644 --- a/pkgs/development/tools/rust/cargo-codspeed/default.nix +++ b/pkgs/development/tools/rust/cargo-codspeed/default.nix @@ -12,16 +12,16 @@ rustPlatform.buildRustPackage rec { pname = "cargo-codspeed"; - version = "2.2.0"; + version = "2.3.0"; src = fetchFromGitHub { owner = "CodSpeedHQ"; repo = "codspeed-rust"; rev = "v${version}"; - hash = "sha256-AGbo38weLBPxkaXgJpi+FXGuhPh7nyZcJOhw6BCDYOc="; + hash = "sha256-oI6IfKvX+Zn3tYPXQVxHRQymVz4bBvXfg3mcrjClbY4="; }; - cargoHash = "sha256-NR+Z5oMaReEOZrLk7d/pB1F37k8tE7FXh4HdVnh+YFc="; + cargoHash = "sha256-ZZhYmyWoqZ8SbRpXCA5XsKCdeqAKAcE1NdNlrHhBiYI="; nativeBuildInputs = [ curl From 3e6c2c196e4ea6f2e58fb18968523c2a37bd5f07 Mon Sep 17 00:00:00 2001 From: Raito Bezarius Date: Sat, 21 Oct 2023 12:47:24 +0200 Subject: [PATCH 162/222] tpm2-totp: init at 0.3.0 --- pkgs/by-name/tp/tpm2-totp/package.nix | 46 +++++++++++++++++++++++++++ 1 file changed, 46 insertions(+) create mode 100644 pkgs/by-name/tp/tpm2-totp/package.nix diff --git a/pkgs/by-name/tp/tpm2-totp/package.nix b/pkgs/by-name/tp/tpm2-totp/package.nix new file mode 100644 index 000000000000..766c6e138af6 --- /dev/null +++ b/pkgs/by-name/tp/tpm2-totp/package.nix @@ -0,0 +1,46 @@ +{ lib +, stdenv +, fetchFromGitHub +, tpm2-tss +, autoreconfHook +, autoconf-archive +, pkg-config +, qrencode +}: + +stdenv.mkDerivation rec { + pname = "tpm2-totp"; + version = "0.3.0"; + + src = fetchFromGitHub { + owner = "tpm2-software"; + repo = "tpm2-totp"; + rev = "v${version}"; + hash = "sha256-aeWhI2GQcWa0xAqlmHfcbCMg78UqcD6eanLlEVNVnRM="; + }; + + preConfigure = '' + echo '0.3.0' > VERSION + ''; + + nativeBuildInputs = [ + autoreconfHook + autoconf-archive + pkg-config + ]; + + buildInputs = [ + tpm2-tss + qrencode + ]; + + meta = with lib; { + description = "Attest the trustworthiness of a device against a human using time-based one-time passwords"; + homepage = "https://github.com/tpm2-software/tpm2-totp"; + changelog = "https://github.com/tpm2-software/tpm2-totp/blob/${src.rev}/CHANGELOG.md"; + license = licenses.bsd3; + mainProgram = "tpm2-totp"; + platforms = platforms.all; + maintainers = with maintainers; [ raitobezarius ]; + }; +} From 5391c0204e54b0d1852415108f20ad316f20cdaf Mon Sep 17 00:00:00 2001 From: hacker1024 Date: Sat, 21 Oct 2023 22:37:01 +1100 Subject: [PATCH 163/222] buildDartApplication: Allow passing a `sdkSetupScript` --- .../dart/build-dart-application/default.nix | 9 +++++---- .../build-dart-application/hooks/dart-config-hook.sh | 3 +++ 2 files changed, 8 insertions(+), 4 deletions(-) diff --git a/pkgs/build-support/dart/build-dart-application/default.nix b/pkgs/build-support/dart/build-dart-application/default.nix index 6992c79a37ed..7920a3d61a7a 100644 --- a/pkgs/build-support/dart/build-dart-application/default.nix +++ b/pkgs/build-support/dart/build-dart-application/default.nix @@ -1,6 +1,7 @@ { lib, stdenv, callPackage, fetchDartDeps, runCommand, writeText, dartHooks, makeWrapper, dart, cacert, nodejs, darwin, jq }: -{ pubGetScript ? "dart pub get" +{ sdkSetupScript ? "" +, pubGetScript ? "dart pub get" # Output type to produce. Can be any kind supported by dart # https://dart.dev/tools/dart-compile#types-of-output @@ -41,13 +42,13 @@ let ''; }) { buildDrvArgs = args; - inherit pubGetScript vendorHash pubspecLockFile; + inherit sdkSetupScript pubGetScript vendorHash pubspecLockFile; }; inherit (dartHooks.override { inherit dart; }) dartConfigHook dartBuildHook dartInstallHook dartFixupHook; baseDerivation = stdenv.mkDerivation (finalAttrs: args // { - inherit pubGetScript dartCompileCommand dartOutputType dartRuntimeCommand - dartCompileFlags dartJitFlags runtimeDependencies; + inherit sdkSetupScript pubGetScript dartCompileCommand dartOutputType + dartRuntimeCommand dartCompileFlags dartJitFlags runtimeDependencies; dartEntryPoints = if (dartEntryPoints != null) diff --git a/pkgs/build-support/dart/build-dart-application/hooks/dart-config-hook.sh b/pkgs/build-support/dart/build-dart-application/hooks/dart-config-hook.sh index 3e901995237d..f22d7d2ce64d 100644 --- a/pkgs/build-support/dart/build-dart-application/hooks/dart-config-hook.sh +++ b/pkgs/build-support/dart/build-dart-application/hooks/dart-config-hook.sh @@ -3,6 +3,9 @@ dartConfigHook() { echo "Executing dartConfigHook" + echo "Setting up SDK" + eval "$sdkSetupScript" + echo "Installing dependencies" eval doPubGet "$pubGetScript" --offline From be1484aa1a980c5ab776be6fd62685de8498b584 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Sandro=20J=C3=A4ckel?= Date: Wed, 18 Oct 2023 17:54:16 +0200 Subject: [PATCH 164/222] ArchiSteamFarm: 5.4.9.3 -> 5.4.11.4 --- .../applications/misc/ArchiSteamFarm/default.nix | 5 +++-- pkgs/applications/misc/ArchiSteamFarm/deps.nix | 16 ++++++++-------- .../misc/ArchiSteamFarm/web-ui/default.nix | 8 ++++---- 3 files changed, 15 insertions(+), 14 deletions(-) diff --git a/pkgs/applications/misc/ArchiSteamFarm/default.nix b/pkgs/applications/misc/ArchiSteamFarm/default.nix index 60b835c719b5..aceb02d5c1db 100644 --- a/pkgs/applications/misc/ArchiSteamFarm/default.nix +++ b/pkgs/applications/misc/ArchiSteamFarm/default.nix @@ -11,13 +11,13 @@ buildDotnetModule rec { pname = "ArchiSteamFarm"; # nixpkgs-update: no auto update - version = "5.4.9.3"; + version = "5.4.11.4"; src = fetchFromGitHub { owner = "JustArchiNET"; repo = "ArchiSteamFarm"; rev = version; - hash = "sha256-Yp8hnMIeV+ZHY6yISJdFd1yAQipQsU5vcXgxFDvkGnA="; + hash = "sha256-wgCpUuJ7Xd+M+YLvywSW/sCQG3SfQtHBX1XJTJVVoI8="; }; dotnet-runtime = dotnetCorePackages.aspnetcore_7_0; @@ -77,6 +77,7 @@ buildDotnetModule rec { homepage = "https://github.com/JustArchiNET/ArchiSteamFarm"; license = licenses.asl20; platforms = [ "x86_64-linux" "aarch64-linux" ]; + mainProgram = "ArchiSteamFarm"; maintainers = with maintainers; [ SuperSandro2000 lom ]; }; } diff --git a/pkgs/applications/misc/ArchiSteamFarm/deps.nix b/pkgs/applications/misc/ArchiSteamFarm/deps.nix index 5d353bfdf6b8..01707970a5c2 100644 --- a/pkgs/applications/misc/ArchiSteamFarm/deps.nix +++ b/pkgs/applications/misc/ArchiSteamFarm/deps.nix @@ -57,11 +57,11 @@ (fetchNuGet { pname = "Humanizer.Core.zh-Hans"; version = "2.14.1"; sha256 = "0zn99311zfn602phxyskfjq9vly0w5712z6fly8r4q0h94qa8c85"; }) (fetchNuGet { pname = "Humanizer.Core.zh-Hant"; version = "2.14.1"; sha256 = "0qxjnbdj645l5sd6y3100yyrq1jy5misswg6xcch06x8jv7zaw1p"; }) (fetchNuGet { pname = "JetBrains.Annotations"; version = "2023.2.0"; sha256 = "0nx7nrzbg9gk9skdc9x330cbr5xbsly6z9gzxm46vywf55yp8vaj"; }) - (fetchNuGet { pname = "Markdig.Signed"; version = "0.32.0"; sha256 = "0rc1d8pwypq44pr15wn8g52zbqz70swdrdmjlzccf6zvwy1vyqkc"; }) + (fetchNuGet { pname = "Markdig.Signed"; version = "0.33.0"; sha256 = "0816lmn0varxwhdklhh5hdqp0xnfz3nlrvaf2wpkk5v1mq86216h"; }) (fetchNuGet { pname = "Microsoft.AspNetCore.JsonPatch"; version = "7.0.0"; sha256 = "1f13vsfs1rp9bmdp3khk4mk2fif932d72yxm2wszpsr239x4s2bf"; }) (fetchNuGet { pname = "Microsoft.AspNetCore.Mvc.NewtonsoftJson"; version = "7.0.0"; sha256 = "1w49rg0n5wb1m5wnays2mmym7qy7bsi2b1zxz97af2rkbw3s3hbd"; }) (fetchNuGet { pname = "Microsoft.Bcl.AsyncInterfaces"; version = "6.0.0"; sha256 = "15gqy2m14fdlvy1g59207h5kisznm355kbw010gy19vh47z8gpz3"; }) - (fetchNuGet { pname = "Microsoft.CodeCoverage"; version = "17.7.0"; sha256 = "12m9fay2d7jvj00hfpws37vflpqvz4dy4gcm25bjycg1zyfpzvly"; }) + (fetchNuGet { pname = "Microsoft.CodeCoverage"; version = "17.7.2"; sha256 = "09mf5kpxn1a1m8ciwklhh6ascx0yqpcs5r2hvmfj80j44n3qrwhm"; }) (fetchNuGet { pname = "Microsoft.CSharp"; version = "4.7.0"; sha256 = "0gd67zlw554j098kabg887b5a6pq9kzavpa3jjy5w53ccjzjfy8j"; }) (fetchNuGet { pname = "Microsoft.Extensions.ApiDescription.Server"; version = "6.0.5"; sha256 = "1pi2bm3cm0a7jzqzmfc2r7bpcdkmk3hhjfvb2c81j7wl7xdw3624"; }) (fetchNuGet { pname = "Microsoft.Extensions.Configuration.Abstractions"; version = "6.0.0"; sha256 = "0w6wwxv12nbc3sghvr68847wc9skkdgsicrz3fx4chgng1i3xy0j"; }) @@ -71,11 +71,11 @@ (fetchNuGet { pname = "Microsoft.Extensions.Logging.Abstractions"; version = "6.0.0"; sha256 = "0b75fmins171zi6bfdcq1kcvyrirs8n91mknjnxy4c3ygi1rrnj0"; }) (fetchNuGet { pname = "Microsoft.Extensions.Options"; version = "6.0.0"; sha256 = "008pnk2p50i594ahz308v81a41mbjz9mwcarqhmrjpl2d20c868g"; }) (fetchNuGet { pname = "Microsoft.Extensions.Primitives"; version = "6.0.0"; sha256 = "1kjiw6s4yfz9gm7mx3wkhp06ghnbs95icj9hi505shz9rjrg42q2"; }) - (fetchNuGet { pname = "Microsoft.NET.Test.Sdk"; version = "17.7.0"; sha256 = "1srhqqmnf9pxdbpffr7dh0bihhf09d0iq5g6gh8ql7brfrh99lvb"; }) + (fetchNuGet { pname = "Microsoft.NET.Test.Sdk"; version = "17.7.2"; sha256 = "08g9dpp766racnh90s1sy3ncl291majgq6v2604hfw1f6zkmbjqh"; }) (fetchNuGet { pname = "Microsoft.NETCore.Platforms"; version = "5.0.0"; sha256 = "0mwpwdflidzgzfx2dlpkvvnkgkr2ayaf0s80737h4wa35gaj11rc"; }) (fetchNuGet { pname = "Microsoft.OpenApi"; version = "1.2.3"; sha256 = "07b19k89whj69j87afkz86gp9b3iybw8jqwvlgcn43m7fb2y99rr"; }) - (fetchNuGet { pname = "Microsoft.TestPlatform.ObjectModel"; version = "17.7.0"; sha256 = "1sqmk99644fx66zk2qa2ims1zl6741i3wl4rjh4z6jakd4xbc28i"; }) - (fetchNuGet { pname = "Microsoft.TestPlatform.TestHost"; version = "17.7.0"; sha256 = "1s8ap0ljqssbqp1ilgsidjr948b9szf1cbl3fgl6smxig9im4zrl"; }) + (fetchNuGet { pname = "Microsoft.TestPlatform.ObjectModel"; version = "17.7.2"; sha256 = "0xdjkdnrvnaxqgg38y5w1l3jbppigg68cc8q9jn0p21vn48bgrxq"; }) + (fetchNuGet { pname = "Microsoft.TestPlatform.TestHost"; version = "17.7.2"; sha256 = "1szsg1iy77f0caxzkk0ihpp4ifbfnbdbn8k0wbbhbdprxj8pr356"; }) (fetchNuGet { pname = "Microsoft.Win32.Registry"; version = "5.0.0"; sha256 = "102hvhq2gmlcbq8y2cb7hdr2dnmjzfp2k3asr1ycwrfacwyaak7n"; }) (fetchNuGet { pname = "MSTest.TestAdapter"; version = "3.1.1"; sha256 = "0y3ic8jv5jhld6gan2qfa2wyk4z57f7y4y5a47njr0jvxxnarg2c"; }) (fetchNuGet { pname = "MSTest.TestFramework"; version = "3.1.1"; sha256 = "1lbgkrbrkmw4c54g61cwbmwc4zl8hyqmp283ymvj93lq7chbxasn"; }) @@ -86,9 +86,9 @@ (fetchNuGet { pname = "Nito.AsyncEx.Tasks"; version = "5.1.2"; sha256 = "11wp47kc69sjdxrbg5pgx0wlffqlp0x5kr54ggnz2v19kmjz362v"; }) (fetchNuGet { pname = "Nito.Collections.Deque"; version = "1.1.1"; sha256 = "152564q3s0n5swfv5p5rx0ghn2sm0g2xsnbd7gv8vb9yfklv7yg8"; }) (fetchNuGet { pname = "Nito.Disposables"; version = "2.2.1"; sha256 = "1hx5k8497j34kxxgh060bvij0vfnraw90dmm3h9bmamcdi8wp80l"; }) - (fetchNuGet { pname = "NLog"; version = "5.2.3"; sha256 = "0srai3s2kk9y2jimdvw1xw86nch38q6nza598dpr81dghx3s6j6w"; }) - (fetchNuGet { pname = "NLog.Extensions.Logging"; version = "5.3.3"; sha256 = "0j19fljxbcc0bysmj7i0fmiax6sp5kjapf2llkimv7dh63rj9ckg"; }) - (fetchNuGet { pname = "NLog.Web.AspNetCore"; version = "5.3.3"; sha256 = "0rhha2lwrzwlx0q1a8w9ph9xwayl3kmmy200ygsghcd02srlazkj"; }) + (fetchNuGet { pname = "NLog"; version = "5.2.5"; sha256 = "02fybqi9d7czz3jmhmgb8wia2hpjj5hmcnij6zsgs69rkv6hf9j0"; }) + (fetchNuGet { pname = "NLog.Extensions.Logging"; version = "5.3.5"; sha256 = "0jzfqa12l5vvxd2j684cnm29w19v386cpm11pw8h6prpf57affaj"; }) + (fetchNuGet { pname = "NLog.Web.AspNetCore"; version = "5.3.5"; sha256 = "0li0sw04w0a4zms5jjv1ga45wxiqlcvaw8gi0wbhiifrdzz5yckb"; }) (fetchNuGet { pname = "NuGet.Frameworks"; version = "6.5.0"; sha256 = "0s37d1p4md0k6d4cy6sq36f2dgkd9qfbzapxhkvi8awwh0vrynhj"; }) (fetchNuGet { pname = "protobuf-net"; version = "3.2.16"; sha256 = "0pwlqlq2p8my2sr8b0cvdav5cm8wpwf3s4gy7s1ba701ac2zyb9y"; }) (fetchNuGet { pname = "protobuf-net.Core"; version = "3.2.16"; sha256 = "00znhikq7valr3jaxg66cwli9hf75wkmmpf6rf8p790hf8lxq0c5"; }) diff --git a/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix b/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix index 77f4e9c6e299..ca10ef3e3ce8 100644 --- a/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix +++ b/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix @@ -1,4 +1,4 @@ -{ lib, fetchFromGitHub, buildNpmPackage, nodePackages, ArchiSteamFarm }: +{ lib, fetchFromGitHub, buildNpmPackage, ArchiSteamFarm }: buildNpmPackage { pname = "asf-ui"; @@ -9,11 +9,11 @@ buildNpmPackage { repo = "ASF-ui"; # updated by the update script # this is always the commit that should be used with asf-ui from the latest asf version - rev = "0b812a7ab0d2f01a675d27f80008ad7b6972b4aa"; - hash = "sha256-ut0x/qT3DyDASW4QbNT+BF6eXHCIbTol5E+3+tirFDA="; + rev = "1d748b6ea01cc2ed7eebb32b4e8f990d8ff5c7d7"; + hash = "sha256-fb6fiZOnQeYzasL/NqCtTQTNOhdmIMG0mymaQ9zKQko="; }; - npmDepsHash = "sha256-HpBEoAIGejpHJnUciz4iWILcXdgpw7X1xFuXmx9Z9dw="; + npmDepsHash = "sha256-xbGSmorPytbsjmcGOnGOYXWryMIwCPJ/ksMkSgSfJWY="; installPhase = '' runHook preInstall From b11e3eb7d178db4c39482434b3b98562b26d8b14 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Sandro=20J=C3=A4ckel?= Date: Wed, 18 Oct 2023 18:01:35 +0200 Subject: [PATCH 165/222] nixos/asf: update hardening options to match upstream --- nixos/modules/services/games/asf.nix | 22 +++++++++++++++++----- 1 file changed, 17 insertions(+), 5 deletions(-) diff --git a/nixos/modules/services/games/asf.nix b/nixos/modules/services/games/asf.nix index f15d7077d965..432de6336ce2 100644 --- a/nixos/modules/services/games/asf.nix +++ b/nixos/modules/services/games/asf.nix @@ -187,29 +187,41 @@ in Group = "asf"; WorkingDirectory = cfg.dataDir; Type = "simple"; - ExecStart = "${cfg.package}/bin/ArchiSteamFarm --path ${cfg.dataDir} --process-required --no-restart --service --no-config-migrate"; + ExecStart = "${lib.getExe cfg.package} --no-restart --process-required --service --system-required --path ${cfg.dataDir}"; Restart = "always"; - # mostly copied from the default systemd service - PrivateTmp = true; + # copied from the default systemd service at + # https://github.com/JustArchiNET/ArchiSteamFarm/blob/main/ArchiSteamFarm/overlay/variant-base/linux/ArchiSteamFarm%40.service + CapabilityBoundingSet = ""; + DevicePolicy = "closed"; LockPersonality = true; + NoNewPrivileges = true; PrivateDevices = true; PrivateIPC = true; PrivateMounts = true; + PrivateTmp = true; # instead of rw /tmp PrivateUsers = true; + ProcSubset = "pid"; ProtectClock = true; ProtectControlGroups = true; + ProtectHome = true; ProtectHostname = true; ProtectKernelLogs = true; ProtectKernelModules = true; ProtectKernelTunables = true; ProtectProc = "invisible"; - ProtectSystem = "full"; + ProtectSystem = "strict"; RemoveIPC = true; - RestrictAddressFamilies = "AF_INET AF_INET6"; + RestrictAddressFamilies = "AF_INET AF_INET6 AF_NETLINK AF_UNIX"; RestrictNamespaces = true; RestrictRealtime = true; RestrictSUIDSGID = true; + SystemCallArchitectures = "native"; + UMask = "0077"; + + # we luckily already have systemd v247+ + SecureBits = "noroot-locked"; + SystemCallFilter = [ "@system-service" "~@privileged" ]; } ]; From c781bd7a53cf38594292e310a22e14a565d8a746 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Sandro=20J=C3=A4ckel?= Date: Fri, 20 Oct 2023 16:33:36 +0200 Subject: [PATCH 166/222] ArchiSteamFarm: 5.4.11.4 -> 5.4.12.3, fix update script for web-ui --- .../applications/misc/ArchiSteamFarm/default.nix | 4 ++-- pkgs/applications/misc/ArchiSteamFarm/deps.nix | 5 +++++ pkgs/applications/misc/ArchiSteamFarm/update.sh | 8 ++++---- .../misc/ArchiSteamFarm/web-ui/.gitignore | 1 + .../misc/ArchiSteamFarm/web-ui/default.nix | 10 +++++----- .../misc/ArchiSteamFarm/web-ui/update.sh | 16 ++++++---------- 6 files changed, 23 insertions(+), 21 deletions(-) create mode 100644 pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore diff --git a/pkgs/applications/misc/ArchiSteamFarm/default.nix b/pkgs/applications/misc/ArchiSteamFarm/default.nix index aceb02d5c1db..1a0e90546bec 100644 --- a/pkgs/applications/misc/ArchiSteamFarm/default.nix +++ b/pkgs/applications/misc/ArchiSteamFarm/default.nix @@ -11,13 +11,13 @@ buildDotnetModule rec { pname = "ArchiSteamFarm"; # nixpkgs-update: no auto update - version = "5.4.11.4"; + version = "5.4.12.5"; src = fetchFromGitHub { owner = "JustArchiNET"; repo = "ArchiSteamFarm"; rev = version; - hash = "sha256-wgCpUuJ7Xd+M+YLvywSW/sCQG3SfQtHBX1XJTJVVoI8="; + hash = "sha256-iIYA9BnHUfsB4J7VbSLKaRdJHMW/xULJxKfv8atfAd8="; }; dotnet-runtime = dotnetCorePackages.aspnetcore_7_0; diff --git a/pkgs/applications/misc/ArchiSteamFarm/deps.nix b/pkgs/applications/misc/ArchiSteamFarm/deps.nix index 01707970a5c2..6154d1ca6e2d 100644 --- a/pkgs/applications/misc/ArchiSteamFarm/deps.nix +++ b/pkgs/applications/misc/ArchiSteamFarm/deps.nix @@ -71,6 +71,10 @@ (fetchNuGet { pname = "Microsoft.Extensions.Logging.Abstractions"; version = "6.0.0"; sha256 = "0b75fmins171zi6bfdcq1kcvyrirs8n91mknjnxy4c3ygi1rrnj0"; }) (fetchNuGet { pname = "Microsoft.Extensions.Options"; version = "6.0.0"; sha256 = "008pnk2p50i594ahz308v81a41mbjz9mwcarqhmrjpl2d20c868g"; }) (fetchNuGet { pname = "Microsoft.Extensions.Primitives"; version = "6.0.0"; sha256 = "1kjiw6s4yfz9gm7mx3wkhp06ghnbs95icj9hi505shz9rjrg42q2"; }) + (fetchNuGet { pname = "Microsoft.IdentityModel.Abstractions"; version = "7.0.3"; sha256 = "0njmg2lygnirnfjv9gck2f5lq4ly5rgws9cpf8qj3kwcwxfp0b9s"; }) + (fetchNuGet { pname = "Microsoft.IdentityModel.JsonWebTokens"; version = "7.0.3"; sha256 = "1ayh85xqdq8rqjk2iqcn7iaczcl7d8qg6bxk0b4rgx59fmsmbqj7"; }) + (fetchNuGet { pname = "Microsoft.IdentityModel.Logging"; version = "7.0.3"; sha256 = "13cjqmf59k895q6gkd5ycl89mnpalckda7rhsdl11jdyr32hsfnv"; }) + (fetchNuGet { pname = "Microsoft.IdentityModel.Tokens"; version = "7.0.3"; sha256 = "1pmhd0imh9wlhvbvvwjrpjsqvzagi2ly22nddwr4r0pi234khyz1"; }) (fetchNuGet { pname = "Microsoft.NET.Test.Sdk"; version = "17.7.2"; sha256 = "08g9dpp766racnh90s1sy3ncl291majgq6v2604hfw1f6zkmbjqh"; }) (fetchNuGet { pname = "Microsoft.NETCore.Platforms"; version = "5.0.0"; sha256 = "0mwpwdflidzgzfx2dlpkvvnkgkr2ayaf0s80737h4wa35gaj11rc"; }) (fetchNuGet { pname = "Microsoft.OpenApi"; version = "1.2.3"; sha256 = "07b19k89whj69j87afkz86gp9b3iybw8jqwvlgcn43m7fb2y99rr"; }) @@ -108,6 +112,7 @@ (fetchNuGet { pname = "System.Composition.Runtime"; version = "7.0.0"; sha256 = "1p9xpqzx42s8cdizv6nh15hcjvl2km0rwby66nfkj4cb472l339s"; }) (fetchNuGet { pname = "System.Composition.TypedParts"; version = "7.0.0"; sha256 = "0syz7y6wgnxxgjvfqgymn9mnaa5fjy1qp06qnsvh3agr9mvcv779"; }) (fetchNuGet { pname = "System.Diagnostics.DiagnosticSource"; version = "6.0.0"; sha256 = "0rrihs9lnb1h6x4h0hn6kgfnh58qq7hx8qq99gh6fayx4dcnx3s5"; }) + (fetchNuGet { pname = "System.IdentityModel.Tokens.Jwt"; version = "7.0.3"; sha256 = "1fls88ffq34j1gr6zay1crm27v3sjs5fa4mvj9akqjq05bxanlhk"; }) (fetchNuGet { pname = "System.Linq.Async"; version = "6.0.1"; sha256 = "10ira8hmv0i54yp9ggrrdm1c06j538sijfjpn1kmnh9j2xk5yzmq"; }) (fetchNuGet { pname = "System.Reflection.Metadata"; version = "1.6.0"; sha256 = "1wdbavrrkajy7qbdblpbpbalbdl48q3h34cchz24gvdgyrlf15r4"; }) (fetchNuGet { pname = "System.Runtime.CompilerServices.Unsafe"; version = "6.0.0"; sha256 = "0qm741kh4rh57wky16sq4m0v05fxmkjjr87krycf5vp9f0zbahbc"; }) diff --git a/pkgs/applications/misc/ArchiSteamFarm/update.sh b/pkgs/applications/misc/ArchiSteamFarm/update.sh index 9af9acb69835..53d3ee664191 100755 --- a/pkgs/applications/misc/ArchiSteamFarm/update.sh +++ b/pkgs/applications/misc/ArchiSteamFarm/update.sh @@ -1,5 +1,5 @@ #!/usr/bin/env nix-shell -#!nix-shell -I nixpkgs=./. -i bash -p curl gnused jq common-updater-scripts nix-prefetch prefetch-npm-deps +#!nix-shell -I nixpkgs=./. -i bash -p curl gnused jq common-updater-scripts set -euo pipefail cd "$(dirname "${BASH_SOURCE[0]}")" @@ -14,7 +14,7 @@ if [[ "$new_version" == "$old_version" ]]; then fi asf_path=$PWD -pushd ../../../.. +cd ../../../.. if [[ "${1:-}" != "--deps-only" ]]; then update-source-version ArchiSteamFarm "$new_version" @@ -22,5 +22,5 @@ fi $(nix-build -A ArchiSteamFarm.fetch-deps --no-out-link) -popd -"$asf_path/web-ui/update.sh" +cd "$asf_path/web-ui" +./update.sh diff --git a/pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore b/pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore new file mode 100644 index 000000000000..d8b83df9cdb6 --- /dev/null +++ b/pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore @@ -0,0 +1 @@ +package-lock.json diff --git a/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix b/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix index ca10ef3e3ce8..4dad0b1f5b6b 100644 --- a/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix +++ b/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix @@ -1,19 +1,19 @@ { lib, fetchFromGitHub, buildNpmPackage, ArchiSteamFarm }: -buildNpmPackage { +buildNpmPackage rec { pname = "asf-ui"; - inherit (ArchiSteamFarm) version; + version = "fceb2fb828cfa420c77dc5cde433fd519a6717d4"; src = fetchFromGitHub { owner = "JustArchiNET"; repo = "ASF-ui"; # updated by the update script # this is always the commit that should be used with asf-ui from the latest asf version - rev = "1d748b6ea01cc2ed7eebb32b4e8f990d8ff5c7d7"; - hash = "sha256-fb6fiZOnQeYzasL/NqCtTQTNOhdmIMG0mymaQ9zKQko="; + rev = version; + hash = "sha256-gMQWly7HN5rIV9r72Qa+gHuBuQMs9sh09od4ja4sRGU="; }; - npmDepsHash = "sha256-xbGSmorPytbsjmcGOnGOYXWryMIwCPJ/ksMkSgSfJWY="; + npmDepsHash = "sha256-UDCQTRpcPDcuvPzlqTu315EkGr5G0+z7qMSsPgYQacA="; installPhase = '' runHook preInstall diff --git a/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh b/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh index 7f026383383d..6fa8e67a1217 100755 --- a/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh +++ b/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh @@ -1,23 +1,19 @@ #!/usr/bin/env nix-shell -#! nix-shell -I nixpkgs=../../../.. -i bash -p nodePackages.node2nix gnused jq curl +#! nix-shell -I nixpkgs=../../../../.. -i bash -p curl gnused jq common-updater-scripts prefetch-npm-deps set -eou pipefail -cd "$(dirname "$0")" -pushd ../../../../.. +cd "$(dirname "$0")"/../../../../.. version=$(nix-instantiate --strict --eval -A ArchiSteamFarm.version | jq -r) -popd -pushd "$(dirname "$0")" +cd - ui=$(curl ${GITHUB_TOKEN:+" -u \":$GITHUB_TOKEN\""} "https://api.github.com/repos/JustArchiNET/ArchiSteamFarm/contents/ASF-ui?ref=$version" | jq -r .sha) curl "https://raw.githubusercontent.com/JustArchiNET/ASF-ui/$ui/package-lock.json" -o package-lock.json -# update-source-version doesn't work for some reason -sed -i "s/rev\\s*=\\s*.*/rev = \"$ui\";/" default.nix -sed -i "s/hash\\s*=\\s*.*/hash = \"$(nix-prefetch fetchurl --url "https://github.com/JustArchiNET/ASF-ui/archive/$ui.tar.gz")\";/" default.nix +cd - +update-source-version ArchiSteamFarm.ui "$ui" +cd - npmDepsHash=$(prefetch-npm-deps ./package-lock.json) sed -E 's#\bnpmDepsHash = ".*?"#npmDepsHash = "'"$npmDepsHash"'"#' -i default.nix rm package-lock.json - -popd From 046c7199a6c1b2d40edbad017a920270e3edd378 Mon Sep 17 00:00:00 2001 From: Mikael Fangel <34864484+MikaelFangel@users.noreply.github.com> Date: Fri, 20 Oct 2023 22:35:57 +0200 Subject: [PATCH 167/222] pulsar: mark vulnerable to multiple CVE's --- pkgs/applications/editors/pulsar/default.nix | 9 +++++++++ 1 file changed, 9 insertions(+) diff --git a/pkgs/applications/editors/pulsar/default.nix b/pkgs/applications/editors/pulsar/default.nix index d2162dc9c9ef..ef08ac9352dd 100644 --- a/pkgs/applications/editors/pulsar/default.nix +++ b/pkgs/applications/editors/pulsar/default.nix @@ -209,5 +209,14 @@ stdenv.mkDerivation rec { license = licenses.mit; platforms = platforms.linux; maintainers = with maintainers; [ colamaroro ]; + knownVulnerabilities = [ + "CVE-2023-5217" + "CVE-2022-21718" + "CVE-2022-29247" + "CVE-2022-29257" + "CVE-2022-36077" + "CVE-2023-29198" + "CVE-2023-39956" + ]; }; } From 9684dfef6d116be2a8e7bd2f6fd2ac95fea17d05 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 12:06:43 +0000 Subject: [PATCH 168/222] eks-node-viewer: 0.4.3 -> 0.5.0 --- .../networking/cluster/eks-node-viewer/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/applications/networking/cluster/eks-node-viewer/default.nix b/pkgs/applications/networking/cluster/eks-node-viewer/default.nix index b4f9ce722e79..80538f0f111c 100644 --- a/pkgs/applications/networking/cluster/eks-node-viewer/default.nix +++ b/pkgs/applications/networking/cluster/eks-node-viewer/default.nix @@ -2,16 +2,16 @@ buildGoModule rec { pname = "eks-node-viewer"; - version = "0.4.3"; + version = "0.5.0"; src = fetchFromGitHub { owner = "awslabs"; repo = pname; rev = "v${version}"; - sha256 = "sha256-570wOLUtKKzDDLLDrAOPAnAUpZeAqrwKsQWoHCBjKKk="; + sha256 = "sha256-kfX9BzARDWUOBIu67j60K38uwkRELxd/gXtEHOHAXS8="; }; - vendorHash = "sha256-kRRUaA/psQDmcM1ZhzdZE3eyw8DWZpesJVA2zVfORGk="; + vendorHash = "sha256-7axI7R8cTntc1IcOwVPmPj8MHeIvhbnkYKQdqu5fZOU="; ldflags = [ "-s" From f25029b7ea641b9f18c6e73077e03bfba37894e8 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 12:07:36 +0000 Subject: [PATCH 169/222] libunarr: 1.1.0 -> 1.1.1 --- pkgs/development/libraries/libunarr/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/libraries/libunarr/default.nix b/pkgs/development/libraries/libunarr/default.nix index 1feafabfd4df..c1e0881bf3ff 100644 --- a/pkgs/development/libraries/libunarr/default.nix +++ b/pkgs/development/libraries/libunarr/default.nix @@ -6,11 +6,11 @@ stdenv.mkDerivation rec { pname = "libunarr"; - version = "1.1.0"; + version = "1.1.1"; src = fetchurl { url = "https://github.com/selmf/unarr/releases/download/v${version}/unarr-${version}.tar.xz"; - hash = "sha256-5wCnhjoj+GTmaeDTCrUnm1Wt9SsWAbQcPSYM//FNeOA="; + hash = "sha256-Mo76BOqZbdOJFrEkeozxdqwpuFyvkhdONNMZmN5BdNI="; }; postPatch = lib.optionalString stdenv.isDarwin '' From 9b6a9a3ea7ba5d44256c3dc43f4bb23d7747f527 Mon Sep 17 00:00:00 2001 From: Marc Jakobi Date: Sat, 21 Oct 2023 14:28:54 +0200 Subject: [PATCH 170/222] luaPackages.ferris.nvim: init at 2.0.0 --- maintainers/scripts/luarocks-packages.csv | 1 + .../lua-modules/generated-packages.nix | 24 +++++++++++++++++++ 2 files changed, 25 insertions(+) diff --git a/maintainers/scripts/luarocks-packages.csv b/maintainers/scripts/luarocks-packages.csv index 5897948a9f83..f03ef4fa09c9 100644 --- a/maintainers/scripts/luarocks-packages.csv +++ b/maintainers/scripts/luarocks-packages.csv @@ -16,6 +16,7 @@ cyrussasl,https://github.com/JorjBauer/lua-cyrussasl.git,,,,, digestif,https://github.com/astoff/digestif.git,,,0.2-1,5.3, dkjson,,,,,, fennel,,,,,,misterio77 +ferris.nvim,,,,,,mrcjkb fifo,,,,,, fluent,,,,,,alerque gitsigns.nvim,https://github.com/lewis6991/gitsigns.nvim.git,,,,5.1, diff --git a/pkgs/development/lua-modules/generated-packages.nix b/pkgs/development/lua-modules/generated-packages.nix index 636c411acca4..f344bd948515 100644 --- a/pkgs/development/lua-modules/generated-packages.nix +++ b/pkgs/development/lua-modules/generated-packages.nix @@ -478,6 +478,30 @@ buildLuarocksPackage { }; }) {}; +ferris-nvim = callPackage({ fetchzip, buildLuarocksPackage, lua, luaOlder }: +buildLuarocksPackage { + pname = "ferris.nvim"; + version = "2.0.0-1"; + knownRockspec = (fetchurl { + url = "mirror://luarocks/ferris.nvim-2.0.0-1.rockspec"; + sha256 = "00d3x2hbs8625ky50r2w08c6idcx3bkrk0rks5qd8yh7v61nj53h"; + }).outPath; + src = fetchzip { + url = "https://github.com/mrcjkb/ferris.nvim/archive/2.0.0.zip"; + sha256 = "1fb18k0ylb06h4ifs9k6lfc42y74xpavzwkqy55lfdkmlbc7jmhy"; + }; + + disabled = (luaOlder "5.1"); + propagatedBuildInputs = [ lua ]; + + meta = { + homepage = "https://github.com/mrcjkb/ferris.nvim"; + description = "Supercharge your Rust experience in Neovim! A heavily modified fork of rust-tools.nvim"; + maintainers = with lib.maintainers; [ mrcjkb ]; + license.fullName = "GPL-2.0"; + }; +}) {}; + fifo = callPackage({ fetchzip, lua, buildLuarocksPackage }: buildLuarocksPackage { pname = "fifo"; From 011eb16003fefbd387ce4a63d9e9c6703c09c201 Mon Sep 17 00:00:00 2001 From: Patrick Steinhardt Date: Sat, 21 Oct 2023 14:34:29 +0200 Subject: [PATCH 171/222] kodi.packages.youtube: refactor to fetch from GitHub Refactor kodi.packages.youtube to fetch sources from GitHub instead of using the official Kodi addons repository. Newer versions of the addon are not released (yet) on the official addon repository, whereas older versions of the addon don't work properly anymore with YouTube. The only resulting difference between old and new version is an additional README.md file: $ diff -r result-old result-new Only in result-new/share/kodi/addons/plugin.video.youtube: README.md Other than that, this refactoring is a no-op change and will allow us to upgrade the addon to newer versions more readily. --- .../video/kodi/addons/youtube/default.nix | 13 ++++++------- 1 file changed, 6 insertions(+), 7 deletions(-) diff --git a/pkgs/applications/video/kodi/addons/youtube/default.nix b/pkgs/applications/video/kodi/addons/youtube/default.nix index bdc4be3a23fa..50273878b424 100644 --- a/pkgs/applications/video/kodi/addons/youtube/default.nix +++ b/pkgs/applications/video/kodi/addons/youtube/default.nix @@ -1,13 +1,15 @@ -{ lib, buildKodiAddon, fetchzip, addonUpdateScript, six, requests, infotagger, inputstreamhelper }: +{ lib, buildKodiAddon, fetchFromGitHub, six, requests, infotagger, inputstreamhelper }: buildKodiAddon rec { pname = "youtube"; namespace = "plugin.video.youtube"; version = "7.0.1"; - src = fetchzip { - url = "https://mirrors.kodi.tv/addons/nexus/${namespace}/${namespace}-${version}.zip"; - sha256 = "sha256-Wdju7d2kFX0V1J1TB75qEVq0UWN2xYYFNlD8UTt1New="; + src = fetchFromGitHub { + owner = "anxdpanic"; + repo = "plugin.video.youtube"; + rev = "v${version}"; + hash = "sha256-BHCVui+enKFH3elz6DovXMDxMQx/2+/BrIw3KQr9TfE="; }; propagatedBuildInputs = [ @@ -19,9 +21,6 @@ buildKodiAddon rec { passthru = { pythonPath = "resources/lib"; - updateScript = addonUpdateScript { - attrPath = "kodi.packages.youtube"; - }; }; meta = with lib; { From 4b6f568a7a5b3b961ab7807239279d6ebdbb226b Mon Sep 17 00:00:00 2001 From: Patrick Steinhardt Date: Sat, 21 Oct 2023 14:37:47 +0200 Subject: [PATCH 172/222] kodi.packages.youtube: 7.0.1 -> 7.0.2.2 --- pkgs/applications/video/kodi/addons/youtube/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/applications/video/kodi/addons/youtube/default.nix b/pkgs/applications/video/kodi/addons/youtube/default.nix index 50273878b424..3d3683ed8776 100644 --- a/pkgs/applications/video/kodi/addons/youtube/default.nix +++ b/pkgs/applications/video/kodi/addons/youtube/default.nix @@ -3,13 +3,13 @@ buildKodiAddon rec { pname = "youtube"; namespace = "plugin.video.youtube"; - version = "7.0.1"; + version = "7.0.2.2"; src = fetchFromGitHub { owner = "anxdpanic"; repo = "plugin.video.youtube"; rev = "v${version}"; - hash = "sha256-BHCVui+enKFH3elz6DovXMDxMQx/2+/BrIw3KQr9TfE="; + hash = "sha256-BUeE/8oQYBiq4XgIp4nv0hjEQz3nnkDWCnAf4kpptwk="; }; propagatedBuildInputs = [ From 7270bfbe7205911de8ebb2c79fb420e569b91cbe Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 12:38:38 +0000 Subject: [PATCH 173/222] python311Packages.trezor: 0.13.7 -> 0.13.8 --- pkgs/development/python-modules/trezor/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/trezor/default.nix b/pkgs/development/python-modules/trezor/default.nix index 109f48d1f71b..23af30faefba 100644 --- a/pkgs/development/python-modules/trezor/default.nix +++ b/pkgs/development/python-modules/trezor/default.nix @@ -24,13 +24,13 @@ buildPythonPackage rec { pname = "trezor"; - version = "0.13.7"; + version = "0.13.8"; disabled = !isPy3k; src = fetchPypi { inherit pname version; - hash = "sha256-dodeWIYBfclPUbu0Efkn8QO9nj7L8HVNXkSjU4mBSeA="; + hash = "sha256-Y01O3fNWAyV8MhYY2FSMajWyc4Rle2XjsL261jWlfP8="; }; nativeBuildInputs = [ installShellFiles ]; From cf965856d4035050ae81b6c1b1d720eb245bc2d3 Mon Sep 17 00:00:00 2001 From: Marc Jakobi Date: Sat, 21 Oct 2023 14:31:31 +0200 Subject: [PATCH 174/222] vimPlugins.ferris-nvim: init at 2023-10-21 --- pkgs/applications/editors/vim/plugins/generated.nix | 12 ++++++++++++ .../editors/vim/plugins/vim-plugin-names | 1 + 2 files changed, 13 insertions(+) diff --git a/pkgs/applications/editors/vim/plugins/generated.nix b/pkgs/applications/editors/vim/plugins/generated.nix index ecd22ae6102b..a38f9c137edc 100644 --- a/pkgs/applications/editors/vim/plugins/generated.nix +++ b/pkgs/applications/editors/vim/plugins/generated.nix @@ -3333,6 +3333,18 @@ final: prev: meta.homepage = "https://github.com/wincent/ferret/"; }; + ferris-nvim = buildNeovimPlugin { + pname = "ferris.nvim"; + version = "2023-11-21"; + src = fetchFromGitHub { + owner = "mrcjkb"; + repo = "ferris.nvim"; + rev = "54943eaeb0d4534988d2378936052655c988c3c2"; + sha256 = "o4yY4IHYBCnanfy7dx/wGdiPFMLMKZsYrG2SqlPRvdI="; + }; + meta.homepage = "https://github.com/mrcjkb/ferris.nvim/"; + }; + fidget-nvim = buildVimPlugin { pname = "fidget.nvim"; version = "2023-06-10"; diff --git a/pkgs/applications/editors/vim/plugins/vim-plugin-names b/pkgs/applications/editors/vim/plugins/vim-plugin-names index ab353da48e24..828465764408 100644 --- a/pkgs/applications/editors/vim/plugins/vim-plugin-names +++ b/pkgs/applications/editors/vim/plugins/vim-plugin-names @@ -277,6 +277,7 @@ https://github.com/freddiehaddad/feline.nvim/,, https://github.com/bakpakin/fennel.vim/,, https://github.com/lambdalisue/fern.vim/,, https://github.com/wincent/ferret/,, +https://github.com/mrcjkb/ferris.nvim/,HEAD, https://github.com/j-hui/fidget.nvim/,legacy, https://github.com/bogado/file-line/,, https://github.com/glacambre/firenvim/,HEAD, From f7251b58fdfcc21423f60505a2e21c35a83e1309 Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 10:25:00 +0200 Subject: [PATCH 175/222] python311Packages.aioairzone: 0.6.8 -> 0.6.9 Diff: https://github.com/Noltari/aioairzone/compare/refs/tags/0.6.8...0.6.9 Changelog: https://github.com/Noltari/aioairzone/releases/tag/0.6.9 --- pkgs/development/python-modules/aioairzone/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/aioairzone/default.nix b/pkgs/development/python-modules/aioairzone/default.nix index ac094571d087..39c12ac6e2c0 100644 --- a/pkgs/development/python-modules/aioairzone/default.nix +++ b/pkgs/development/python-modules/aioairzone/default.nix @@ -8,7 +8,7 @@ buildPythonPackage rec { pname = "aioairzone"; - version = "0.6.8"; + version = "0.6.9"; format = "pyproject"; disabled = pythonOlder "3.11"; @@ -17,7 +17,7 @@ buildPythonPackage rec { owner = "Noltari"; repo = pname; rev = "refs/tags/${version}"; - hash = "sha256-aCf0IO70t/QMmDmIwBKN3Um1HgHjHn1r6Dze/pWaQ5M="; + hash = "sha256-0nbH0pnTYRuSOkzG5Yn/fJmRKtXBMd6ti6Z+AW72j3Q="; }; nativeBuildInputs = [ From cdabf26e66ce4ef2ef65cc63abb9eab79813cf1d Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sun, 15 Oct 2023 11:46:59 +0200 Subject: [PATCH 176/222] python311Packages.aioesphomeapi: 17.2.0 -> 18.0.7 https://github.com/esphome/aioesphomeapi/releases/tag/v18.0.0 https://github.com/esphome/aioesphomeapi/releases/tag/v18.0.1 https://github.com/esphome/aioesphomeapi/releases/tag/v18.0.2 https://github.com/esphome/aioesphomeapi/releases/tag/v18.0.3 https://github.com/esphome/aioesphomeapi/releases/tag/v18.0.4 https://github.com/esphome/aioesphomeapi/releases/tag/v18.0.5 https://github.com/esphome/aioesphomeapi/releases/tag/v18.0.6 https://github.com/esphome/aioesphomeapi/releases/tag/v18.0.7 https://github.com/esphome/aioesphomeapi/compare/refs/tags/v17.2.0...v18.0.7 Co-Authored-By: Martin Weinelt --- pkgs/development/python-modules/aioesphomeapi/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/aioesphomeapi/default.nix b/pkgs/development/python-modules/aioesphomeapi/default.nix index 79ef028fd36e..c77a4dfadda5 100644 --- a/pkgs/development/python-modules/aioesphomeapi/default.nix +++ b/pkgs/development/python-modules/aioesphomeapi/default.nix @@ -14,7 +14,7 @@ buildPythonPackage rec { pname = "aioesphomeapi"; - version = "17.2.0"; + version = "18.0.7"; format = "setuptools"; disabled = pythonOlder "3.9"; @@ -23,7 +23,7 @@ buildPythonPackage rec { owner = "esphome"; repo = pname; rev = "refs/tags/v${version}"; - hash = "sha256-+yPHIXJ0vHaFO2X3xN+7WIQUlCvoYlGi1N7W+H/ng/0="; + hash = "sha256-Jgu9NEFY74Z0mZ2Cz4uaHG0gfywa2nF/H8G1j9YAyrw="; }; propagatedBuildInputs = [ From 5a758d9d2c801bf0466d57f8d27346934b67fed6 Mon Sep 17 00:00:00 2001 From: Martin Weinelt Date: Sat, 21 Oct 2023 14:41:49 +0200 Subject: [PATCH 177/222] python311Packages.dbus-fast: 2.11.1 -> 2.12.0 https://github.com/Bluetooth-Devices/dbus-fast/releases/tag/v2.12.0 --- pkgs/development/python-modules/dbus-fast/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/dbus-fast/default.nix b/pkgs/development/python-modules/dbus-fast/default.nix index b5d2ce8eef71..4394271f7ebd 100644 --- a/pkgs/development/python-modules/dbus-fast/default.nix +++ b/pkgs/development/python-modules/dbus-fast/default.nix @@ -13,7 +13,7 @@ buildPythonPackage rec { pname = "dbus-fast"; - version = "2.11.1"; + version = "2.12.0"; format = "pyproject"; disabled = pythonOlder "3.7"; @@ -22,7 +22,7 @@ buildPythonPackage rec { owner = "Bluetooth-Devices"; repo = pname; rev = "refs/tags/v${version}"; - hash = "sha256-oYBk+Rko5qK1k2TJdDNiN0rWdx7sdy6UpxMlDynKZ9Y="; + hash = "sha256-ZeDQn+/b6WBCodZ7Ow5IlC9XlWieAifCMJtM1yse5P8="; }; # The project can build both an optimized cython version and an unoptimized From cd22a1098c48833ac5defb6371bdddf496f31f2a Mon Sep 17 00:00:00 2001 From: Martin Weinelt Date: Sat, 21 Oct 2023 14:43:45 +0200 Subject: [PATCH 178/222] python311Packages.velbus-aio: 2023.10.0 -> 2023.10.1 https://github.com/Cereal2nd/velbus-aio/releases/tag/2023.10.1 --- pkgs/development/python-modules/velbus-aio/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/velbus-aio/default.nix b/pkgs/development/python-modules/velbus-aio/default.nix index dda198ff95cc..03c44ef031c0 100644 --- a/pkgs/development/python-modules/velbus-aio/default.nix +++ b/pkgs/development/python-modules/velbus-aio/default.nix @@ -10,7 +10,7 @@ buildPythonPackage rec { pname = "velbus-aio"; - version = "2023.10.0"; + version = "2023.10.1"; format = "setuptools"; disabled = pythonOlder "3.7"; @@ -19,7 +19,7 @@ buildPythonPackage rec { owner = "Cereal2nd"; repo = pname; rev = version; - hash = "sha256-xVELkmucrw1QazSR2XN6ldmzdTya/rWsQd1mRsLTcbU="; + hash = "sha256-v2B+tDqvQTm+K+cvTRM8LnfaFp5CTsI8/B5clBDNE08="; fetchSubmodules = true; }; From 4dcc0ce788a2bfe420e286ff44a761f93945b031 Mon Sep 17 00:00:00 2001 From: Martin Weinelt Date: Sat, 21 Oct 2023 14:42:44 +0200 Subject: [PATCH 179/222] home-assistant: 2023.10.3 -> 2023.10.4 https://github.com/home-assistant/core/releases/tag/2023.10.4 --- pkgs/servers/home-assistant/component-packages.nix | 2 +- pkgs/servers/home-assistant/default.nix | 6 +++--- 2 files changed, 4 insertions(+), 4 deletions(-) diff --git a/pkgs/servers/home-assistant/component-packages.nix b/pkgs/servers/home-assistant/component-packages.nix index 79195bd7152e..7f9efafdfe9a 100644 --- a/pkgs/servers/home-assistant/component-packages.nix +++ b/pkgs/servers/home-assistant/component-packages.nix @@ -2,7 +2,7 @@ # Do not edit! { - version = "2023.10.3"; + version = "2023.10.4"; components = { "3_day_blinds" = ps: with ps; [ ]; diff --git a/pkgs/servers/home-assistant/default.nix b/pkgs/servers/home-assistant/default.nix index 9bc35bd882c9..593099d264af 100644 --- a/pkgs/servers/home-assistant/default.nix +++ b/pkgs/servers/home-assistant/default.nix @@ -296,7 +296,7 @@ let extraBuildInputs = extraPackages python.pkgs; # Don't forget to run parse-requirements.py after updating - hassVersion = "2023.10.3"; + hassVersion = "2023.10.4"; in python.pkgs.buildPythonApplication rec { pname = "homeassistant"; @@ -312,7 +312,7 @@ in python.pkgs.buildPythonApplication rec { # Primary source is the pypi sdist, because it contains translations src = fetchPypi { inherit pname version; - hash = "sha256-7Eg6Ik8eiPPUTXyRedQLixaCnHDg9Dmikmhcq55+458="; + hash = "sha256-HG8Uyk52Bj9CpQ+dn+dbsXVBKakXDlRktG4KSkVVVmE="; }; # Secondary source is git for tests @@ -320,7 +320,7 @@ in python.pkgs.buildPythonApplication rec { owner = "home-assistant"; repo = "core"; rev = "refs/tags/${version}"; - hash = "sha256-4J1BBC6PvfbN4fKD+zUpW19sMvoKALilitNJlwB0ZTk="; + hash = "sha256-m3MjJHFq9S0dogFijIlpryqGQoHpLqkqgkWLuIxLHa8="; }; nativeBuildInputs = with python.pkgs; [ From 862bdb6435579ffd9897beda46e1b9754bbb7956 Mon Sep 17 00:00:00 2001 From: Martin Weinelt Date: Sat, 21 Oct 2023 14:58:36 +0200 Subject: [PATCH 180/222] python311Packages.homeassistant-stubs: 2023.10.1 -> 2023.10.4 https://github.com/KapJI/homeassistant-stubs/releases/tag/2023.10.4 --- pkgs/servers/home-assistant/stubs.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/servers/home-assistant/stubs.nix b/pkgs/servers/home-assistant/stubs.nix index adc7089741e9..a0146829bf2c 100644 --- a/pkgs/servers/home-assistant/stubs.nix +++ b/pkgs/servers/home-assistant/stubs.nix @@ -8,7 +8,7 @@ buildPythonPackage rec { pname = "homeassistant-stubs"; - version = "2023.10.1"; + version = "2023.10.4"; format = "pyproject"; disabled = python.version != home-assistant.python.version; @@ -17,7 +17,7 @@ buildPythonPackage rec { owner = "KapJI"; repo = "homeassistant-stubs"; rev = "refs/tags/${version}"; - hash = "sha256-4TPjYBTyrJtnYVZ+F/Bxf6m0lZn6fQR3ai0+CDTqwVc="; + hash = "sha256-iehGVXom5Wjw7A0PC4wfzed+w1h1/g9SKIuCuVRtIAs="; }; nativeBuildInputs = [ From 21317d93e1f739222c4781dcd5ff520337f72bef Mon Sep 17 00:00:00 2001 From: Martin Weinelt Date: Sat, 21 Oct 2023 14:50:43 +0200 Subject: [PATCH 181/222] python311Packages.bleak: fix bluetoothctl substitution --- pkgs/development/python-modules/bleak/default.nix | 12 ++++++------ 1 file changed, 6 insertions(+), 6 deletions(-) diff --git a/pkgs/development/python-modules/bleak/default.nix b/pkgs/development/python-modules/bleak/default.nix index 61a069305d13..f53f614867ec 100644 --- a/pkgs/development/python-modules/bleak/default.nix +++ b/pkgs/development/python-modules/bleak/default.nix @@ -25,6 +25,12 @@ buildPythonPackage rec { hash = "sha256-T0im8zKyNLbskAEDeUUFS/daJtvttlHlttjscqP8iSk="; }; + postPatch = '' + # bleak checks BlueZ's version with a call to `bluetoothctl --version` + substituteInPlace bleak/backends/bluezdbus/version.py \ + --replace \"bluetoothctl\" \"${bluez}/bin/bluetoothctl\" + ''; + nativeBuildInputs = [ poetry-core ]; @@ -40,12 +46,6 @@ buildPythonPackage rec { pytestCheckHook ]; - postPatch = '' - # bleak checks BlueZ's version with a call to `bluetoothctl --version` - substituteInPlace bleak/backends/bluezdbus/__init__.py \ - --replace \"bluetoothctl\" \"${bluez}/bin/bluetoothctl\" - ''; - pythonImportsCheck = [ "bleak" ]; From becdfbe17c5a2104a9e7e024910c6157b1cd10dd Mon Sep 17 00:00:00 2001 From: hacker1024 Date: Sun, 22 Oct 2023 00:14:42 +1100 Subject: [PATCH 182/222] buildDartApplication: Recognise extraWrapProgramArgs --- .../dart/build-dart-application/default.nix | 1 + .../hooks/dart-fixup-hook.sh | 25 +++++++++++++------ 2 files changed, 19 insertions(+), 7 deletions(-) diff --git a/pkgs/build-support/dart/build-dart-application/default.nix b/pkgs/build-support/dart/build-dart-application/default.nix index 7920a3d61a7a..76328e5645f6 100644 --- a/pkgs/build-support/dart/build-dart-application/default.nix +++ b/pkgs/build-support/dart/build-dart-application/default.nix @@ -25,6 +25,7 @@ else null , runtimeDependencies ? [ ] +, extraWrapProgramArgs ? "" , customPackageOverrides ? { } , autoDepsList ? false , depsListFile ? null diff --git a/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh b/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh index 6e1995aebc13..dd96ab374860 100644 --- a/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh +++ b/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh @@ -3,15 +3,26 @@ dartFixupHook() { echo "Executing dartFixupHook" - echo "Providing runtime dependencies" + declare -a wrapProgramArgs + + # Add runtime library dependencies to the LD_LIBRARY_PATH. + # For some reason, the RUNPATH of the executable is not used to load dynamic libraries in dart:ffi with DynamicLibrary.open(). + # + # This could alternatively be fixed with patchelf --add-needed, but this would cause all the libraries to be opened immediately, + # which is not what application authors expect. + echo "$runtimeDependencyLibraryPath" if [[ ! -z "$runtimeDependencyLibraryPath" ]]; then - # Add runtime library dependencies to the LD_LIBRARY_PATH. - # For some reason, the RUNPATH of the executable is not used to load dynamic libraries in dart:ffi with DynamicLibrary.open(). - # - # This could alternatively be fixed with patchelf --add-needed, but this would cause all the libraries to be opened immediately, - # which is not what application authors expect. + wrapProgramArgs+=(--suffix LD_LIBRARY_PATH : \"$runtimeDependencyLibraryPath\") + fi + + if [[ ! -z "$extraWrapProgramArgs" ]]; then + wrapProgramArgs+=("$extraWrapProgramArgs") + fi + + if [ ${#wrapProgramArgs[@]} -ne 0 ]; then for f in "$out"/bin/*; do - wrapProgram "$f" --suffix LD_LIBRARY_PATH : "$runtimeDependencyLibraryPath" + echo "Wrapping $f..." + eval "wrapProgram \"$f\" ${wrapProgramArgs[@]}" done fi From ed0bddfcf0ab155744204cc99a6fabc04de001c6 Mon Sep 17 00:00:00 2001 From: Alyssa Ross Date: Sat, 21 Oct 2023 11:30:33 +0000 Subject: [PATCH 183/222] erofs-utils.meta.homepage: init --- pkgs/tools/filesystems/erofs-utils/default.nix | 1 + 1 file changed, 1 insertion(+) diff --git a/pkgs/tools/filesystems/erofs-utils/default.nix b/pkgs/tools/filesystems/erofs-utils/default.nix index d1daee70967f..e25df7288094 100644 --- a/pkgs/tools/filesystems/erofs-utils/default.nix +++ b/pkgs/tools/filesystems/erofs-utils/default.nix @@ -30,6 +30,7 @@ stdenv.mkDerivation rec { ] ++ lib.optional fuseSupport "--enable-fuse"; meta = with lib; { + homepage = "https://git.kernel.org/pub/scm/linux/kernel/git/xiang/erofs-utils.git/about/"; description = "Userspace utilities for linux-erofs file system"; license = with licenses; [ gpl2Plus ]; maintainers = with maintainers; [ ehmry nikstur ]; From 6e4796d619a52329db6ae9722a8ce8c4a037bcf1 Mon Sep 17 00:00:00 2001 From: networkException Date: Sat, 21 Oct 2023 12:58:07 +0200 Subject: [PATCH 184/222] chromium,electron: always output sri hashes from update scripts this patch changes the update script to always output sri hashes for all hashes written to chromium's `upstream-info.nix` and electron's `info.json`. the keys have also been renamed from `sha256` to `hash`. --- .../networking/browsers/chromium/update.py | 20 +++++++++---------- pkgs/development/tools/electron/update.py | 2 +- 2 files changed, 11 insertions(+), 11 deletions(-) diff --git a/pkgs/applications/networking/browsers/chromium/update.py b/pkgs/applications/networking/browsers/chromium/update.py index fd8f36778405..60267331cc27 100755 --- a/pkgs/applications/networking/browsers/chromium/update.py +++ b/pkgs/applications/networking/browsers/chromium/update.py @@ -59,9 +59,9 @@ def prefetch_src_sri_hash(attr_path, version): def nix_prefetch_url(url, algo='sha256'): """Prefetches the content of the given URL.""" - print(f'nix-prefetch-url {url}') - out = subprocess.check_output(['nix-prefetch-url', '--type', algo, url]) - return out.decode('utf-8').rstrip() + print(f'nix store prefetch-file {url}') + out = subprocess.check_output(['nix', 'store', 'prefetch-file', '--json', '--hash-type', algo, url]) + return json.loads(out)['hash'] def nix_prefetch_git(url, rev): @@ -96,9 +96,9 @@ def get_chromedriver(channel): return { 'version': channel['version'], - 'sha256_linux': nix_prefetch_url(get_chromedriver_url('linux64')), - 'sha256_darwin': nix_prefetch_url(get_chromedriver_url('mac-x64')), - 'sha256_darwin_aarch64': nix_prefetch_url(get_chromedriver_url('mac-arm64')) + 'hash_linux': nix_prefetch_url(get_chromedriver_url('linux64')), + 'hash_darwin': nix_prefetch_url(get_chromedriver_url('mac-x64')), + 'hash_darwin_aarch64': nix_prefetch_url(get_chromedriver_url('mac-arm64')) } @@ -113,7 +113,7 @@ def get_channel_dependencies(version): 'version': datetime.fromisoformat(gn['date']).date().isoformat(), 'url': gn['url'], 'rev': gn['rev'], - 'sha256': gn['sha256'] + 'hash': gn['hash'] } } @@ -222,11 +222,11 @@ with urlopen(RELEASES_URL) as resp: google_chrome_suffix = channel_name try: - channel['sha256'] = prefetch_src_sri_hash( + channel['hash'] = prefetch_src_sri_hash( channel_name_to_attr_name(channel_name), release["version"] ) - channel['sha256bin64'] = nix_prefetch_url( + channel['hash_deb_amd64'] = nix_prefetch_url( f'{DEB_URL}/google-chrome-{google_chrome_suffix}/' + f'google-chrome-{google_chrome_suffix}_{release["version"]}-1_amd64.deb') except subprocess.CalledProcessError: @@ -241,7 +241,7 @@ with urlopen(RELEASES_URL) as resp: ungoogled_repo_url = 'https://github.com/ungoogled-software/ungoogled-chromium.git' channel['deps']['ungoogled-patches'] = { 'rev': release['ungoogled_tag'], - 'sha256': nix_prefetch_git(ungoogled_repo_url, release['ungoogled_tag'])['sha256'] + 'hash': nix_prefetch_git(ungoogled_repo_url, release['ungoogled_tag'])['hash'] } with open(UNGOOGLED_FLAGS_PATH, 'w') as out: out.write(get_ungoogled_chromium_gn_flags(release['ungoogled_tag'])) diff --git a/pkgs/development/tools/electron/update.py b/pkgs/development/tools/electron/update.py index 1ea11bd5bba9..128b1dc05067 100755 --- a/pkgs/development/tools/electron/update.py +++ b/pkgs/development/tools/electron/update.py @@ -188,7 +188,7 @@ def get_gn_source(repo): "version": datetime.fromisoformat(gn["date"]).date().isoformat(), "url": gn["url"], "rev": gn["rev"], - "sha256": gn["sha256"] + "hash": gn["hash"] } } From f627d8682a70dedc45d9f550fe1c99d35a0bf609 Mon Sep 17 00:00:00 2001 From: Mika Tammi Date: Sat, 21 Oct 2023 16:20:35 +0300 Subject: [PATCH 185/222] openra: add release- prefix to version string (#262324) Change version string to have prefix `release-`. This fixes "Server is running an incompatible version.", when trying to play against official builds of the OpenRA. Signed-off-by: Mika Tammi --- pkgs/games/openra/build-engine.nix | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/pkgs/games/openra/build-engine.nix b/pkgs/games/openra/build-engine.nix index 664a4c0735b3..10e8b4939215 100644 --- a/pkgs/games/openra/build-engine.nix +++ b/pkgs/games/openra/build-engine.nix @@ -36,7 +36,7 @@ buildDotnetModule rec { dontDotnetFixup = true; preBuild = '' - make VERSION=${version} version + make VERSION=${engine.build}-${version} version ''; postInstall = '' From 2addb67a1408441b090e3ba158c8ab19e2ab3dc5 Mon Sep 17 00:00:00 2001 From: hacker1024 Date: Sun, 22 Oct 2023 00:31:58 +1100 Subject: [PATCH 186/222] buildFlutterApplication: Wrap buildDartApplication --- pkgs/build-support/flutter/default.nix | 182 +++++------------- .../dart/package-overrides/default.nix | 7 +- .../flutter-secure-storage-linux/default.nix | 0 .../handy-window/default.nix | 0 .../package-overrides/matrix/default.nix | 0 .../package-overrides/olm/default.nix | 0 .../flutter/package-overrides/default.nix | 8 - 7 files changed, 54 insertions(+), 143 deletions(-) rename pkgs/development/compilers/{flutter => dart}/package-overrides/flutter-secure-storage-linux/default.nix (100%) rename pkgs/development/compilers/{flutter => dart}/package-overrides/handy-window/default.nix (100%) rename pkgs/development/compilers/{flutter => dart}/package-overrides/matrix/default.nix (100%) rename pkgs/development/compilers/{flutter => dart}/package-overrides/olm/default.nix (100%) delete mode 100644 pkgs/development/compilers/flutter/package-overrides/default.nix diff --git a/pkgs/build-support/flutter/default.nix b/pkgs/build-support/flutter/default.nix index a0ed1211ed81..3e136211655b 100644 --- a/pkgs/build-support/flutter/default.nix +++ b/pkgs/build-support/flutter/default.nix @@ -1,34 +1,28 @@ { lib , callPackage -, stdenvNoCC , runCommand , makeWrapper , wrapGAppsHook -, llvmPackages_13 +, fetchDartDeps +, buildDartApplication , cacert , glib , flutter -, jq }: # absolutely no mac support for now { pubGetScript ? "flutter pub get" , flutterBuildFlags ? [ ] -, runtimeDependencies ? [ ] -, customPackageOverrides ? { } -, autoDepsList ? false -, depsListFile ? null -, vendorHash ? "" -, pubspecLockFile ? null -, nativeBuildInputs ? [ ] -, preUnpack ? "" -, postFixup ? "" , extraWrapProgramArgs ? "" , ... }@args: -let - flutterSetupScript = '' + +(buildDartApplication.override { + dart = flutter; + fetchDartDeps = fetchDartDeps.override { dart = flutter; }; +}) (args // { + sdkSetupScript = '' # Pub needs SSL certificates. Dart normally looks in a hardcoded path. # https://github.com/dart-lang/sdk/blob/3.1.0/runtime/bin/security_context_linux.cc#L48 # @@ -54,136 +48,56 @@ let flutter config --enable-linux-desktop >/dev/null ''; - deps = callPackage ../dart/fetch-dart-deps { dart = flutter; } { - sdkSetupScript = flutterSetupScript; - inherit pubGetScript vendorHash pubspecLockFile; - buildDrvArgs = args; - }; + nativeBuildInputs = (args.nativeBuildInputs or [ ]) ++ [ wrapGAppsHook ]; + buildInputs = (args.buildInputs or [ ]) ++ [ glib ]; - baseDerivation = llvmPackages_13.stdenv.mkDerivation (finalAttrs: args // { - inherit flutterBuildFlags runtimeDependencies; + dontDartBuild = true; + buildPhase = args.buildPhase or '' + runHook preBuild - outputs = [ "out" "debug" ]; + mkdir -p build/flutter_assets/fonts - nativeBuildInputs = [ - makeWrapper - deps - flutter - jq - glib - wrapGAppsHook - ] ++ nativeBuildInputs; + doPubGet flutter pub get --offline -v + flutter build linux -v --release --split-debug-info="$debug" ${builtins.concatStringsSep " " (map (flag: "\"${flag}\"") flutterBuildFlags)} - dontWrapGApps = true; + runHook postBuild + ''; - preUnpack = '' - ${lib.optionalString (!autoDepsList) '' - if ! { [ '${lib.boolToString (depsListFile != null)}' = 'true' ] ${lib.optionalString (depsListFile != null) "&& cmp -s <(jq -Sc . '${depsListFile}') <(jq -Sc . '${finalAttrs.passthru.depsListFile}')"}; }; then - echo 1>&2 -e '\nThe dependency list file was either not given or differs from the expected result.' \ - '\nPlease choose one of the following solutions:' \ - '\n - Duplicate the following file and pass it to the depsListFile argument.' \ - '\n ${finalAttrs.passthru.depsListFile}' \ - '\n - Set autoDepsList to true (not supported by Hydra or permitted in Nixpkgs)'. - exit 1 - fi - ''} + dontDartInstall = true; + installPhase = args.installPhase or '' + runHook preInstall - ${preUnpack} - ''; + built=build/linux/*/release/bundle - configurePhase = '' - runHook preConfigure + mkdir -p $out/bin + mv $built $out/app - ${flutterSetupScript} + for f in $(find $out/app -iname "*.desktop" -type f); do + install -D $f $out/share/applications/$(basename $f) + done - runHook postConfigure - ''; + for f in $(find $out/app -maxdepth 1 -type f); do + ln -s $f $out/bin/$(basename $f) + done - buildPhase = '' - runHook preBuild + # make *.so executable + find $out/app -iname "*.so" -type f -exec chmod +x {} + - mkdir -p build/flutter_assets/fonts + # remove stuff like /build/source/packages/ubuntu_desktop_installer/linux/flutter/ephemeral + for f in $(find $out/app -executable -type f); do + if patchelf --print-rpath "$f" | grep /build; then # this ignores static libs (e,g. libapp.so) also + echo "strip RPath of $f" + newrp=$(patchelf --print-rpath $f | sed -r "s|/build.*ephemeral:||g" | sed -r "s|/build.*profile:||g") + patchelf --set-rpath "$newrp" "$f" + fi + done - doPubGet flutter pub get --offline -v - flutter build linux -v --release --split-debug-info="$debug" ${builtins.concatStringsSep " " (map (flag: "\"${flag}\"") finalAttrs.flutterBuildFlags)} + runHook postInstall + ''; - runHook postBuild - ''; - - installPhase = '' - runHook preInstall - - built=build/linux/*/release/bundle - - mkdir -p $out/bin - mv $built $out/app - - for f in $(find $out/app -iname "*.desktop" -type f); do - install -D $f $out/share/applications/$(basename $f) - done - - for f in $(find $out/app -maxdepth 1 -type f); do - ln -s $f $out/bin/$(basename $f) - done - - # make *.so executable - find $out/app -iname "*.so" -type f -exec chmod +x {} + - - # remove stuff like /build/source/packages/ubuntu_desktop_installer/linux/flutter/ephemeral - for f in $(find $out/app -executable -type f); do - if patchelf --print-rpath "$f" | grep /build; then # this ignores static libs (e,g. libapp.so) also - echo "strip RPath of $f" - newrp=$(patchelf --print-rpath $f | sed -r "s|/build.*ephemeral:||g" | sed -r "s|/build.*profile:||g") - patchelf --set-rpath "$newrp" "$f" - fi - done - - runHook postInstall - ''; - - postFixup = '' - # Add runtime library dependencies to the LD_LIBRARY_PATH. - # For some reason, the RUNPATH of the executable is not used to load dynamic libraries in dart:ffi with DynamicLibrary.open(). - # - # This could alternatively be fixed with patchelf --add-needed, but this would cause all the libraries to be opened immediately, - # which is not what application authors expect. - for f in "$out"/bin/*; do - wrapProgram "$f" \ - --suffix LD_LIBRARY_PATH : '${lib.makeLibraryPath finalAttrs.runtimeDependencies}' \ - ''${gappsWrapperArgs[@]} \ - ${extraWrapProgramArgs} - done - - ${postFixup} - ''; - - passthru = (args.passthru or {}) // { - inherit (deps) depsListFile; - }; - }); - - packageOverrideRepository = (callPackage ../../development/compilers/flutter/package-overrides { }) // customPackageOverrides; - productPackages = builtins.filter (package: package.kind != "dev") - (if autoDepsList - then lib.importJSON deps.depsListFile - else - if depsListFile == null - then [ ] - else lib.importJSON depsListFile); -in -builtins.foldl' - (prev: package: - if packageOverrideRepository ? ${package.name} - then - prev.overrideAttrs - (packageOverrideRepository.${package.name} { - inherit (package) - name - version - kind - source - dependencies; - }) - else prev) - baseDerivation - productPackages + dontWrapGApps = true; + extraWrapProgramArgs = '' + ''${gappsWrapperArgs[@]} \ + ${extraWrapProgramArgs} + ''; +}) diff --git a/pkgs/development/compilers/dart/package-overrides/default.nix b/pkgs/development/compilers/dart/package-overrides/default.nix index a7237fe1cfa1..c162929e336a 100644 --- a/pkgs/development/compilers/dart/package-overrides/default.nix +++ b/pkgs/development/compilers/dart/package-overrides/default.nix @@ -1,3 +1,8 @@ { callPackage }: -{ } +{ + flutter_secure_storage_linux = callPackage ./flutter-secure-storage-linux { }; + handy_window = callPackage ./handy-window { }; + matrix = callPackage ./matrix { }; + olm = callPackage ./olm { }; +} diff --git a/pkgs/development/compilers/flutter/package-overrides/flutter-secure-storage-linux/default.nix b/pkgs/development/compilers/dart/package-overrides/flutter-secure-storage-linux/default.nix similarity index 100% rename from pkgs/development/compilers/flutter/package-overrides/flutter-secure-storage-linux/default.nix rename to pkgs/development/compilers/dart/package-overrides/flutter-secure-storage-linux/default.nix diff --git a/pkgs/development/compilers/flutter/package-overrides/handy-window/default.nix b/pkgs/development/compilers/dart/package-overrides/handy-window/default.nix similarity index 100% rename from pkgs/development/compilers/flutter/package-overrides/handy-window/default.nix rename to pkgs/development/compilers/dart/package-overrides/handy-window/default.nix diff --git a/pkgs/development/compilers/flutter/package-overrides/matrix/default.nix b/pkgs/development/compilers/dart/package-overrides/matrix/default.nix similarity index 100% rename from pkgs/development/compilers/flutter/package-overrides/matrix/default.nix rename to pkgs/development/compilers/dart/package-overrides/matrix/default.nix diff --git a/pkgs/development/compilers/flutter/package-overrides/olm/default.nix b/pkgs/development/compilers/dart/package-overrides/olm/default.nix similarity index 100% rename from pkgs/development/compilers/flutter/package-overrides/olm/default.nix rename to pkgs/development/compilers/dart/package-overrides/olm/default.nix diff --git a/pkgs/development/compilers/flutter/package-overrides/default.nix b/pkgs/development/compilers/flutter/package-overrides/default.nix deleted file mode 100644 index c162929e336a..000000000000 --- a/pkgs/development/compilers/flutter/package-overrides/default.nix +++ /dev/null @@ -1,8 +0,0 @@ -{ callPackage }: - -{ - flutter_secure_storage_linux = callPackage ./flutter-secure-storage-linux { }; - handy_window = callPackage ./handy-window { }; - matrix = callPackage ./matrix { }; - olm = callPackage ./olm { }; -} From 98a7a5edd36d91b906558536f73239e709b36feb Mon Sep 17 00:00:00 2001 From: hacker1024 Date: Sun, 22 Oct 2023 00:42:07 +1100 Subject: [PATCH 187/222] dartHooks.dartFixupHook: Add trailing newline --- .../dart/build-dart-application/hooks/dart-fixup-hook.sh | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh b/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh index dd96ab374860..c5a9bedd0665 100644 --- a/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh +++ b/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh @@ -29,4 +29,4 @@ dartFixupHook() { echo "Finished dartFixupHook" } -postFixupHooks+=(dartFixupHook) \ No newline at end of file +postFixupHooks+=(dartFixupHook) From 409ed2c31d35193106122e43012238543cf55ccf Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 13:45:09 +0000 Subject: [PATCH 188/222] sbctl: 0.11 -> 0.12 --- pkgs/tools/security/sbctl/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/tools/security/sbctl/default.nix b/pkgs/tools/security/sbctl/default.nix index 6471425a8581..0778406b40cb 100644 --- a/pkgs/tools/security/sbctl/default.nix +++ b/pkgs/tools/security/sbctl/default.nix @@ -8,16 +8,16 @@ buildGoModule rec { pname = "sbctl"; - version = "0.11"; + version = "0.12"; src = fetchFromGitHub { owner = "Foxboron"; repo = pname; rev = version; - hash = "sha256-kApPb8X1JCP1XfyVFcoCDd+yrytTKSkNWRHKDA3mGaQ="; + hash = "sha256-1dA+a8GS4teaLmclatJNKt+OjhabLO4j/+p4Q95yG/s="; }; - vendorHash = "sha256-WbPYTETTOzqWH+q6fzyDgm0wMScbLWlksLxkDjopF4E="; + vendorHash = "sha256-kVXzHTONPCE1UeAnUiULjubJeZFD0DAxIk+w8/Dqs6c="; ldflags = [ "-s" "-w" "-X github.com/foxboron/sbctl.DatabasePath=${databasePath}" ]; From 93cafa97f6952af455de9fae5491049401cc58c1 Mon Sep 17 00:00:00 2001 From: Anderson Torres Date: Sat, 21 Oct 2023 00:19:39 -0300 Subject: [PATCH 189/222] tecoc: migrate to by-name --- .../editors/tecoc/default.nix => by-name/te/tecoc/package.nix} | 0 pkgs/top-level/all-packages.nix | 2 -- 2 files changed, 2 deletions(-) rename pkgs/{applications/editors/tecoc/default.nix => by-name/te/tecoc/package.nix} (100%) diff --git a/pkgs/applications/editors/tecoc/default.nix b/pkgs/by-name/te/tecoc/package.nix similarity index 100% rename from pkgs/applications/editors/tecoc/default.nix rename to pkgs/by-name/te/tecoc/package.nix diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index 7dad74b54a11..54fe23cf1946 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -35390,8 +35390,6 @@ with pkgs; tart = callPackage ../applications/virtualization/tart { }; - tecoc = callPackage ../applications/editors/tecoc { }; - viber = callPackage ../applications/networking/instant-messengers/viber { }; wavebox = libsForQt5.callPackage ../applications/networking/instant-messengers/wavebox { }; From 8db090977294c7e25a6907b1be1c9f772c59f3b8 Mon Sep 17 00:00:00 2001 From: Anderson Torres Date: Sat, 21 Oct 2023 00:24:38 -0300 Subject: [PATCH 190/222] tecoc: fixup license url --- pkgs/by-name/te/tecoc/package.nix | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/pkgs/by-name/te/tecoc/package.nix b/pkgs/by-name/te/tecoc/package.nix index 778115dfbfa7..a5531b3aa874 100644 --- a/pkgs/by-name/te/tecoc/package.nix +++ b/pkgs/by-name/te/tecoc/package.nix @@ -72,7 +72,7 @@ stdenv.mkDerivation (finalAttrs: { TECOC is a portable C implementation of TECO-11. ''; license = { - url = "https://github.com/blakemcbride/TECOC/tree/master/doc/readme-1st.txt"; + url = "https://github.com/blakemcbride/TECOC/blob/${finalAttrs.src.rev}/doc/readme-1st.txt"; }; maintainers = [ lib.maintainers.AndersonTorres ]; platforms = lib.platforms.unix; From dc69ed5af3bdd9e337b034c0ded96e4e2ecccb00 Mon Sep 17 00:00:00 2001 From: Anderson Torres Date: Fri, 20 Oct 2023 23:42:16 -0300 Subject: [PATCH 191/222] argagg: migrate to by-name --- .../libraries => by-name/ar}/argagg/0001-catch.diff | 0 .../argagg/default.nix => by-name/ar/argagg/package.nix} | 0 pkgs/top-level/all-packages.nix | 2 -- 3 files changed, 2 deletions(-) rename pkgs/{development/libraries => by-name/ar}/argagg/0001-catch.diff (100%) rename pkgs/{development/libraries/argagg/default.nix => by-name/ar/argagg/package.nix} (100%) diff --git a/pkgs/development/libraries/argagg/0001-catch.diff b/pkgs/by-name/ar/argagg/0001-catch.diff similarity index 100% rename from pkgs/development/libraries/argagg/0001-catch.diff rename to pkgs/by-name/ar/argagg/0001-catch.diff diff --git a/pkgs/development/libraries/argagg/default.nix b/pkgs/by-name/ar/argagg/package.nix similarity index 100% rename from pkgs/development/libraries/argagg/default.nix rename to pkgs/by-name/ar/argagg/package.nix diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index 54fe23cf1946..891b215d49f1 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -3267,8 +3267,6 @@ with pkgs; apitrace = libsForQt5.callPackage ../applications/graphics/apitrace { }; - argagg = callPackage ../development/libraries/argagg { }; - argtable = callPackage ../development/libraries/argtable { }; arguments = callPackage ../development/libraries/arguments { }; From 95964369a695d0e335d7fd14ab1bf9cbb070c77e Mon Sep 17 00:00:00 2001 From: Anderson Torres Date: Fri, 20 Oct 2023 23:51:55 -0300 Subject: [PATCH 192/222] argagg: 0.4.6 -> 0.4.7 --- pkgs/by-name/ar/argagg/0001-catch.diff | 20 -------------------- pkgs/by-name/ar/argagg/package.nix | 25 ++++++++++--------------- 2 files changed, 10 insertions(+), 35 deletions(-) delete mode 100644 pkgs/by-name/ar/argagg/0001-catch.diff diff --git a/pkgs/by-name/ar/argagg/0001-catch.diff b/pkgs/by-name/ar/argagg/0001-catch.diff deleted file mode 100644 index f99649d56812..000000000000 --- a/pkgs/by-name/ar/argagg/0001-catch.diff +++ /dev/null @@ -1,20 +0,0 @@ ---- old/test/doctest.h 2019-03-05 18:04:06.143740733 +0300 -+++ new/test/doctest.h 2019-03-05 18:04:43.577284916 +0300 -@@ -1307,7 +1307,7 @@ - __FILE__, __LINE__, #expr, #as); \ - try { \ - expr; \ -- } catch(as) { \ -+ } catch(as e) { \ - _DOCTEST_RB.m_threw = true; \ - _DOCTEST_RB.m_threw_as = true; \ - } catch(...) { _DOCTEST_RB.m_threw = true; } \ -@@ -1332,7 +1332,7 @@ - #define DOCTEST_REQUIRE_THROWS(expr) DOCTEST_ASSERT_THROWS(expr, DT_REQUIRE_THROWS) - - #define DOCTEST_WARN_THROWS_AS(expr, ex) DOCTEST_ASSERT_THROWS_AS(expr, ex, DT_WARN_THROWS_AS) --#define DOCTEST_CHECK_THROWS_AS(expr, ex) DOCTEST_ASSERT_THROWS_AS(expr, ex, DT_CHECK_THROWS_AS) -+#define DOCTEST_CHECK_THROWS_AS(expr, ex) DOCTEST_ASSERT_THROWS_AS(expr, const ex &, DT_CHECK_THROWS_AS) - #define DOCTEST_REQUIRE_THROWS_AS(expr, ex) DOCTEST_ASSERT_THROWS_AS(expr, ex, DT_REQUIRE_THROWS_AS) - - #define DOCTEST_WARN_NOTHROW(expr) DOCTEST_ASSERT_NOTHROW(expr, DT_WARN_NOTHROW) diff --git a/pkgs/by-name/ar/argagg/package.nix b/pkgs/by-name/ar/argagg/package.nix index 7ff9eaac1e3e..bb8507abbe97 100644 --- a/pkgs/by-name/ar/argagg/package.nix +++ b/pkgs/by-name/ar/argagg/package.nix @@ -4,27 +4,22 @@ , cmake }: -stdenv.mkDerivation rec { +stdenv.mkDerivation (finalAttrs: { pname = "argagg"; - version = "0.4.6"; + version = "0.4.7"; src = fetchFromGitHub { owner = "vietjtnguyen"; - repo = pname; - rev = version; - hash = "sha256-MCtlAPfwdJpgfS8IH+zlcgaaxZ5AsP4hJvbZAFtOa4o="; + repo = "argagg"; + rev = finalAttrs.version; + hash = "sha256-G0PzoKpUyb1MaziLvHgasq98jPODUu4EgPzywRjuIN8="; }; - patches = [ - # Fix compilation of macro catch statement - ./0001-catch.diff - ]; - nativeBuildInputs = [ cmake ]; - meta = with lib; { + meta = { homepage = "https://github.com/vietjtnguyen/argagg"; description = "Argument Aggregator"; longDescription = '' @@ -38,9 +33,9 @@ stdenv.mkDerivation rec { types until you access them, so the result structures end up just being pointers into the original command line argument C-strings. ''; - license = licenses.mit; - maintainers = with maintainers; [ AndersonTorres ]; - platforms = with platforms; all; + license = lib.licenses.mit; + maintainers = with lib.maintainers; [ AndersonTorres ]; + platforms = lib.platforms.all; badPlatforms = [ "aarch64-darwin" ]; }; -} +}) From 8b087fdb0948d3efc5d5b7715ac20941a384be27 Mon Sep 17 00:00:00 2001 From: Anderson Torres Date: Fri, 20 Oct 2023 23:56:25 -0300 Subject: [PATCH 193/222] argtable: migrate to by-name --- .../argtable/default.nix => by-name/ar/argtable/package.nix} | 0 pkgs/top-level/all-packages.nix | 2 -- 2 files changed, 2 deletions(-) rename pkgs/{development/libraries/argtable/default.nix => by-name/ar/argtable/package.nix} (100%) diff --git a/pkgs/development/libraries/argtable/default.nix b/pkgs/by-name/ar/argtable/package.nix similarity index 100% rename from pkgs/development/libraries/argtable/default.nix rename to pkgs/by-name/ar/argtable/package.nix diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix index 891b215d49f1..235d9fe41ed6 100644 --- a/pkgs/top-level/all-packages.nix +++ b/pkgs/top-level/all-packages.nix @@ -3267,8 +3267,6 @@ with pkgs; apitrace = libsForQt5.callPackage ../applications/graphics/apitrace { }; - argtable = callPackage ../development/libraries/argtable { }; - arguments = callPackage ../development/libraries/arguments { }; argus = callPackage ../tools/networking/argus { }; From 7d0661c68e0102eb337660ab9bfd50817f88fb01 Mon Sep 17 00:00:00 2001 From: Anderson Torres Date: Sat, 21 Oct 2023 00:18:45 -0300 Subject: [PATCH 194/222] argtable: 3.2.1 -> 3.2.2 --- pkgs/by-name/ar/argtable/package.nix | 22 +++++++++++----------- 1 file changed, 11 insertions(+), 11 deletions(-) diff --git a/pkgs/by-name/ar/argtable/package.nix b/pkgs/by-name/ar/argtable/package.nix index 9752b9600397..18206202691c 100644 --- a/pkgs/by-name/ar/argtable/package.nix +++ b/pkgs/by-name/ar/argtable/package.nix @@ -4,29 +4,29 @@ , cmake }: -stdenv.mkDerivation rec { +stdenv.mkDerivation (finalAttrs: { pname = "argtable"; - version = "3.2.1"; - srcVersion = "v${version}.52f24e5"; + version = "3.2.2"; + srcVersion = "v${finalAttrs.version}.f25c624"; src = fetchFromGitHub { owner = "argtable"; repo = "argtable3"; - rev = srcVersion; - hash = "sha256-HFsk91uJXQ0wpvAQxP4/yZwRQx9kLH7KgB3Y/+zcZC0="; + rev = finalAttrs.srcVersion; + hash = "sha256-X89xFLDs6NEgjzzwy8kplvTgukQd/CV3Xa9A3JXecf4="; }; nativeBuildInputs = [ cmake ]; cmakeFlags = [ - "-DBUILD_SHARED_LIBS=ON" + (lib.cmakeBool "BUILD_SHARED_LIBS" true) ]; postPatch = '' patchShebangs tools/build ''; - meta = with lib; { + meta = { homepage = "https://github.com/argtable/argtable3"; description = "A single-file, ANSI C command-line parsing library"; longDescription = '' @@ -37,11 +37,11 @@ stdenv.mkDerivation rec { handling logic and textual descriptions of the command line syntax, which are essential but tedious to implement for a robust CLI program. ''; - license = with licenses; bsd3; - maintainers = with maintainers; [ AndersonTorres artuuge ]; - platforms = with platforms; all; + license = lib.licenses.bsd3; + maintainers = with lib.maintainers; [ AndersonTorres artuuge ]; + platforms = lib.platforms.all; }; -} +}) # TODO: a NixOS test suite # TODO: multiple outputs # TODO: documentation From 7efc0b24189dcf9ef0d6e5c5ecfe2b6451022f7c Mon Sep 17 00:00:00 2001 From: Martin Weinelt Date: Sat, 21 Oct 2023 13:21:17 +0200 Subject: [PATCH 195/222] doc/python: mention python313 --- doc/languages-frameworks/python.section.md | 1 + 1 file changed, 1 insertion(+) diff --git a/doc/languages-frameworks/python.section.md b/doc/languages-frameworks/python.section.md index 40236d141d3d..cdd5c806912e 100644 --- a/doc/languages-frameworks/python.section.md +++ b/doc/languages-frameworks/python.section.md @@ -12,6 +12,7 @@ | python310 | python3 | CPython 3.10 | | python311 | | CPython 3.11 | | python312 | | CPython 3.12 | +| python313 | | CPython 3.13 | | pypy27 | pypy2, pypy | PyPy2.7 | | pypy39 | pypy3 | PyPy 3.9 | From 3e8424248f74e03a119f8aeb4920d91593eeadad Mon Sep 17 00:00:00 2001 From: Yaya Date: Wed, 11 Oct 2023 23:42:57 +0200 Subject: [PATCH 196/222] electron-{22,24}-bin: Mark EOL These are now EOL since 2023-10-10 https://endoflife.date/electron Co-authored-by: Yureka --- pkgs/development/tools/electron/binary/generic.nix | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/pkgs/development/tools/electron/binary/generic.nix b/pkgs/development/tools/electron/binary/generic.nix index cbd908098965..6e1493528e2b 100644 --- a/pkgs/development/tools/electron/binary/generic.nix +++ b/pkgs/development/tools/electron/binary/generic.nix @@ -40,7 +40,7 @@ let ++ optionals (versionAtLeast version "11.0.0") [ "aarch64-darwin" ] ++ optionals (versionOlder version "19.0.0") [ "i686-linux" ]; sourceProvenance = with sourceTypes; [ binaryNativeCode ]; - knownVulnerabilities = optional (versionOlder version "22.0.0" || versions.major version == "23") "Electron version ${version} is EOL"; + knownVulnerabilities = optional (versionOlder version "25.0.0") "Electron version ${version} is EOL"; }; fetcher = vers: tag: hash: fetchurl { From b247b1e07d3d6dbeacdf709106ac85abd15b80ff Mon Sep 17 00:00:00 2001 From: Pol Dellaiera Date: Sat, 21 Oct 2023 16:52:55 +0200 Subject: [PATCH 197/222] php.packages.grumphp: 1.15.0 -> 2.1.0 --- .../php-packages/grumphp/composer-json.patch | 27 ++++++++++ .../php-packages/grumphp/composer-lock.patch | 24 +++++++++ .../php-packages/grumphp/default.nix | 54 ++++++++++++------- 3 files changed, 86 insertions(+), 19 deletions(-) create mode 100644 pkgs/development/php-packages/grumphp/composer-json.patch create mode 100644 pkgs/development/php-packages/grumphp/composer-lock.patch diff --git a/pkgs/development/php-packages/grumphp/composer-json.patch b/pkgs/development/php-packages/grumphp/composer-json.patch new file mode 100644 index 000000000000..7fd7441612cc --- /dev/null +++ b/pkgs/development/php-packages/grumphp/composer-json.patch @@ -0,0 +1,27 @@ +From 2f53794374e0d32e1f322202c6668655792f745d Mon Sep 17 00:00:00 2001 +From: Pol Dellaiera +Date: Sat, 21 Oct 2023 16:46:59 +0200 +Subject: [PATCH] composer.json + +--- + composer.json | 5 +- + 1 file changed, 4 insertion(+), 1 deletion(-) + +diff --git i/composer.json w/composer.json +index 6ac54420..69b75a51 100644 +--- i/composer.json ++++ w/composer.json +@@ -96,7 +96,10 @@ + "bin/grumphp" + ], + "config": { +- "sort-packages": true ++ "sort-packages": true, ++ "platform": { ++ "php": "8.1" ++ } + }, + "extra": { + "class": "GrumPHP\\Composer\\GrumPHPPlugin" +-- +2.42.0 diff --git a/pkgs/development/php-packages/grumphp/composer-lock.patch b/pkgs/development/php-packages/grumphp/composer-lock.patch new file mode 100644 index 000000000000..2fc801557c4f --- /dev/null +++ b/pkgs/development/php-packages/grumphp/composer-lock.patch @@ -0,0 +1,24 @@ +From 2f53794374e0d32e1f322202c6668655792f745d Mon Sep 17 00:00:00 2001 +From: Pol Dellaiera +Date: Sat, 21 Oct 2023 16:46:59 +0200 +Subject: [PATCH] composer.lock + +--- + phar.composer.lock | 2 +- + 1 file changed, 1 insertion(+), 1 deletion(-) + +diff --git a/phar.composer.lock b/phar.composer.lock +index 96b692c3..a8cb2a87 100644 +--- a/phar.composer.lock ++++ b/phar.composer.lock +@@ -4,7 +4,7 @@ + "Read more about it at https://getcomposer.org/doc/01-basic-usage.md#installing-dependencies", + "This file is @generated automatically" + ], +- "content-hash": "8a069c630e6ddbc4475db9a992430539", ++ "content-hash": "0474062650b24a22c63007631cf35f1e", + "packages": [ + { + "name": "amphp/amp", +-- +2.42.0 diff --git a/pkgs/development/php-packages/grumphp/default.nix b/pkgs/development/php-packages/grumphp/default.nix index c7c2d9fc323e..6367dd996bf2 100644 --- a/pkgs/development/php-packages/grumphp/default.nix +++ b/pkgs/development/php-packages/grumphp/default.nix @@ -1,32 +1,48 @@ -{ mkDerivation, fetchurl, makeWrapper, lib, php }: +{ fetchFromGitHub, stdenvNoCC, lib, php }: -mkDerivation (finalAttrs: { +php.buildComposerProject (finalAttrs: { pname = "grumphp"; - version = "1.15.0"; + version = "2.1.0"; - src = fetchurl { - url = "https://github.com/phpro/grumphp/releases/download/v${finalAttrs.version}/grumphp.phar"; - sha256 = "sha256-EqzJb7DYZb7PnebErLVI/EZLxj0m26cniZlsu1feif0="; + src = fetchFromGitHub { + owner = "phpro"; + repo = "grumphp"; + rev = "v${finalAttrs.version}"; + hash = "sha256-RVgreCspdz+A6mdE2H4i8ajmdH8AZ9BOIw2OqLw7HfI="; }; - dontUnpack = true; + patches = [ + ./composer-json.patch + ]; - nativeBuildInputs = [ makeWrapper ]; + composerLock = stdenvNoCC.mkDerivation (finalComposerLockAttrs: { + name = "grumphp-composer-lock"; - installPhase = '' - runHook preInstall - mkdir -p $out/bin - install -D $src $out/libexec/grumphp/grumphp.phar - makeWrapper ${php}/bin/php $out/bin/grumphp \ - --add-flags "$out/libexec/grumphp/grumphp.phar" - runHook postInstall - ''; + src = fetchFromGitHub { + owner = "phpro"; + repo = "grumphp-shim"; + rev = "v${finalAttrs.version}"; + hash = "sha256-JxgRd0p/o3ouZ4MPke8cHqvAPuepY8ax0wx4t8+2dME="; + }; - meta = with lib; { + patches = [ + ./composer-lock.patch + ]; + + installPhase = '' + runHook preInstall + cp phar.composer.lock $out + runHook postInstall + ''; + }); + + vendorHash = "sha256-yefamPAzIabDCzZ9ghKq9iPH7AoCdgCCQ8PKrUN9ifQ="; + + meta = { changelog = "https://github.com/phpro/grumphp/releases/tag/v${finalAttrs.version}"; description = "A PHP code-quality tool"; homepage = "https://github.com/phpro/grumphp"; - license = licenses.mit; - maintainers = teams.php.members; + license = lib.licenses.mit; + maintainers = lib.teams.php.members; }; }) From 77f7b5a3e5cf65b4b31204aae8d205a771ec990e Mon Sep 17 00:00:00 2001 From: dadada Date: Sat, 8 Jul 2023 01:44:42 +0200 Subject: [PATCH 198/222] nixos/soft-serve: init This adds a NixOS module for Soft Serve, a tasty, self-hostable Git server for the command line. The module has a test that checks some basic things like creating users, creating a repo and cloning it. Co-authored-by: Sandro --- .../manual/release-notes/rl-2311.section.md | 2 + nixos/modules/module-list.nix | 1 + nixos/modules/services/misc/soft-serve.nix | 99 +++++++++++++++++ nixos/tests/all-tests.nix | 1 + nixos/tests/soft-serve.nix | 102 ++++++++++++++++++ pkgs/servers/soft-serve/default.nix | 4 +- 6 files changed, 208 insertions(+), 1 deletion(-) create mode 100644 nixos/modules/services/misc/soft-serve.nix create mode 100644 nixos/tests/soft-serve.nix diff --git a/nixos/doc/manual/release-notes/rl-2311.section.md b/nixos/doc/manual/release-notes/rl-2311.section.md index 38c89668f84a..13648364e13e 100644 --- a/nixos/doc/manual/release-notes/rl-2311.section.md +++ b/nixos/doc/manual/release-notes/rl-2311.section.md @@ -113,6 +113,8 @@ - [virt-manager](https://virt-manager.org/), an UI for managing virtual machines in libvirt, is now available as `programs.virt-manager`. +- [Soft Serve](https://github.com/charmbracelet/soft-serve), a tasty, self-hostable Git server for the command line. Available as [services.soft-serve](#opt-services.soft-serve.enable). + ## Backward Incompatibilities {#sec-release-23.11-incompatibilities} - `network-online.target` has been fixed to no longer time out for systems with `networking.useDHCP = true` and `networking.useNetworkd = true`. diff --git a/nixos/modules/module-list.nix b/nixos/modules/module-list.nix index 79918f71f7be..69f2a5a557c1 100644 --- a/nixos/modules/module-list.nix +++ b/nixos/modules/module-list.nix @@ -730,6 +730,7 @@ ./services/misc/signald.nix ./services/misc/siproxd.nix ./services/misc/snapper.nix + ./services/misc/soft-serve.nix ./services/misc/sonarr.nix ./services/misc/sourcehut ./services/misc/spice-vdagentd.nix diff --git a/nixos/modules/services/misc/soft-serve.nix b/nixos/modules/services/misc/soft-serve.nix new file mode 100644 index 000000000000..0f246493880b --- /dev/null +++ b/nixos/modules/services/misc/soft-serve.nix @@ -0,0 +1,99 @@ +{ config, lib, pkgs, ... }: + +with lib; + +let + cfg = config.services.soft-serve; + configFile = format.generate "config.yaml" cfg.settings; + format = pkgs.formats.yaml { }; + docUrl = "https://charm.sh/blog/self-hosted-soft-serve/"; + stateDir = "/var/lib/soft-serve"; +in +{ + options = { + services.soft-serve = { + enable = mkEnableOption "Enable soft-serve service"; + + package = mkPackageOption pkgs "soft-serve" { }; + + settings = mkOption { + type = format.type; + default = { }; + description = mdDoc '' + The contents of the configuration file. + + See <${docUrl}>. + ''; + example = literalExpression '' + { + name = "dadada's repos"; + log_format = "text"; + ssh = { + listen_addr = ":23231"; + public_url = "ssh://localhost:23231"; + max_timeout = 30; + idle_timeout = 120; + }; + stats.listen_addr = ":23233"; + } + ''; + }; + }; + }; + + config = mkIf cfg.enable { + + systemd.tmpfiles.rules = [ + # The config file has to be inside the state dir + "L+ ${stateDir}/config.yaml - - - - ${configFile}" + ]; + + systemd.services.soft-serve = { + description = "Soft Serve git server"; + documentation = [ docUrl ]; + requires = [ "network-online.target" ]; + after = [ "network-online.target" ]; + wantedBy = [ "multi-user.target" ]; + + environment.SOFT_SERVE_DATA_PATH = stateDir; + + serviceConfig = { + Type = "simple"; + DynamicUser = true; + Restart = "always"; + ExecStart = "${getExe cfg.package} serve"; + StateDirectory = "soft-serve"; + WorkingDirectory = stateDir; + RuntimeDirectory = "soft-serve"; + RuntimeDirectoryMode = "0750"; + ProcSubset = "pid"; + ProtectProc = "invisible"; + UMask = "0027"; + CapabilityBoundingSet = ""; + ProtectHome = true; + PrivateDevices = true; + PrivateUsers = true; + ProtectHostname = true; + ProtectClock = true; + ProtectKernelTunables = true; + ProtectKernelModules = true; + ProtectKernelLogs = true; + ProtectControlGroups = true; + RestrictAddressFamilies = [ "AF_UNIX" "AF_INET" "AF_INET6" ]; + RestrictNamespaces = true; + LockPersonality = true; + MemoryDenyWriteExecute = true; + RestrictRealtime = true; + RemoveIPC = true; + PrivateMounts = true; + SystemCallArchitectures = "native"; + SystemCallFilter = [ + "@system-service" + "~@cpu-emulation @debug @keyring @module @mount @obsolete @privileged @raw-io @reboot @setuid @swap" + ]; + }; + }; + }; + + meta.maintainers = [ maintainers.dadada ]; +} diff --git a/nixos/tests/all-tests.nix b/nixos/tests/all-tests.nix index 33f8abf6ccd4..59da5827a1be 100644 --- a/nixos/tests/all-tests.nix +++ b/nixos/tests/all-tests.nix @@ -732,6 +732,7 @@ in { snapper = handleTest ./snapper.nix {}; snipe-it = runTest ./web-apps/snipe-it.nix; soapui = handleTest ./soapui.nix {}; + soft-serve = handleTest ./soft-serve.nix {}; sogo = handleTest ./sogo.nix {}; solanum = handleTest ./solanum.nix {}; sonarr = handleTest ./sonarr.nix {}; diff --git a/nixos/tests/soft-serve.nix b/nixos/tests/soft-serve.nix new file mode 100644 index 000000000000..1c4cb4c95819 --- /dev/null +++ b/nixos/tests/soft-serve.nix @@ -0,0 +1,102 @@ +import ./make-test-python.nix ({ pkgs, lib, ... }: +let + inherit (import ./ssh-keys.nix pkgs) snakeOilPrivateKey snakeOilPublicKey; + sshPort = 8231; + httpPort = 8232; + statsPort = 8233; + gitPort = 8418; +in +{ + name = "soft-serve"; + meta.maintainers = with lib.maintainers; [ dadada ]; + nodes = { + client = { pkgs, ... }: { + environment.systemPackages = with pkgs; [ + curl + git + openssh + ]; + environment.etc.sshKey = { + source = snakeOilPrivateKey; + mode = "0600"; + }; + }; + + server = + { config, ... }: + { + services.soft-serve = { + enable = true; + settings = { + name = "TestServer"; + ssh.listen_addr = ":${toString sshPort}"; + git.listen_addr = ":${toString gitPort}"; + http.listen_addr = ":${toString httpPort}"; + stats.listen_addr = ":${toString statsPort}"; + initial_admin_keys = [ snakeOilPublicKey ]; + }; + }; + networking.firewall.allowedTCPPorts = [ sshPort httpPort statsPort ]; + }; + }; + + testScript = + { ... }: + '' + SSH_PORT = ${toString sshPort} + HTTP_PORT = ${toString httpPort} + STATS_PORT = ${toString statsPort} + KEY = "${snakeOilPublicKey}" + SSH_KEY = "/etc/sshKey" + SSH_COMMAND = f"ssh -p {SSH_PORT} -i {SSH_KEY} -o StrictHostKeyChecking=no" + TEST_DIR = "/tmp/test" + GIT = f"git -C {TEST_DIR}" + + for machine in client, server: + machine.wait_for_unit("network.target") + + server.wait_for_unit("soft-serve.service") + server.wait_for_open_port(SSH_PORT) + + with subtest("Get info"): + status, test = client.execute(f"{SSH_COMMAND} server info") + if status != 0: + raise Exception("Failed to get SSH info") + key = " ".join(KEY.split(" ")[0:2]) + if not key in test: + raise Exception("Admin key must be configured correctly") + + with subtest("Create user"): + client.succeed(f"{SSH_COMMAND} server user create beatrice") + client.succeed(f"{SSH_COMMAND} server user info beatrice") + + with subtest("Create repo"): + client.succeed(f"git init {TEST_DIR}") + client.succeed(f"{GIT} config --global user.email you@example.com") + client.succeed(f"touch {TEST_DIR}/foo") + client.succeed(f"{GIT} add foo") + client.succeed(f"{GIT} commit --allow-empty -m test") + client.succeed(f"{GIT} remote add origin git@server:test") + client.succeed(f"GIT_SSH_COMMAND='{SSH_COMMAND}' {GIT} push -u origin master") + client.execute("rm -r /tmp/test") + + server.wait_for_open_port(HTTP_PORT) + + with subtest("Clone over HTTP"): + client.succeed(f"curl --connect-timeout 10 http://server:{HTTP_PORT}/") + client.succeed(f"git clone http://server:{HTTP_PORT}/test /tmp/test") + client.execute("rm -r /tmp/test") + + with subtest("Clone over SSH"): + client.succeed(f"GIT_SSH_COMMAND='{SSH_COMMAND}' git clone git@server:test /tmp/test") + client.execute("rm -r /tmp/test") + + with subtest("Get stats over HTTP"): + server.wait_for_open_port(STATS_PORT) + status, test = client.execute(f"curl --connect-timeout 10 http://server:{STATS_PORT}/metrics") + if status != 0: + raise Exception("Failed to get metrics from status port") + if not "go_gc_duration_seconds_count" in test: + raise Exception("Metrics did not contain key 'go_gc_duration_seconds_count'") + ''; +}) diff --git a/pkgs/servers/soft-serve/default.nix b/pkgs/servers/soft-serve/default.nix index 01a5ea9d6dd0..2cfd41f7caf8 100644 --- a/pkgs/servers/soft-serve/default.nix +++ b/pkgs/servers/soft-serve/default.nix @@ -1,4 +1,4 @@ -{ lib, buildGoModule, fetchFromGitHub, makeWrapper, git, bash }: +{ lib, buildGoModule, fetchFromGitHub, makeWrapper, nixosTests, git, bash }: buildGoModule rec { pname = "soft-serve"; @@ -26,6 +26,8 @@ buildGoModule rec { --prefix PATH : "${lib.makeBinPath [ git bash ]}" ''; + passthru.tests = nixosTests.soft-serve; + meta = with lib; { description = "A tasty, self-hosted Git server for the command line"; homepage = "https://github.com/charmbracelet/soft-serve"; From 1a81fe0cc89a4eb7c28c7a6b376700c9af869709 Mon Sep 17 00:00:00 2001 From: Adam Stephens Date: Sat, 14 Oct 2023 08:18:46 -0400 Subject: [PATCH 199/222] zfs: 2.1.13 -> 2.2.0 --- .../manual/release-notes/rl-2311.section.md | 2 ++ nixos/tests/zfs.nix | 4 --- pkgs/os-specific/linux/zfs/generic.nix | 27 ++++++------------- pkgs/os-specific/linux/zfs/stable.nix | 13 +++------ 4 files changed, 13 insertions(+), 33 deletions(-) diff --git a/nixos/doc/manual/release-notes/rl-2311.section.md b/nixos/doc/manual/release-notes/rl-2311.section.md index 9a682077230c..2cdde5ec7ae7 100644 --- a/nixos/doc/manual/release-notes/rl-2311.section.md +++ b/nixos/doc/manual/release-notes/rl-2311.section.md @@ -339,6 +339,8 @@ - `jq` was updated to 1.7, its [first release in 5 years](https://github.com/jqlang/jq/releases/tag/jq-1.7). +- `zfs` was updated from 2.1.x to 2.2.0, [enabling newer kernel support and adding new features](https://github.com/openzfs/zfs/releases/tag/zfs-2.2.0). + - A new option was added to the virtualisation module that enables specifying explicitly named network interfaces in QEMU VMs. The existing `virtualisation.vlans` is still supported for cases where the name of the network interface is irrelevant. - DocBook option documentation is no longer supported, all module documentation now uses markdown. diff --git a/nixos/tests/zfs.nix b/nixos/tests/zfs.nix index 800f5e43cd15..3454fbaf78fe 100644 --- a/nixos/tests/zfs.nix +++ b/nixos/tests/zfs.nix @@ -113,8 +113,6 @@ let }; testScript = '' - # TODO: Remove this when upgrading stable to zfs 2.2.0 - unstable = ${if enableUnstable then "True" else "False"}; machine.wait_for_unit("multi-user.target") machine.succeed( "zpool status", @@ -136,8 +134,6 @@ let machine.crash() machine.wait_for_unit("multi-user.target") machine.succeed("zfs set sharesmb=on rpool/shared_smb") - if not unstable: - machine.succeed("zfs share rpool/shared_smb") machine.succeed( "smbclient -gNL localhost | grep rpool_shared_smb", "umount /tmp/mnt", diff --git a/pkgs/os-specific/linux/zfs/generic.nix b/pkgs/os-specific/linux/zfs/generic.nix index 81ff2214bcad..7bb4a1b7496e 100644 --- a/pkgs/os-specific/linux/zfs/generic.nix +++ b/pkgs/os-specific/linux/zfs/generic.nix @@ -76,25 +76,14 @@ stdenv'.mkDerivation { substituteInPlace ./config/user-systemd.m4 --replace "/usr/lib/modules-load.d" "$out/etc/modules-load.d" substituteInPlace ./config/zfs-build.m4 --replace "\$sysconfdir/init.d" "$out/etc/init.d" \ --replace "/etc/default" "$out/etc/default" - # TODO: drop when upgrading to 2.2.0 - ${if isUnstable then '' - substituteInPlace ./contrib/initramfs/Makefile.am \ - --replace "/usr/share/initramfs-tools" "$out/usr/share/initramfs-tools" - substituteInPlace ./udev/vdev_id \ - --replace "PATH=/bin:/sbin:/usr/bin:/usr/sbin" \ - "PATH=${makeBinPath [ coreutils gawk gnused gnugrep systemd ]}" - substituteInPlace ./config/zfs-build.m4 \ - --replace "bashcompletiondir=/etc/bash_completion.d" \ - "bashcompletiondir=$out/share/bash-completion/completions" - '' else '' - substituteInPlace ./etc/zfs/Makefile.am --replace "\$(sysconfdir)/zfs" "$out/etc/zfs" - - find ./contrib/initramfs -name Makefile.am -exec sed -i -e 's|/usr/share/initramfs-tools|'$out'/share/initramfs-tools|g' {} \; - - substituteInPlace ./cmd/vdev_id/vdev_id \ - --replace "PATH=/bin:/sbin:/usr/bin:/usr/sbin" \ - "PATH=${makeBinPath [ coreutils gawk gnused gnugrep systemd ]}" - ''} + substituteInPlace ./contrib/initramfs/Makefile.am \ + --replace "/usr/share/initramfs-tools" "$out/usr/share/initramfs-tools" + substituteInPlace ./udev/vdev_id \ + --replace "PATH=/bin:/sbin:/usr/bin:/usr/sbin" \ + "PATH=${makeBinPath [ coreutils gawk gnused gnugrep systemd ]}" + substituteInPlace ./config/zfs-build.m4 \ + --replace "bashcompletiondir=/etc/bash_completion.d" \ + "bashcompletiondir=$out/share/bash-completion/completions" ''; nativeBuildInputs = [ autoreconfHook269 nukeReferences ] diff --git a/pkgs/os-specific/linux/zfs/stable.nix b/pkgs/os-specific/linux/zfs/stable.nix index 1a77396300eb..3e53ba902cbd 100644 --- a/pkgs/os-specific/linux/zfs/stable.nix +++ b/pkgs/os-specific/linux/zfs/stable.nix @@ -16,20 +16,13 @@ callPackage ./generic.nix args { if stdenv'.isx86_64 || removeLinuxDRM then kernel.kernelOlder "6.6" else kernel.kernelOlder "6.2"; + latestCompatibleLinuxPackages = if stdenv'.isx86_64 || removeLinuxDRM then linuxKernel.packages.linux_6_5 else linuxKernel.packages.linux_6_1; - extraPatches = [ - # applied in version 2.2.x - (fetchpatch { - name = "musl.patch"; - url = "https://github.com/openzfs/zfs/commit/1f19826c9ac85835cbde61a7439d9d1fefe43a4a.patch"; - sha256 = "XEaK227ubfOwlB2s851UvZ6xp/QOtYUWYsKTkEHzmo0="; - }) - ]; # this package should point to the latest release. - version = "2.1.13"; + version = "2.2.0"; - sha256 = "tqUCn/Hf/eEmyWRQthWQdmTJK2sDspnHiiEfn9rz2Kc="; + sha256 = "sha256-s1sdXSrLu6uSOmjprbUa4cFsE2Vj7JX5i75e4vRnlvg="; } From 53bb653759a95ae98c9aa9389ed825384da732a1 Mon Sep 17 00:00:00 2001 From: Adam Stephens Date: Sat, 14 Oct 2023 08:19:01 -0400 Subject: [PATCH 200/222] zfsUnstable: 2.2.0-rc5 -> 2.2.1-unstable-2023-10-21 --- pkgs/os-specific/linux/zfs/unstable.nix | 5 +++-- 1 file changed, 3 insertions(+), 2 deletions(-) diff --git a/pkgs/os-specific/linux/zfs/unstable.nix b/pkgs/os-specific/linux/zfs/unstable.nix index 23882322c093..9c7e14c31bf3 100644 --- a/pkgs/os-specific/linux/zfs/unstable.nix +++ b/pkgs/os-specific/linux/zfs/unstable.nix @@ -23,9 +23,10 @@ callPackage ./generic.nix args { # IMPORTANT: Always use a tagged release candidate or commits from the # zfs--staging branch, because this is tested by the OpenZFS # maintainers. - version = "2.2.0-rc5"; + version = "2.2.1-unstable-2023-10-21"; + rev = "95785196f26e92d82cf4445654ba84e4a9671c57"; - sha256 = "sha256-97dTmSneAuhDR7LrJxG7/xPpI1hGv5mDDuq8HRTZKx0="; + sha256 = "sha256-s1sdXSrLu6uSOmjprbUa4cFsE2Vj7JX5i75e4vRnlvg="; isUnstable = true; } From b54ec5ac08641aafc6f3e14130d0268287745574 Mon Sep 17 00:00:00 2001 From: Adam Stephens Date: Mon, 16 Oct 2023 08:30:42 -0400 Subject: [PATCH 201/222] python3Packages.py-libzfs: 22.02.4 -> 22.12.4.2 --- pkgs/development/python-modules/py-libzfs/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/python-modules/py-libzfs/default.nix b/pkgs/development/python-modules/py-libzfs/default.nix index 1eacc39b8ab0..d148e539d3ff 100644 --- a/pkgs/development/python-modules/py-libzfs/default.nix +++ b/pkgs/development/python-modules/py-libzfs/default.nix @@ -8,13 +8,13 @@ buildPythonPackage rec { pname = "py-libzfs"; - version = "22.02.4"; + version = "22.12.4.2"; src = fetchFromGitHub { owner = "truenas"; repo = pname; rev = "TS-${version}"; - hash = "sha256-BJG+cw07Qu4aL99pVKNd7JAgr+w/6Uv2eI46EB615/I="; + hash = "sha256-vBLbjP1gQEQNsTLc2W6uRzCFHQXZp+jGiwE0Pe8VTuw="; }; nativeBuildInputs = [ cython ]; From 04ecbb895022be1f081a493e25d69b4924d41176 Mon Sep 17 00:00:00 2001 From: Alyssa Ross Date: Sat, 21 Oct 2023 16:39:22 +0000 Subject: [PATCH 202/222] python3.pkgs.pyliblo.meta.license: clarify "or later" is mentioned in a few files, but not most of them, and there's no project-wide explanation of the license. --- pkgs/development/python-modules/pyliblo/default.nix | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/pkgs/development/python-modules/pyliblo/default.nix b/pkgs/development/python-modules/pyliblo/default.nix index 52f59cc3fc8d..851083a52b58 100644 --- a/pkgs/development/python-modules/pyliblo/default.nix +++ b/pkgs/development/python-modules/pyliblo/default.nix @@ -22,7 +22,7 @@ buildPythonPackage rec { meta = with lib; { homepage = "https://das.nasophon.de/pyliblo/"; description = "Python wrapper for the liblo OSC library"; - license = licenses.lgpl21; + license = licenses.lgpl21Only; }; } From 6504124f98b3b3eb1804f525da13badc5bbb2b4d Mon Sep 17 00:00:00 2001 From: Alyssa Ross Date: Sat, 21 Oct 2023 16:40:07 +0000 Subject: [PATCH 203/222] python311.pkgs.pyliblo: fix build --- pkgs/development/python-modules/pyliblo/default.nix | 9 ++++++++- 1 file changed, 8 insertions(+), 1 deletion(-) diff --git a/pkgs/development/python-modules/pyliblo/default.nix b/pkgs/development/python-modules/pyliblo/default.nix index 851083a52b58..e56b1dfa3683 100644 --- a/pkgs/development/python-modules/pyliblo/default.nix +++ b/pkgs/development/python-modules/pyliblo/default.nix @@ -10,13 +10,20 @@ buildPythonPackage rec { pname = "pyliblo"; version = "0.10.0"; - disabled = isPyPy || pythonAtLeast "3.11"; + disabled = isPyPy; src = fetchurl { url = "http://das.nasophon.de/download/${pname}-${version}.tar.gz"; sha256 = "13vry6xhxm7adnbyj28w1kpwrh0kf7nw83cz1yq74wl21faz2rzw"; }; + patches = [ + (fetchurl { + url = "https://git.alpinelinux.org/aports/plain/community/py3-pyliblo/py3.11.patch?id=a7e1eca5533657ddd7e37c43e67e8126e3447258"; + hash = "sha256-4yCWNQaE/9FHGTVuvNEimBNuViWZ9aSJMcpTOP0fnM0="; + }) + ]; + buildInputs = [ liblo cython ]; meta = with lib; { From 7e1ecbc27989eed033a37e6459d5859d8b763aca Mon Sep 17 00:00:00 2001 From: Yaya Date: Sun, 15 Oct 2023 14:43:48 +0000 Subject: [PATCH 204/222] ldb: 2.7.2 -> 2.8.0 --- pkgs/development/libraries/ldb/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/development/libraries/ldb/default.nix b/pkgs/development/libraries/ldb/default.nix index 95547fb6382a..de1af1f447e8 100644 --- a/pkgs/development/libraries/ldb/default.nix +++ b/pkgs/development/libraries/ldb/default.nix @@ -17,11 +17,11 @@ stdenv.mkDerivation rec { pname = "ldb"; - version = "2.7.2"; + version = "2.8.0"; src = fetchurl { url = "mirror://samba/ldb/${pname}-${version}.tar.gz"; - hash = "sha256-Ju5y1keFTmYtmWQ+srLTQWVavzH0mQg41mUPtc+SCcg="; + hash = "sha256-NY3KEPzScgeshXoNf0NaRtvGzR98ENu4QMGTG/GWXwg="; }; outputs = [ "out" "dev" ]; From 3b9c240c73c0d23cc7d0cc6405a6eec1ed519ab5 Mon Sep 17 00:00:00 2001 From: Yaya Date: Sat, 14 Oct 2023 14:50:53 +0000 Subject: [PATCH 205/222] samba: 4.18.6 -> 4.19.1 https://lists.samba.org/archive/samba-announce/2023/000651.html Fixes CVE-2023-3961 Fixes CVE-2023-4091 Fixes CVE-2023-4154 Fixes CVE-2023-42669 Fixes CVE-2023-42670 --- pkgs/servers/samba/4.x.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/servers/samba/4.x.nix b/pkgs/servers/samba/4.x.nix index ed8744ef3c62..4665402361d5 100644 --- a/pkgs/servers/samba/4.x.nix +++ b/pkgs/servers/samba/4.x.nix @@ -51,11 +51,11 @@ with lib; stdenv.mkDerivation rec { pname = "samba"; - version = "4.18.6"; + version = "4.19.1"; src = fetchurl { url = "mirror://samba/pub/samba/stable/${pname}-${version}.tar.gz"; - hash = "sha256-KEyKmUzpich81oCMOQ/LnQDDayGg3BqKdUdLZ8nnFec="; + hash = "sha256-zjt/DRi/kapf1kbouzhaOzU3W3A8blEjsCuFoavIGHk="; }; outputs = [ "out" "dev" "man" ]; From 7096340f9e63c67bc18c2552ad66297f29488fa9 Mon Sep 17 00:00:00 2001 From: Robert Hensing Date: Sat, 21 Oct 2023 18:34:49 +0200 Subject: [PATCH 206/222] nixos/qemu-vm: Rename nixos-disk-image -> nix-store-image For the image that's actually a store image only. Helps with visibility. The name "nixos-disk-image" has no special significance, by grepping nixpkgs. --- nixos/modules/virtualisation/qemu-vm.nix | 1 + 1 file changed, 1 insertion(+) diff --git a/nixos/modules/virtualisation/qemu-vm.nix b/nixos/modules/virtualisation/qemu-vm.nix index e0004df6f6b2..737a935711ae 100644 --- a/nixos/modules/virtualisation/qemu-vm.nix +++ b/nixos/modules/virtualisation/qemu-vm.nix @@ -267,6 +267,7 @@ let }; storeImage = import ../../lib/make-disk-image.nix { + name = "nix-store-image"; inherit pkgs config lib; additionalPaths = [ regInfo ]; format = "qcow2"; From d82cd10e9aa87b834aea929e3fd2ef662b1975f1 Mon Sep 17 00:00:00 2001 From: Kai Norman Clasen Date: Sat, 21 Oct 2023 19:29:37 +0200 Subject: [PATCH 207/222] flyway: meta add `mainProgram` --- pkgs/development/tools/flyway/default.nix | 1 + 1 file changed, 1 insertion(+) diff --git a/pkgs/development/tools/flyway/default.nix b/pkgs/development/tools/flyway/default.nix index d9cffc192506..cd42388f0f82 100644 --- a/pkgs/development/tools/flyway/default.nix +++ b/pkgs/development/tools/flyway/default.nix @@ -32,6 +32,7 @@ stdenv.mkDerivation (finalAttrs: { This package is only the Community Edition of the Flyway command-line tool. ''; + mainProgram = "flyway"; downloadPage = "https://github.com/flyway/flyway"; homepage = "https://flywaydb.org/"; changelog = "https://documentation.red-gate.com/fd/release-notes-for-flyway-engine-179732572.html"; From 03cb04dca4f8d7dbb305c3d28000c46808257dcf Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Bj=C3=B8rn=20Forsman?= Date: Sat, 21 Oct 2023 19:34:48 +0200 Subject: [PATCH 208/222] ddclient: 3.11.0_1 -> 3.11.0 Release notes: https://github.com/ddclient/ddclient/releases/tag/v3.11.0 (The previous version was a pre-release.) --- pkgs/tools/networking/ddclient/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/tools/networking/ddclient/default.nix b/pkgs/tools/networking/ddclient/default.nix index 6477c5b185c0..eafba0d4f527 100644 --- a/pkgs/tools/networking/ddclient/default.nix +++ b/pkgs/tools/networking/ddclient/default.nix @@ -5,7 +5,7 @@ let in perlPackages.buildPerlPackage rec { pname = "ddclient"; - version = "3.11.0_1"; + version = "3.11.0"; outputs = [ "out" ]; @@ -13,7 +13,7 @@ perlPackages.buildPerlPackage rec { owner = "ddclient"; repo = "ddclient"; rev = "v${version}"; - sha256 = "sha256-pl1kbzY5nUIvx1QiDdL9TP4vKtQnnv3RWklE4gbxXCw="; + sha256 = "sha256-s/gdTvEY4QIVidqNnN7GYrpCsp4nZ0GEH8Jv+LkSr48="; }; postPatch = '' From e2523b4ca08abf11bb706193bd8ce526c731ad21 Mon Sep 17 00:00:00 2001 From: networkException Date: Sat, 21 Oct 2023 13:02:47 +0200 Subject: [PATCH 209/222] chromium,chromedriver,electron: use hash instead of sha256 everywhere this patch updates the packaging of chromium and chromedriver to use sri hashes in `upstream-info.nix` instead of sha256 as well as the packaging of electron to use sri hashes in `info.json` instead of sha256 (just gn). this patch also updates the previous `sha256` values in `upstream-info.nix` and `info.json` to sri hashes in `hash`. --- .../networking/browsers/chromium/common.nix | 16 ++++----- .../networking/browsers/chromium/default.nix | 12 +++---- .../browsers/chromium/ungoogled.nix | 6 ++-- .../browsers/chromium/upstream-info.nix | 34 +++++++++---------- pkgs/development/tools/electron/info.json | 8 ++--- .../tools/selenium/chromedriver/default.nix | 8 ++--- 6 files changed, 42 insertions(+), 42 deletions(-) diff --git a/pkgs/applications/networking/browsers/chromium/common.nix b/pkgs/applications/networking/browsers/chromium/common.nix index 22d71e8975f8..9688bf4b096f 100644 --- a/pkgs/applications/networking/browsers/chromium/common.nix +++ b/pkgs/applications/networking/browsers/chromium/common.nix @@ -67,16 +67,16 @@ let ]); clangFormatPython3 = fetchurl { url = "https://chromium.googlesource.com/chromium/tools/build/+/e77882e0dde52c2ccf33c5570929b75b4a2a2522/recipes/recipe_modules/chromium/resources/clang-format?format=TEXT"; - sha256 = "0ic3hn65dimgfhakli1cyf9j3cxcqsf1qib706ihfhmlzxf7256l"; + hash = "sha256-1BRxXP+0QgejAWdFHJzGrLMhk/MsRDoVdK/GVoyFg0U="; }; # The additional attributes for creating derivations based on the chromium # source tree. extraAttrs = buildFun base; - githubPatch = { commit, sha256, revert ? false }: fetchpatch { + githubPatch = { commit, hash, revert ? false }: fetchpatch { url = "https://github.com/chromium/chromium/commit/${commit}.patch"; - inherit sha256 revert; + inherit hash revert; }; mkGnFlags = @@ -118,7 +118,7 @@ let libExecPath = "$out/libexec/${packageName}"; ungoogler = ungoogled-chromium { - inherit (upstream-info.deps.ungoogled-patches) rev sha256; + inherit (upstream-info.deps.ungoogled-patches) rev hash; }; # There currently isn't a (much) more concise way to get a stdenv @@ -148,10 +148,10 @@ let else throw "no chromium Rosetta Stone entry for os: ${platform.config}"; }; - recompressTarball = { version, sha256 ? "" }: fetchzip { + recompressTarball = { version, hash ? "" }: fetchzip { name = "chromium-${version}.tar.zstd"; url = "https://commondatastorage.googleapis.com/chromium-browser-official/chromium-${version}.tar.xz"; - inherit sha256; + inherit hash; nativeBuildInputs = [ zstd ]; @@ -180,7 +180,7 @@ let inherit (upstream-info) version; inherit packageName buildType buildPath; - src = recompressTarball { inherit version; inherit (upstream-info) sha256; }; + src = recompressTarball { inherit version; inherit (upstream-info) hash; }; nativeBuildInputs = [ ninja pkg-config @@ -250,7 +250,7 @@ let (githubPatch { # Reland [clang] Disable autoupgrading debug info in ThinLTO builds commit = "54969766fd2029c506befc46e9ce14d67c7ed02a"; - sha256 = "sha256-Vryjg8kyn3cxWg3PmSwYRG6zrHOqYWBMSdEMGiaPg6M="; + hash = "sha256-Vryjg8kyn3cxWg3PmSwYRG6zrHOqYWBMSdEMGiaPg6M="; revert = true; }) ]; diff --git a/pkgs/applications/networking/browsers/chromium/default.nix b/pkgs/applications/networking/browsers/chromium/default.nix index 5677bc37e844..7c2c75e74974 100644 --- a/pkgs/applications/networking/browsers/chromium/default.nix +++ b/pkgs/applications/networking/browsers/chromium/default.nix @@ -57,7 +57,7 @@ let gnChromium = buildPackages.gn.overrideAttrs (oldAttrs: { inherit (upstream-info.deps.gn) version; src = fetchgit { - inherit (upstream-info.deps.gn) url rev sha256; + inherit (upstream-info.deps.gn) url rev hash; }; }); }); @@ -80,12 +80,12 @@ let chromeSrc = let # Use the latest stable Chrome version if necessary: - version = if chromium.upstream-info.sha256bin64 != null + version = if chromium.upstream-info.hash_deb_amd64 != null then chromium.upstream-info.version else (import ./upstream-info.nix).stable.version; - sha256 = if chromium.upstream-info.sha256bin64 != null - then chromium.upstream-info.sha256bin64 - else (import ./upstream-info.nix).stable.sha256bin64; + hash = if chromium.upstream-info.hash_deb_amd64 != null + then chromium.upstream-info.hash_deb_amd64 + else (import ./upstream-info.nix).stable.hash_deb_amd64; in fetchurl { urls = map (repo: "${repo}/${pkgName}/${pkgName}_${version}-1_amd64.deb") [ "https://dl.google.com/linux/chrome/deb/pool/main/g" @@ -93,7 +93,7 @@ let "http://mirror.pcbeta.com/google/chrome/deb/pool/main/g" "http://repo.fdzh.org/chrome/deb/pool/main/g" ]; - inherit sha256; + inherit hash; }; mkrpath = p: "${lib.makeSearchPathOutput "lib" "lib64" p}:${lib.makeLibraryPath p}"; diff --git a/pkgs/applications/networking/browsers/chromium/ungoogled.nix b/pkgs/applications/networking/browsers/chromium/ungoogled.nix index 549d2853776f..cf3d0a7d73ad 100644 --- a/pkgs/applications/networking/browsers/chromium/ungoogled.nix +++ b/pkgs/applications/networking/browsers/chromium/ungoogled.nix @@ -6,10 +6,10 @@ }: { rev -, sha256 +, hash }: -stdenv.mkDerivation rec { +stdenv.mkDerivation { pname = "ungoogled-chromium"; version = rev; @@ -17,7 +17,7 @@ stdenv.mkDerivation rec { src = fetchFromGitHub { owner = "ungoogled-software"; repo = "ungoogled-chromium"; - inherit rev sha256; + inherit rev hash; }; dontBuild = true; diff --git a/pkgs/applications/networking/browsers/chromium/upstream-info.nix b/pkgs/applications/networking/browsers/chromium/upstream-info.nix index b8004a7d4b39..29a15907cb36 100644 --- a/pkgs/applications/networking/browsers/chromium/upstream-info.nix +++ b/pkgs/applications/networking/browsers/chromium/upstream-info.nix @@ -3,63 +3,63 @@ deps = { gn = { rev = "811d332bd90551342c5cbd39e133aa276022d7f8"; - sha256 = "0jlg3d31p346na6a3yk0x29pm6b7q03ck423n5n6mi8nv4ybwajq"; + hash = "sha256-WCq+PNkWxWpssUOQyQbAZ5l6k+hg+qGMsoaMG0Ybj0o="; url = "https://gn.googlesource.com/gn"; version = "2023-08-01"; }; }; - sha256 = "0c3adrrgpnhm8g1546ask9pf17qj1sjgb950mj0rv4snxvddi75j"; - sha256bin64 = "11w1di146mjb9ql30df9yk9x4b9amc6514jzyfbf09mqsrw88dvr"; + hash = "sha256-spzY2u5Wk52BrKCk9aQOEp/gbppaGVLCQxXa+3JuajA="; + hash_deb_amd64 = "sha256-eTeEeNa4JuCW81+SUAyrKi3S0/TJNTAoTktWQ0JsgYc="; version = "117.0.5938.22"; }; dev = { deps = { gn = { rev = "cc56a0f98bb34accd5323316e0292575ff17a5d4"; - sha256 = "1ly7z48v147bfdb1kqkbc98myxpgqq3g6vgr8bjx1ikrk17l82ab"; + hash = "sha256-SwlET5h5xtDlQvlt8wbG73ZfUWJr4hlWc+uQsBH5x9M="; url = "https://gn.googlesource.com/gn"; version = "2023-08-10"; }; }; - sha256 = "16dq27lsywrn2xlgr5g46gdv15p30sihfamli4vkv3zxzfxdjisv"; - sha256bin64 = "11y09hsy7y1vg65xfilq44ffsmn15dqy80fa57psj1kin4a52v2x"; + hash = "sha256-W0fZuvv9jz03ibQqB6MG45aw2zPklfxoFzZzr+kRuJk="; + hash_deb_amd64 = "sha256-XWxRFLFxBqnvKcoB5HErwVbtHCGYRteLeTv44zVMwIc="; version = "118.0.5966.0"; }; stable = { chromedriver = { - sha256_darwin = "0y973bs4dbdrl152bfiq5avsp6h27j3v1kwgcgxk1d0g293322xs"; - sha256_darwin_aarch64 = - "04qrhr52qc9rhmslgsh2yymsix9cv32g39xbpf8576scihfdngv8"; - sha256_linux = "1hy3s6j20h03ria033kfxd3rq259davvpjny4gpvznzklns71vi1"; + hash_darwin = "sha256-ugsxRhIPtDD7Y4/PsIc8Apqrtyo4uiVKoLmtRvQaJ3k="; + hash_darwin_aarch64 = + "sha256-aD/bHIxMm1OQu6un8cTYLPWoq/cC6kd1hTkxLEqGGRM="; + hash_linux = "sha256-Ie5wtKXz27/vI97Ku7dqqQicR+tujgFUzANAIKTRw8M="; version = "118.0.5993.70"; }; deps = { gn = { rev = "cc56a0f98bb34accd5323316e0292575ff17a5d4"; - sha256 = "1ly7z48v147bfdb1kqkbc98myxpgqq3g6vgr8bjx1ikrk17l82ab"; + hash = "sha256-SwlET5h5xtDlQvlt8wbG73ZfUWJr4hlWc+uQsBH5x9M="; url = "https://gn.googlesource.com/gn"; version = "2023-08-10"; }; }; - sha256 = "sha256-CTkw92TiRD2tkYu5a5dy8fjpR2MMOMCvcbxXhJ36Bp8="; - sha256bin64 = "06rbsjh4khhl408181ns5nsdwasklb277fdjfajdv5h1j9a190k3"; + hash = "sha256-CTkw92TiRD2tkYu5a5dy8fjpR2MMOMCvcbxXhJ36Bp8="; + hash_deb_amd64 = "sha256-Y4IUVJIBlt2kcrK5c8SiUyvetC3aBhQQIBTCSaDUKxs="; version = "118.0.5993.88"; }; ungoogled-chromium = { deps = { gn = { rev = "cc56a0f98bb34accd5323316e0292575ff17a5d4"; - sha256 = "1ly7z48v147bfdb1kqkbc98myxpgqq3g6vgr8bjx1ikrk17l82ab"; + hash = "sha256-SwlET5h5xtDlQvlt8wbG73ZfUWJr4hlWc+uQsBH5x9M="; url = "https://gn.googlesource.com/gn"; version = "2023-08-10"; }; ungoogled-patches = { rev = "118.0.5993.88-1"; - sha256 = "17j47d64l97ascp85h8cnfnr5wr4va3bdk95wmagqss7ym5c7zsf"; + hash = "sha256-Tv/DSvVHa/xU5SXNtobaJPOSrbMMwYIu0+okSkw7RJ4="; }; }; - sha256 = "sha256-CTkw92TiRD2tkYu5a5dy8fjpR2MMOMCvcbxXhJ36Bp8="; - sha256bin64 = "06rbsjh4khhl408181ns5nsdwasklb277fdjfajdv5h1j9a190k3"; + hash = "sha256-CTkw92TiRD2tkYu5a5dy8fjpR2MMOMCvcbxXhJ36Bp8="; + hash_deb_amd64 = "sha256-Y4IUVJIBlt2kcrK5c8SiUyvetC3aBhQQIBTCSaDUKxs="; version = "118.0.5993.88"; }; } diff --git a/pkgs/development/tools/electron/info.json b/pkgs/development/tools/electron/info.json index 92c4ce68c63c..a3b470f78d7b 100644 --- a/pkgs/development/tools/electron/info.json +++ b/pkgs/development/tools/electron/info.json @@ -884,7 +884,7 @@ "version": "2023-09-12", "url": "https://gn.googlesource.com/gn", "rev": "991530ce394efb58fcd848195469022fa17ae126", - "sha256": "1zpbaspb2mncbsabps8n1iwzc67nhr79ndc9dnqxx1w1qfvaldg2" + "hash": "sha256-4jWqtsOBh96xbYk1m06G9hj2eQwW6buUXsxWsa5W6/4=" } } }, @@ -1776,7 +1776,7 @@ "version": "2023-08-10", "url": "https://gn.googlesource.com/gn", "rev": "cc56a0f98bb34accd5323316e0292575ff17a5d4", - "sha256": "1ly7z48v147bfdb1kqkbc98myxpgqq3g6vgr8bjx1ikrk17l82ab" + "hash": "sha256-SwlET5h5xtDlQvlt8wbG73ZfUWJr4hlWc+uQsBH5x9M=" } } }, @@ -2620,7 +2620,7 @@ "version": "2023-06-09", "url": "https://gn.googlesource.com/gn", "rev": "4bd1a77e67958fb7f6739bd4542641646f264e5d", - "sha256": "14h9jqspb86sl5lhh6q0kk2rwa9zcak63f8drp7kb3r4dx08vzsw" + "hash": "sha256-XP+NQG8kjzXPzQ25YaZiPymexZwAGwhpodqgdTWWCZI=" } } }, @@ -3440,7 +3440,7 @@ "version": "2023-04-19", "url": "https://gn.googlesource.com/gn", "rev": "5a004f9427a050c6c393c07ddb85cba8ff3849fa", - "sha256": "01xrh9m9m6x8lz0vxwdw2mrhrvnw93zpg09hwdhqakj06agf4jjk" + "hash": "sha256-U0rinjJAToVh4zCBd/9I3O4McxW88b7Bp6ibmmqCuQc=" } } }, diff --git a/pkgs/development/tools/selenium/chromedriver/default.nix b/pkgs/development/tools/selenium/chromedriver/default.nix index f17208fbfbdd..55ce40832f9e 100644 --- a/pkgs/development/tools/selenium/chromedriver/default.nix +++ b/pkgs/development/tools/selenium/chromedriver/default.nix @@ -10,17 +10,17 @@ let allSpecs = { x86_64-linux = { system = "linux64"; - sha256 = upstream-info.sha256_linux; + hash = upstream-info.hash_linux; }; x86_64-darwin = { system = "mac-x64"; - sha256 = upstream-info.sha256_darwin; + hash = upstream-info.hash_darwin; }; aarch64-darwin = { system = "mac-arm64"; - sha256 = upstream-info.sha256_darwin_aarch64; + hash = upstream-info.hash_darwin_aarch64; }; }; @@ -42,7 +42,7 @@ in stdenv.mkDerivation rec { src = fetchurl { url = "https://edgedl.me.gvt1.com/edgedl/chrome/chrome-for-testing/${version}/${spec.system}/chromedriver-${spec.system}.zip"; - sha256 = spec.sha256; + hash = spec.hash; }; nativeBuildInputs = [ unzip makeWrapper ]; From 8d3ab4e556a43e9c9fcd49212d6a02e25b08707e Mon Sep 17 00:00:00 2001 From: Fabian Affolter Date: Sat, 21 Oct 2023 14:39:58 +0200 Subject: [PATCH 210/222] python311Packages.ratelimiter: remove ratelimiter has been removed, since it is unmaintained and broken --- .../python-modules/ratelimiter/default.nix | 43 ------------------- pkgs/top-level/python-aliases.nix | 1 + pkgs/top-level/python-packages.nix | 2 - 3 files changed, 1 insertion(+), 45 deletions(-) delete mode 100644 pkgs/development/python-modules/ratelimiter/default.nix diff --git a/pkgs/development/python-modules/ratelimiter/default.nix b/pkgs/development/python-modules/ratelimiter/default.nix deleted file mode 100644 index 6c01a9e548c9..000000000000 --- a/pkgs/development/python-modules/ratelimiter/default.nix +++ /dev/null @@ -1,43 +0,0 @@ -{ lib -, buildPythonPackage -, fetchPypi -, pytest-asyncio -, pytestCheckHook -}: - -buildPythonPackage rec { - pname = "ratelimiter"; - version = "1.2.0.post0"; - format = "setuptools"; - - src = fetchPypi { - inherit pname version; - hash = "sha256-XDldyr273i5ReO8/ibVoowZkVKbdwiO3ZHPawi+JtPc="; - }; - - nativeCheckInputs = [ - pytest-asyncio - pytestCheckHook - ]; - - pythonImportsCheck = [ - "ratelimiter" - ]; - - preCheck = '' - # Uses out-dated options - rm tests/conftest.py - ''; - - disabledTests = [ - # TypeError: object Lock can't be used in 'await' expression - "test_alock" - ]; - - meta = with lib; { - description = "Simple python rate limiting object"; - homepage = "https://github.com/RazerM/ratelimiter"; - license = licenses.asl20; - maintainers = with maintainers; [ helkafen ]; - }; -} diff --git a/pkgs/top-level/python-aliases.nix b/pkgs/top-level/python-aliases.nix index 4e679de15084..164475b96eb8 100644 --- a/pkgs/top-level/python-aliases.nix +++ b/pkgs/top-level/python-aliases.nix @@ -354,6 +354,7 @@ mapAliases ({ Quandl = quandl; # added 2023-02-19 qiskit-aqua = throw "qiskit-aqua has been removed due to deprecation, with its functionality moved to different qiskit packages"; rabbitpy = throw "rabbitpy has been removed, since it is unmaintained and broken"; # added 2023-07-01 + ratelimiter = throw "ratelimiter has been removed, since it is unmaintained and broken"; # added 2023-10-21 rdflib-jsonld = throw "rdflib-jsonld is not compatible with rdflib 6"; # added 2021-11-05 recaptcha_client = throw "recaptcha_client has been removed since it is no longer maintained"; # added 2023-10-20 rednose = throw "rednose is no longer maintained (since February 2018)"; # added 2023-08-06 diff --git a/pkgs/top-level/python-packages.nix b/pkgs/top-level/python-packages.nix index ac62b89f9882..57c9a0eb33df 100644 --- a/pkgs/top-level/python-packages.nix +++ b/pkgs/top-level/python-packages.nix @@ -11995,8 +11995,6 @@ self: super: with self; { ratelimit = callPackage ../development/python-modules/ratelimit { }; - ratelimiter = callPackage ../development/python-modules/ratelimiter { }; - rauth = callPackage ../development/python-modules/rauth { }; raven = callPackage ../development/python-modules/raven { }; From 2fd6c3a3aa72874d1e806cc6b54d2d041e762439 Mon Sep 17 00:00:00 2001 From: Kai Norman Clasen Date: Sat, 21 Oct 2023 19:37:07 +0200 Subject: [PATCH 211/222] pgbouncer: meta add `mainProgram` --- pkgs/servers/sql/pgbouncer/default.nix | 1 + 1 file changed, 1 insertion(+) diff --git a/pkgs/servers/sql/pgbouncer/default.nix b/pkgs/servers/sql/pgbouncer/default.nix index 7f6cfa0f898a..dd47de907576 100644 --- a/pkgs/servers/sql/pgbouncer/default.nix +++ b/pkgs/servers/sql/pgbouncer/default.nix @@ -19,6 +19,7 @@ stdenv.mkDerivation rec { meta = with lib; { homepage = "https://www.pgbouncer.org/"; + mainProgram = "pgbouncer"; description = "Lightweight connection pooler for PostgreSQL"; changelog = "https://github.com/pgbouncer/pgbouncer/releases/tag/pgbouncer_${replaceStrings ["."] ["_"] version}"; license = licenses.isc; From 4d513ab5f170d66afa3387bdd718d41aa936ee9f Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Christina=20S=C3=B8rensen?= Date: Tue, 17 Oct 2023 20:22:43 +0200 Subject: [PATCH 212/222] nushell: 0.85.0 -> 0.86.0 MIME-Version: 1.0 Content-Type: text/plain; charset=UTF-8 Content-Transfer-Encoding: 8bit Signed-off-by: Christina Sørensen --- pkgs/shells/nushell/default.nix | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/pkgs/shells/nushell/default.nix b/pkgs/shells/nushell/default.nix index 34b8f9504f8b..acd7494fd3cc 100644 --- a/pkgs/shells/nushell/default.nix +++ b/pkgs/shells/nushell/default.nix @@ -22,7 +22,7 @@ }: let - version = "0.85.0"; + version = "0.86.0"; in rustPlatform.buildRustPackage { @@ -33,10 +33,10 @@ rustPlatform.buildRustPackage { owner = "nushell"; repo = "nushell"; rev = version; - hash = "sha256-/c3JTgIT+T41D0S7irQ0jq2MDzmx3os4pYpVr10cL3E="; + hash = "sha256-jUZKqsu0/RO4mc+hzjis1mNrohj1JzM17Z8e2Ggxlfs="; }; - cargoHash = "sha256-lBipwX72j0Af3PCat18s9NIjJiKZFZTcU9Utwt+eQzI="; + cargoHash = "sha256-WDGhuc2ZGDwfh7X/oRTZLzmKPj1jSnQFL4sy7KYt5Js="; nativeBuildInputs = [ pkg-config ] ++ lib.optionals (withDefaultFeatures && stdenv.isLinux) [ python3 ] From a26cc51f231fdb21e312feeb84d013b6b7851153 Mon Sep 17 00:00:00 2001 From: Paul Grandperrin Date: Sat, 21 Oct 2023 20:45:18 +0200 Subject: [PATCH 213/222] rclone: add filesystem helpers (#258487) This adds two symlinks to rclone: rclonefs and mount.rclone fixes #258478 --- pkgs/applications/networking/sync/rclone/default.nix | 4 ++++ 1 file changed, 4 insertions(+) diff --git a/pkgs/applications/networking/sync/rclone/default.nix b/pkgs/applications/networking/sync/rclone/default.nix index 2e6dd8fa7fde..cad0829b9c2b 100644 --- a/pkgs/applications/networking/sync/rclone/default.nix +++ b/pkgs/applications/networking/sync/rclone/default.nix @@ -41,6 +41,10 @@ buildGoModule rec { ${rcloneBin}/bin/rclone genautocomplete $shell rclone.$shell installShellCompletion rclone.$shell done + + # filesystem helpers + ln -s $out/bin/rclone $out/bin/rclonefs + ln -s $out/bin/rclone $out/bin/mount.rclone '' + lib.optionalString (enableCmount && !stdenv.isDarwin) # use --suffix here to ensure we don't shadow /run/wrappers/bin/fusermount, # as the setuid wrapper is required as non-root on NixOS. From 27cfb8a1aba4ba58a2c42d0bb1bd8a04aeaf6881 Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Sat, 21 Oct 2023 19:14:05 +0000 Subject: [PATCH 214/222] unciv: 4.8.9-patch2 -> 4.8.13 --- pkgs/games/unciv/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/games/unciv/default.nix b/pkgs/games/unciv/default.nix index f4b350ad38e7..70971fb1ad37 100644 --- a/pkgs/games/unciv/default.nix +++ b/pkgs/games/unciv/default.nix @@ -25,11 +25,11 @@ let in stdenv.mkDerivation rec { pname = "unciv"; - version = "4.8.9-patch2"; + version = "4.8.13"; src = fetchurl { url = "https://github.com/yairm210/Unciv/releases/download/${version}/Unciv.jar"; - hash = "sha256-ek2FDzo7EbgZGbQyZ6mBmVoPRKkJu0JFewbVvsGzZMA="; + hash = "sha256-16TpsKNLcm6lbi4exYxDZWfmRsvfAhT1ktP36zC9Psg="; }; dontUnpack = true; From 51d906d2341c9e866e48c2efcaac0f2d70bfd43e Mon Sep 17 00:00:00 2001 From: "R. Ryantm" Date: Thu, 19 Oct 2023 04:30:33 +0000 Subject: [PATCH 215/222] sacc: 1.06 -> 1.07 --- pkgs/applications/networking/gopher/sacc/default.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/applications/networking/gopher/sacc/default.nix b/pkgs/applications/networking/gopher/sacc/default.nix index 994423870398..686f671e13a5 100644 --- a/pkgs/applications/networking/gopher/sacc/default.nix +++ b/pkgs/applications/networking/gopher/sacc/default.nix @@ -4,11 +4,11 @@ stdenv.mkDerivation rec { pname = "sacc"; - version = "1.06"; + version = "1.07"; src = fetchurl { url = "ftp://bitreich.org/releases/sacc/sacc-${version}.tar.gz"; - hash = "sha512-eoleQy4dKLfZsrsqUybKMjUIdqLIDTncbBnnU0fXKkhH8apP8R8H6Kmt6hTqcbhNcIkNzBcP9s4Ld54dZYa0+g=="; + hash = "sha256-LdEeZH+JWb7iEEzikAXaxG0N5GMPxjgTId4THLgdU2w="; }; inherit patches; From 13b98764bbeee2a64ae147fce310eda8488af97a Mon Sep 17 00:00:00 2001 From: Einherjar Date: Sat, 21 Oct 2023 16:51:17 -0300 Subject: [PATCH 216/222] yazi: 0.1.4 -> 0.1.5 (#262500) MIME-Version: 1.0 Content-Type: text/plain; charset=UTF-8 Content-Transfer-Encoding: 8bit Co-authored-by: éclairevoyant <848000+eclairevoyant@users.noreply.github.com> --- pkgs/applications/file-managers/yazi/default.nix | 13 +++++++++---- 1 file changed, 9 insertions(+), 4 deletions(-) diff --git a/pkgs/applications/file-managers/yazi/default.nix b/pkgs/applications/file-managers/yazi/default.nix index 7757a1322b15..cd0476c1e00d 100644 --- a/pkgs/applications/file-managers/yazi/default.nix +++ b/pkgs/applications/file-managers/yazi/default.nix @@ -3,6 +3,7 @@ , lib , makeWrapper +, installShellFiles , stdenv , Foundation @@ -30,18 +31,18 @@ rustPlatform.buildRustPackage rec { pname = "yazi"; - version = "0.1.4"; + version = "0.1.5"; src = fetchFromGitHub { owner = "sxyazi"; repo = pname; rev = "v${version}"; - hash = "sha256-ARpludMVQlZtCRAfW0cNYVmT3m9t9lunMIW24peYX6Y="; + hash = "sha256-FhKrq4N32uJRHGc0qRl+CIVNRW597jACcTFEgj8hiSE="; }; - cargoHash = "sha256-dhdk5aGKv6tY8x7MmA0hWcmJBiXOXC92DlQTd/1AKtQ="; + cargoHash = "sha256-YUymZhDp1Pjm+W6m8Vmh2AgMCdaNt6TQQpiJwSg/gPw="; - nativeBuildInputs = [ makeWrapper ]; + nativeBuildInputs = [ makeWrapper installShellFiles ]; buildInputs = lib.optionals stdenv.isDarwin [ Foundation ]; postInstall = with lib; @@ -60,6 +61,10 @@ rustPlatform.buildRustPackage rec { '' wrapProgram $out/bin/yazi \ --prefix PATH : "${makeBinPath runtimePaths}" + installShellCompletion --cmd yazi \ + --bash ./config/completions/yazi.bash \ + --fish ./config/completions/yazi.fish \ + --zsh ./config/completions/_yazi ''; passthru.updateScript = nix-update-script { }; From d1df9108ba701b9a02945182e60da0a0201d2464 Mon Sep 17 00:00:00 2001 From: Rishi Desai Date: Tue, 25 Jul 2023 12:45:41 -0500 Subject: [PATCH 217/222] nixos/fanout: init fanout oneshot module --- nixos/modules/config/fanout.nix | 49 +++++++++++++++++++++++++++++++++ nixos/modules/module-list.nix | 1 + 2 files changed, 50 insertions(+) create mode 100644 nixos/modules/config/fanout.nix diff --git a/nixos/modules/config/fanout.nix b/nixos/modules/config/fanout.nix new file mode 100644 index 000000000000..60ee145f19af --- /dev/null +++ b/nixos/modules/config/fanout.nix @@ -0,0 +1,49 @@ +{ config, lib, pkgs, ... }: +let + cfg = config.services.fanout; + mknodCmds = n: lib.lists.imap0 (i: s: + "mknod /dev/fanout${builtins.toString i} c $MAJOR ${builtins.toString i}" + ) (lib.lists.replicate n ""); +in +{ + options.services.fanout = { + enable = lib.mkEnableOption (lib.mdDoc "fanout"); + fanoutDevices = lib.mkOption { + type = lib.types.int; + default = 1; + description = "Number of /dev/fanout devices"; + }; + bufferSize = lib.mkOption { + type = lib.types.int; + default = 16384; + description = "Size of /dev/fanout buffer in bytes"; + }; + }; + + config = lib.mkIf cfg.enable { + boot.extraModulePackages = [ config.boot.kernelPackages.fanout.out ]; + + boot.kernelModules = [ "fanout" ]; + + boot.extraModprobeConfig = '' + options fanout buffersize=${builtins.toString cfg.bufferSize} + ''; + + systemd.services.fanout = { + description = "Bring up /dev/fanout devices"; + script = '' + MAJOR=$(${pkgs.gnugrep}/bin/grep fanout /proc/devices | ${pkgs.gawk}/bin/awk '{print $1}') + ${lib.strings.concatLines (mknodCmds cfg.fanoutDevices)} + ''; + + wantedBy = [ "multi-user.target" ]; + + serviceConfig = { + Type = "oneshot"; + User = "root"; + RemainAfterExit = "yes"; + Restart = "no"; + }; + }; + }; +} diff --git a/nixos/modules/module-list.nix b/nixos/modules/module-list.nix index b32783d4e2e6..395a638033fe 100644 --- a/nixos/modules/module-list.nix +++ b/nixos/modules/module-list.nix @@ -2,6 +2,7 @@ ./config/appstream.nix ./config/console.nix ./config/debug-info.nix + ./config/fanout.nix ./config/fonts/fontconfig.nix ./config/fonts/fontdir.nix ./config/fonts/ghostscript.nix From 52effd56af02623fa2d2177430c8a1d2606bcbdb Mon Sep 17 00:00:00 2001 From: Rishi Desai Date: Tue, 25 Jul 2023 12:45:54 -0500 Subject: [PATCH 218/222] nixos/fanout: add test --- nixos/tests/all-tests.nix | 1 + nixos/tests/fanout.nix | 30 ++++++++++++++++++++++++++++++ 2 files changed, 31 insertions(+) create mode 100644 nixos/tests/fanout.nix diff --git a/nixos/tests/all-tests.nix b/nixos/tests/all-tests.nix index 9c62021a5cde..ef98efd7dbca 100644 --- a/nixos/tests/all-tests.nix +++ b/nixos/tests/all-tests.nix @@ -272,6 +272,7 @@ in { fail2ban = handleTest ./fail2ban.nix { }; fakeroute = handleTest ./fakeroute.nix {}; fancontrol = handleTest ./fancontrol.nix {}; + fanout = handleTest ./fanout.nix {}; fcitx5 = handleTest ./fcitx5 {}; fenics = handleTest ./fenics.nix {}; ferm = handleTest ./ferm.nix {}; diff --git a/nixos/tests/fanout.nix b/nixos/tests/fanout.nix new file mode 100644 index 000000000000..c36d34dcce0b --- /dev/null +++ b/nixos/tests/fanout.nix @@ -0,0 +1,30 @@ +{ system ? builtins.currentSystem +, config ? {} +, pkgs ? import ../.. { inherit system config; } +}: +import ./make-test-python.nix ({lib, pkgs, ...}: { + name = "fanout"; + meta.maintainers = [ lib.maintainers.therishidesai ]; + + nodes = let + cfg = { ... }: { + services.fanout = { + enable = true; + fanoutDevices = 2; + bufferSize = 8192; + }; + }; + in { + machine = cfg; + }; + + testScript = '' + start_all() + + # mDNS. + machine.wait_for_unit("multi-user.target") + + machine.succeed("test -c /dev/fanout0") + machine.succeed("test -c /dev/fanout1") + ''; +}) From cf9cf455783117075b678374693342dc1c6e804d Mon Sep 17 00:00:00 2001 From: Auguste Baum <52001167+augustebaum@users.noreply.github.com> Date: Sat, 21 Oct 2023 22:56:17 +0200 Subject: [PATCH 219/222] rustfmt: add `meta.mainProgram` --- pkgs/development/compilers/rust/rustfmt.nix | 1 + 1 file changed, 1 insertion(+) diff --git a/pkgs/development/compilers/rust/rustfmt.nix b/pkgs/development/compilers/rust/rustfmt.nix index b53be1633d56..40f6237dbe98 100644 --- a/pkgs/development/compilers/rust/rustfmt.nix +++ b/pkgs/development/compilers/rust/rustfmt.nix @@ -38,6 +38,7 @@ rustPlatform.buildRustPackage rec { description = "A tool for formatting Rust code according to style guidelines"; homepage = "https://github.com/rust-lang-nursery/rustfmt"; license = with licenses; [ mit asl20 ]; + mainProgram = "rustfmt"; maintainers = with maintainers; [ globin basvandijk ]; }; } From 57436cf549be6214e90ff99245e4f75b0469de02 Mon Sep 17 00:00:00 2001 From: Ivan Jager Date: Sat, 21 Oct 2023 16:29:13 -0500 Subject: [PATCH 220/222] nixos/firefox: Fix package references https://github.com/NixOS/nixpkgs/pull/262017 removed `with pkgs;` so setting `programs.firefox.enable = true` resulted in evaluation errors like `error: undefined variable 'ff2mpv'` This still doesn't fix https://github.com/NixOS/nixpkgs/issues/262600 --- nixos/modules/programs/firefox.nix | 10 +++++----- 1 file changed, 5 insertions(+), 5 deletions(-) diff --git a/nixos/modules/programs/firefox.nix b/nixos/modules/programs/firefox.nix index 99236f01c537..813e0e0105f6 100644 --- a/nixos/modules/programs/firefox.nix +++ b/nixos/modules/programs/firefox.nix @@ -224,11 +224,11 @@ in extraPrefs = cfg.autoConfig; extraNativeMessagingHosts = old.extraNativeMessagingHosts or [] - ++ optional nmh.ff2mpv ff2mpv - ++ optional nmh.euwebid web-eid-app - ++ optional nmh.gsconnect gnomeExtensions.gsconnect - ++ optional nmh.jabref jabref - ++ optional nmh.passff passff-host; + ++ optional nmh.ff2mpv pkgs.ff2mpv + ++ optional nmh.euwebid pkgs.web-eid-app + ++ optional nmh.gsconnect pkgs.gnomeExtensions.gsconnect + ++ optional nmh.jabref pkgs.jabref + ++ optional nmh.passff pkgs.passff-host; cfg = let # copy-pasted from the wrapper; TODO: figure out fix applicationName = cfg.package.binaryName or (lib.getName cfg.package); From 7aa1e5d83241aca86b124d4dbe1818765c574e0c Mon Sep 17 00:00:00 2001 From: Martin Weinelt Date: Sun, 22 Oct 2023 00:59:26 +0200 Subject: [PATCH 221/222] firefox-beta-unwrapped: 119.0b4 -> 119.0b9 --- pkgs/applications/networking/browsers/firefox/packages.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/applications/networking/browsers/firefox/packages.nix b/pkgs/applications/networking/browsers/firefox/packages.nix index 6d7e0198829f..27e0534ef5c1 100644 --- a/pkgs/applications/networking/browsers/firefox/packages.nix +++ b/pkgs/applications/networking/browsers/firefox/packages.nix @@ -30,11 +30,11 @@ firefox-beta = buildMozillaMach rec { pname = "firefox-beta"; - version = "119.0b4"; + version = "119.0b9"; applicationName = "Mozilla Firefox Beta"; src = fetchurl { url = "mirror://mozilla/firefox/releases/${version}/source/firefox-${version}.source.tar.xz"; - sha512 = "7c067d759602608e527d032f7a3772df827a5b5c4270992c05abda726fcd665f4f2c5380e684623ed108364ace4afaed8b5959f75a4b0540edd5ae30422b0e54"; + sha512 = "11d07474e3ca72a4e2f60053882e09a215e0d29d6830d0cd41447bb67370118356090af7adcbacd7703ad9fcdda83c9f909419c86b8f3bf2eacd9ca3d3aa3f54"; }; meta = { From 3c76fece1dc2e55e42f6d11b33121bf667972bf4 Mon Sep 17 00:00:00 2001 From: Martin Weinelt Date: Sun, 22 Oct 2023 01:00:00 +0200 Subject: [PATCH 222/222] firefox-devedition-unwrapped: 119.0b4 -> 119.0b9 --- pkgs/applications/networking/browsers/firefox/packages.nix | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/pkgs/applications/networking/browsers/firefox/packages.nix b/pkgs/applications/networking/browsers/firefox/packages.nix index 27e0534ef5c1..94f01b8af398 100644 --- a/pkgs/applications/networking/browsers/firefox/packages.nix +++ b/pkgs/applications/networking/browsers/firefox/packages.nix @@ -58,12 +58,12 @@ firefox-devedition = (buildMozillaMach rec { pname = "firefox-devedition"; - version = "119.0b4"; + version = "119.0b9"; applicationName = "Mozilla Firefox Developer Edition"; branding = "browser/branding/aurora"; src = fetchurl { url = "mirror://mozilla/devedition/releases/${version}/source/firefox-${version}.source.tar.xz"; - sha512 = "ded00bc1e090bdca5f32160d980cec47590bb952a6c7f1dc8f4df30fa452cad8c47a3c6d20cf3e8345fd5811777b475354d71d704c866fb49396a83c8a795bcb"; + sha512 = "ce3e2adb3171aa05c7af3b7a4ea25eaafbc109c522b90e26aad577192a0902000fb7d705fa5707a9a7d0be2ab1c0cddc5a98abbe6549e1377c0a1d765bda62eb"; }; meta = {