diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
index 32201333c37b..06b9c10dfec6 100644
--- a/CONTRIBUTING.md
+++ b/CONTRIBUTING.md
@@ -565,7 +565,7 @@ Names of files and directories should be in lowercase, with dashes between words
- Do not use tab characters, i.e. configure your editor to use soft tabs. For instance, use `(setq-default indent-tabs-mode nil)` in Emacs. Everybody has different tab settings so it’s asking for trouble.
-- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [](#sec-package-naming).
+- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [package naming](./pkgs/README.md#package-naming).
- Function calls with attribute set arguments are written as
diff --git a/doc/languages-frameworks/dart.section.md b/doc/languages-frameworks/dart.section.md
index b00327b78eb2..8d9c062f4220 100644
--- a/doc/languages-frameworks/dart.section.md
+++ b/doc/languages-frameworks/dart.section.md
@@ -12,6 +12,8 @@ If you are packaging a Flutter desktop application, use [`buildFlutterApplicatio
If the upstream source is missing a `pubspec.lock` file, you'll have to vendor one and specify it using `pubspecLockFile`. If it is needed, one will be generated for you and printed when attempting to build the derivation.
+The `depsListFile` must always be provided when packaging in Nixpkgs. It will be generated and printed if the derivation is attempted to be built without one. Alternatively, `autoDepsList` may be set to `true` only when outside of Nixpkgs, as it relies on import-from-derivation.
+
The `dart` commands run can be overridden through `pubGetScript` and `dartCompileCommand`, you can also add flags using `dartCompileFlags` or `dartJitFlags`.
Dart supports multiple [outputs types](https://dart.dev/tools/dart-compile#types-of-output), you can choose between them using `dartOutputType` (defaults to `exe`). If you want to override the binaries path or the source path they come from, you can use `dartEntryPoints`. Outputs that require a runtime will automatically be wrapped with the relevant runtime (`dartaotruntime` for `aot-snapshot`, `dart run` for `jit-snapshot` and `kernel`, `node` for `js`), this can be overridden through `dartRuntimeCommand`.
@@ -31,6 +33,7 @@ buildDartApplication rec {
};
pubspecLockFile = ./pubspec.lock;
+ depsListFile = ./deps.json;
vendorHash = "sha256-Atm7zfnDambN/BmmUf4BG0yUz/y6xWzf0reDw3Ad41s=";
}
```
@@ -39,9 +42,7 @@ buildDartApplication rec {
The function `buildFlutterApplication` builds Flutter applications.
-The deps.json file must always be provided when packaging in Nixpkgs. It will be generated and printed if the derivation is attempted to be built without one. Alternatively, `autoDepsList` may be set to `true` when outside of Nixpkgs, as it relies on import-from-derivation.
-
-A `pubspec.lock` file must be available. See the [Dart documentation](#ssec-dart-applications) for more details.
+See the [Dart documentation](#ssec-dart-applications) for more details on required files and arguments.
```nix
{ flutter, fetchFromGitHub }:
diff --git a/doc/languages-frameworks/python.section.md b/doc/languages-frameworks/python.section.md
index 40236d141d3d..cdd5c806912e 100644
--- a/doc/languages-frameworks/python.section.md
+++ b/doc/languages-frameworks/python.section.md
@@ -12,6 +12,7 @@
| python310 | python3 | CPython 3.10 |
| python311 | | CPython 3.11 |
| python312 | | CPython 3.12 |
+| python313 | | CPython 3.13 |
| pypy27 | pypy2, pypy | PyPy2.7 |
| pypy39 | pypy3 | PyPy 3.9 |
diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix
index 5294b18995e1..403e2841839b 100644
--- a/maintainers/maintainer-list.nix
+++ b/maintainers/maintainer-list.nix
@@ -1274,6 +1274,9 @@
github = "antonmosich";
githubId = 27223336;
name = "Anton Mosich";
+ keys = [ {
+ fingerprint = "F401 287C 324F 0A1C B321 657B 9B96 97B8 FB18 7D14";
+ } ];
};
antono = {
email = "self@antono.info";
@@ -3874,6 +3877,12 @@
githubId = 50051176;
name = "Daniel Rolls";
};
+ danielsidhion = {
+ email = "nixpkgs@sidhion.com";
+ github = "DanielSidhion";
+ githubId = 160084;
+ name = "Daniel Sidhion";
+ };
daniyalsuri6 = {
email = "daniyal.suri@gmail.com";
github = "daniyalsuri6";
@@ -6190,6 +6199,16 @@
githubId = 45048741;
name = "Alwanga Oyango";
};
+ galaxy = {
+ email = "galaxy@dmc.chat";
+ matrix = "@galaxy:mozilla.org";
+ name = "The Galaxy";
+ github = "ga1aksy";
+ githubId = 148551648;
+ keys = [{
+ fingerprint = "48CA 3873 9E9F CA8E 76A0 835A E3DE CF85 4212 E1EA";
+ }];
+ };
gal_bolle = {
email = "florent.becker@ens-lyon.org";
github = "FlorentBecker";
@@ -6622,6 +6641,12 @@
githubId = 4656860;
name = "Gaute Ravndal";
};
+ gray-heron = {
+ email = "ave+nix@cezar.info";
+ github = "gray-heron";
+ githubId = 7032646;
+ name = "Cezary Siwek";
+ };
graysonhead = {
email = "grayson@graysonhead.net";
github = "graysonhead";
@@ -7219,6 +7244,7 @@
};
hubble = {
name = "Hubble the Wolverine";
+ email = "hubblethewolverine@gmail.com";
matrix = "@hubofeverything:bark.lgbt";
github = "the-furry-hubofeverything";
githubId = 53921912;
@@ -10923,6 +10949,12 @@
githubId = 29855073;
name = "Michael Colicchia";
};
+ massimogengarelli = {
+ email = "massimo.gengarelli@gmail.com";
+ github = "massix";
+ githubId = 585424;
+ name = "Massimo Gengarelli";
+ };
matejc = {
email = "cotman.matej@gmail.com";
github = "matejc";
@@ -13642,6 +13674,12 @@
githubId = 152312;
name = "Periklis Tsirakidis";
};
+ perstark = {
+ email = "perstark.se@gmail.com";
+ github = "perstarkse";
+ githubId = 63069986;
+ name = "Per Stark";
+ };
petercommand = {
email = "petercommand@gmail.com";
github = "petercommand";
@@ -13910,6 +13948,12 @@
githubId = 610615;
name = "Chih-Mao Chen";
};
+ pks = {
+ email = "ps@pks.im";
+ github = "pks-t";
+ githubId = 4056630;
+ name = "Patrick Steinhardt";
+ };
plabadens = {
name = "Pierre Labadens";
email = "labadens.pierre+nixpkgs@gmail.com";
@@ -17804,6 +17848,12 @@
githubId = 858790;
name = "Tobias Mayer";
};
+ tochiaha = {
+ email = "tochiahan@proton.me";
+ github = "Tochiaha";
+ githubId = 74688871;
+ name = "Tochukwu Ahanonu";
+ };
tokudan = {
email = "git@danielfrank.net";
github = "tokudan";
@@ -17849,6 +17899,10 @@
githubId = 13155277;
name = "Tom Houle";
};
+ tomkoid = {
+ email = "tomaszierl@outlook.com";
+ name = "Tomkoid";
+ };
tomodachi94 = {
email = "tomodachi94+nixpkgs@protonmail.com";
matrix = "@tomodachi94:matrix.org";
@@ -18004,6 +18058,12 @@
githubId = 15064765;
name = "tshaynik";
};
+ tsowell = {
+ email = "tom@ldtlb.com";
+ github = "tsowell";
+ githubId = 4044033;
+ name = "Thomas Sowell";
+ };
ttuegel = {
email = "ttuegel@mailbox.org";
github = "ttuegel";
@@ -19356,6 +19416,11 @@
github = "ymeister";
githubId = 47071325;
};
+ ymstnt = {
+ name = "YMSTNT";
+ github = "ymstnt";
+ githubId = 21342713;
+ };
yoavlavi = {
email = "yoav@yoavlavi.com";
github = "yoav-lavi";
diff --git a/maintainers/scripts/luarocks-packages.csv b/maintainers/scripts/luarocks-packages.csv
index 5897948a9f83..f03ef4fa09c9 100644
--- a/maintainers/scripts/luarocks-packages.csv
+++ b/maintainers/scripts/luarocks-packages.csv
@@ -16,6 +16,7 @@ cyrussasl,https://github.com/JorjBauer/lua-cyrussasl.git,,,,,
digestif,https://github.com/astoff/digestif.git,,,0.2-1,5.3,
dkjson,,,,,,
fennel,,,,,,misterio77
+ferris.nvim,,,,,,mrcjkb
fifo,,,,,,
fluent,,,,,,alerque
gitsigns.nvim,https://github.com/lewis6991/gitsigns.nvim.git,,,,5.1,
diff --git a/nixos/doc/manual/release-notes/rl-2311.section.md b/nixos/doc/manual/release-notes/rl-2311.section.md
index 38c89668f84a..4e7d116e1e47 100644
--- a/nixos/doc/manual/release-notes/rl-2311.section.md
+++ b/nixos/doc/manual/release-notes/rl-2311.section.md
@@ -113,6 +113,8 @@
- [virt-manager](https://virt-manager.org/), an UI for managing virtual machines in libvirt, is now available as `programs.virt-manager`.
+- [Soft Serve](https://github.com/charmbracelet/soft-serve), a tasty, self-hostable Git server for the command line. Available as [services.soft-serve](#opt-services.soft-serve.enable).
+
## Backward Incompatibilities {#sec-release-23.11-incompatibilities}
- `network-online.target` has been fixed to no longer time out for systems with `networking.useDHCP = true` and `networking.useNetworkd = true`.
@@ -341,6 +343,8 @@
- `jq` was updated to 1.7, its [first release in 5 years](https://github.com/jqlang/jq/releases/tag/jq-1.7).
+- `zfs` was updated from 2.1.x to 2.2.0, [enabling newer kernel support and adding new features](https://github.com/openzfs/zfs/releases/tag/zfs-2.2.0).
+
- A new option was added to the virtualisation module that enables specifying explicitly named network interfaces in QEMU VMs. The existing `virtualisation.vlans` is still supported for cases where the name of the network interface is irrelevant.
- DocBook option documentation is no longer supported, all module documentation now uses markdown.
@@ -398,6 +402,8 @@ The module update takes care of the new config syntax and the data itself (user
- Suricata was upgraded from 6.0 to 7.0 and no longer considers HTTP/2 support as experimental, see [upstream release notes](https://forum.suricata.io/t/suricata-7-0-0-released/3715) for more details.
+- Cloud support in the `netdata` package is now disabled by default. To enable it use the `netdataCloud` package.
+
- `networking.nftables` now has the option `networking.nftables.table.
` to create tables
and have them be updated atomically, instead of flushing the ruleset.
diff --git a/nixos/lib/test-driver/test_driver/machine.py b/nixos/lib/test-driver/test_driver/machine.py
index 7ed001a1dfce..b1688cd3b64f 100644
--- a/nixos/lib/test-driver/test_driver/machine.py
+++ b/nixos/lib/test-driver/test_driver/machine.py
@@ -791,6 +791,28 @@ class Machine:
with self.nested(f"waiting for TCP port {port} on {addr}"):
retry(port_is_open, timeout)
+ def wait_for_open_unix_socket(
+ self, addr: str, is_datagram: bool = False, timeout: int = 900
+ ) -> None:
+ """
+ Wait until a process is listening on the given UNIX-domain socket
+ (default to a UNIX-domain stream socket).
+ """
+
+ nc_flags = [
+ "-z",
+ "-uU" if is_datagram else "-U",
+ ]
+
+ def socket_is_open(_: Any) -> bool:
+ status, _ = self.execute(f"nc {' '.join(nc_flags)} {addr}")
+ return status == 0
+
+ with self.nested(
+ f"waiting for UNIX-domain {'datagram' if is_datagram else 'stream'} on '{addr}'"
+ ):
+ retry(socket_is_open, timeout)
+
def wait_for_closed_port(
self, port: int, addr: str = "localhost", timeout: int = 900
) -> None:
diff --git a/nixos/modules/config/fanout.nix b/nixos/modules/config/fanout.nix
new file mode 100644
index 000000000000..60ee145f19af
--- /dev/null
+++ b/nixos/modules/config/fanout.nix
@@ -0,0 +1,49 @@
+{ config, lib, pkgs, ... }:
+let
+ cfg = config.services.fanout;
+ mknodCmds = n: lib.lists.imap0 (i: s:
+ "mknod /dev/fanout${builtins.toString i} c $MAJOR ${builtins.toString i}"
+ ) (lib.lists.replicate n "");
+in
+{
+ options.services.fanout = {
+ enable = lib.mkEnableOption (lib.mdDoc "fanout");
+ fanoutDevices = lib.mkOption {
+ type = lib.types.int;
+ default = 1;
+ description = "Number of /dev/fanout devices";
+ };
+ bufferSize = lib.mkOption {
+ type = lib.types.int;
+ default = 16384;
+ description = "Size of /dev/fanout buffer in bytes";
+ };
+ };
+
+ config = lib.mkIf cfg.enable {
+ boot.extraModulePackages = [ config.boot.kernelPackages.fanout.out ];
+
+ boot.kernelModules = [ "fanout" ];
+
+ boot.extraModprobeConfig = ''
+ options fanout buffersize=${builtins.toString cfg.bufferSize}
+ '';
+
+ systemd.services.fanout = {
+ description = "Bring up /dev/fanout devices";
+ script = ''
+ MAJOR=$(${pkgs.gnugrep}/bin/grep fanout /proc/devices | ${pkgs.gawk}/bin/awk '{print $1}')
+ ${lib.strings.concatLines (mknodCmds cfg.fanoutDevices)}
+ '';
+
+ wantedBy = [ "multi-user.target" ];
+
+ serviceConfig = {
+ Type = "oneshot";
+ User = "root";
+ RemainAfterExit = "yes";
+ Restart = "no";
+ };
+ };
+ };
+}
diff --git a/nixos/modules/module-list.nix b/nixos/modules/module-list.nix
index 79918f71f7be..395a638033fe 100644
--- a/nixos/modules/module-list.nix
+++ b/nixos/modules/module-list.nix
@@ -2,6 +2,7 @@
./config/appstream.nix
./config/console.nix
./config/debug-info.nix
+ ./config/fanout.nix
./config/fonts/fontconfig.nix
./config/fonts/fontdir.nix
./config/fonts/ghostscript.nix
@@ -730,6 +731,7 @@
./services/misc/signald.nix
./services/misc/siproxd.nix
./services/misc/snapper.nix
+ ./services/misc/soft-serve.nix
./services/misc/sonarr.nix
./services/misc/sourcehut
./services/misc/spice-vdagentd.nix
@@ -1154,6 +1156,7 @@
./services/security/hologram-agent.nix
./services/security/hologram-server.nix
./services/security/infnoise.nix
+ ./services/security/jitterentropy-rngd.nix
./services/security/kanidm.nix
./services/security/munge.nix
./services/security/nginx-sso.nix
diff --git a/nixos/modules/programs/firefox.nix b/nixos/modules/programs/firefox.nix
index 83a3edaf813e..813e0e0105f6 100644
--- a/nixos/modules/programs/firefox.nix
+++ b/nixos/modules/programs/firefox.nix
@@ -220,23 +220,20 @@ in
config = mkIf cfg.enable {
environment.systemPackages = [
- (cfg.package.override {
+ (cfg.package.override (old: {
extraPrefs = cfg.autoConfig;
- extraNativeMessagingHosts = with pkgs; optionals nmh.ff2mpv [
- ff2mpv
- ] ++ optionals nmh.euwebid [
- web-eid-app
- ] ++ optionals nmh.gsconnect [
- gnomeExtensions.gsconnect
- ] ++ optionals nmh.jabref [
- jabref
- ] ++ optionals nmh.passff [
- passff-host
- ];
+ extraNativeMessagingHosts =
+ old.extraNativeMessagingHosts or []
+ ++ optional nmh.ff2mpv pkgs.ff2mpv
+ ++ optional nmh.euwebid pkgs.web-eid-app
+ ++ optional nmh.gsconnect pkgs.gnomeExtensions.gsconnect
+ ++ optional nmh.jabref pkgs.jabref
+ ++ optional nmh.passff pkgs.passff-host;
cfg = let
# copy-pasted from the wrapper; TODO: figure out fix
applicationName = cfg.package.binaryName or (lib.getName cfg.package);
+ oldCfg = old.cfg or {};
nixpkgsConfig = pkgs.config.${applicationName} or {};
optionConfig = cfg.wrapperConfig;
nmhConfig = {
@@ -246,8 +243,8 @@ in
enableUgetIntegrator = nmh.ugetIntegrator;
enableFXCastBridge = nmh.fxCast;
};
- in nixpkgsConfig // optionConfig // nmhConfig;
- })
+ in oldCfg // nixpkgsConfig // optionConfig // nmhConfig;
+ }))
];
environment.etc =
diff --git a/nixos/modules/services/cluster/hadoop/default.nix b/nixos/modules/services/cluster/hadoop/default.nix
index 72bf25c21146..ff6b4d5588b1 100644
--- a/nixos/modules/services/cluster/hadoop/default.nix
+++ b/nixos/modules/services/cluster/hadoop/default.nix
@@ -67,16 +67,16 @@ with lib;
mapredSiteDefault = mkOption {
default = {
"mapreduce.framework.name" = "yarn";
- "yarn.app.mapreduce.am.env" = "HADOOP_MAPRED_HOME=${cfg.package}/lib/${cfg.package.untarDir}";
- "mapreduce.map.env" = "HADOOP_MAPRED_HOME=${cfg.package}/lib/${cfg.package.untarDir}";
- "mapreduce.reduce.env" = "HADOOP_MAPRED_HOME=${cfg.package}/lib/${cfg.package.untarDir}";
+ "yarn.app.mapreduce.am.env" = "HADOOP_MAPRED_HOME=${cfg.package}";
+ "mapreduce.map.env" = "HADOOP_MAPRED_HOME=${cfg.package}";
+ "mapreduce.reduce.env" = "HADOOP_MAPRED_HOME=${cfg.package}";
};
defaultText = literalExpression ''
{
"mapreduce.framework.name" = "yarn";
- "yarn.app.mapreduce.am.env" = "HADOOP_MAPRED_HOME=''${config.${opt.package}}/lib/''${config.${opt.package}.untarDir}";
- "mapreduce.map.env" = "HADOOP_MAPRED_HOME=''${config.${opt.package}}/lib/''${config.${opt.package}.untarDir}";
- "mapreduce.reduce.env" = "HADOOP_MAPRED_HOME=''${config.${opt.package}}/lib/''${config.${opt.package}.untarDir}";
+ "yarn.app.mapreduce.am.env" = "HADOOP_MAPRED_HOME=''${config.${opt.package}}";
+ "mapreduce.map.env" = "HADOOP_MAPRED_HOME=''${config.${opt.package}}";
+ "mapreduce.reduce.env" = "HADOOP_MAPRED_HOME=''${config.${opt.package}}";
}
'';
type = types.attrsOf types.anything;
@@ -154,13 +154,13 @@ with lib;
};
log4jProperties = mkOption {
- default = "${cfg.package}/lib/${cfg.package.untarDir}/etc/hadoop/log4j.properties";
+ default = "${cfg.package}/etc/hadoop/log4j.properties";
defaultText = literalExpression ''
- "''${config.${opt.package}}/lib/''${config.${opt.package}.untarDir}/etc/hadoop/log4j.properties"
+ "''${config.${opt.package}}/etc/hadoop/log4j.properties"
'';
type = types.path;
example = literalExpression ''
- "''${pkgs.hadoop}/lib/''${pkgs.hadoop.untarDir}/etc/hadoop/log4j.properties";
+ "''${pkgs.hadoop}/etc/hadoop/log4j.properties";
'';
description = lib.mdDoc "log4j.properties file added to HADOOP_CONF_DIR";
};
diff --git a/nixos/modules/services/cluster/hadoop/yarn.nix b/nixos/modules/services/cluster/hadoop/yarn.nix
index 26077f35fdd0..a49aafbd1dca 100644
--- a/nixos/modules/services/cluster/hadoop/yarn.nix
+++ b/nixos/modules/services/cluster/hadoop/yarn.nix
@@ -160,7 +160,7 @@ in
umount /run/wrappers/yarn-nodemanager/cgroup/cpu || true
rm -rf /run/wrappers/yarn-nodemanager/ || true
mkdir -p /run/wrappers/yarn-nodemanager/{bin,etc/hadoop,cgroup/cpu}
- cp ${cfg.package}/lib/${cfg.package.untarDir}/bin/container-executor /run/wrappers/yarn-nodemanager/bin/
+ cp ${cfg.package}/bin/container-executor /run/wrappers/yarn-nodemanager/bin/
chgrp hadoop /run/wrappers/yarn-nodemanager/bin/container-executor
chmod 6050 /run/wrappers/yarn-nodemanager/bin/container-executor
cp ${hadoopConf}/container-executor.cfg /run/wrappers/yarn-nodemanager/etc/hadoop/
diff --git a/nixos/modules/services/games/asf.nix b/nixos/modules/services/games/asf.nix
index f15d7077d965..432de6336ce2 100644
--- a/nixos/modules/services/games/asf.nix
+++ b/nixos/modules/services/games/asf.nix
@@ -187,29 +187,41 @@ in
Group = "asf";
WorkingDirectory = cfg.dataDir;
Type = "simple";
- ExecStart = "${cfg.package}/bin/ArchiSteamFarm --path ${cfg.dataDir} --process-required --no-restart --service --no-config-migrate";
+ ExecStart = "${lib.getExe cfg.package} --no-restart --process-required --service --system-required --path ${cfg.dataDir}";
Restart = "always";
- # mostly copied from the default systemd service
- PrivateTmp = true;
+ # copied from the default systemd service at
+ # https://github.com/JustArchiNET/ArchiSteamFarm/blob/main/ArchiSteamFarm/overlay/variant-base/linux/ArchiSteamFarm%40.service
+ CapabilityBoundingSet = "";
+ DevicePolicy = "closed";
LockPersonality = true;
+ NoNewPrivileges = true;
PrivateDevices = true;
PrivateIPC = true;
PrivateMounts = true;
+ PrivateTmp = true; # instead of rw /tmp
PrivateUsers = true;
+ ProcSubset = "pid";
ProtectClock = true;
ProtectControlGroups = true;
+ ProtectHome = true;
ProtectHostname = true;
ProtectKernelLogs = true;
ProtectKernelModules = true;
ProtectKernelTunables = true;
ProtectProc = "invisible";
- ProtectSystem = "full";
+ ProtectSystem = "strict";
RemoveIPC = true;
- RestrictAddressFamilies = "AF_INET AF_INET6";
+ RestrictAddressFamilies = "AF_INET AF_INET6 AF_NETLINK AF_UNIX";
RestrictNamespaces = true;
RestrictRealtime = true;
RestrictSUIDSGID = true;
+ SystemCallArchitectures = "native";
+ UMask = "0077";
+
+ # we luckily already have systemd v247+
+ SecureBits = "noroot-locked";
+ SystemCallFilter = [ "@system-service" "~@privileged" ];
}
];
diff --git a/nixos/modules/services/misc/soft-serve.nix b/nixos/modules/services/misc/soft-serve.nix
new file mode 100644
index 000000000000..0f246493880b
--- /dev/null
+++ b/nixos/modules/services/misc/soft-serve.nix
@@ -0,0 +1,99 @@
+{ config, lib, pkgs, ... }:
+
+with lib;
+
+let
+ cfg = config.services.soft-serve;
+ configFile = format.generate "config.yaml" cfg.settings;
+ format = pkgs.formats.yaml { };
+ docUrl = "https://charm.sh/blog/self-hosted-soft-serve/";
+ stateDir = "/var/lib/soft-serve";
+in
+{
+ options = {
+ services.soft-serve = {
+ enable = mkEnableOption "Enable soft-serve service";
+
+ package = mkPackageOption pkgs "soft-serve" { };
+
+ settings = mkOption {
+ type = format.type;
+ default = { };
+ description = mdDoc ''
+ The contents of the configuration file.
+
+ See <${docUrl}>.
+ '';
+ example = literalExpression ''
+ {
+ name = "dadada's repos";
+ log_format = "text";
+ ssh = {
+ listen_addr = ":23231";
+ public_url = "ssh://localhost:23231";
+ max_timeout = 30;
+ idle_timeout = 120;
+ };
+ stats.listen_addr = ":23233";
+ }
+ '';
+ };
+ };
+ };
+
+ config = mkIf cfg.enable {
+
+ systemd.tmpfiles.rules = [
+ # The config file has to be inside the state dir
+ "L+ ${stateDir}/config.yaml - - - - ${configFile}"
+ ];
+
+ systemd.services.soft-serve = {
+ description = "Soft Serve git server";
+ documentation = [ docUrl ];
+ requires = [ "network-online.target" ];
+ after = [ "network-online.target" ];
+ wantedBy = [ "multi-user.target" ];
+
+ environment.SOFT_SERVE_DATA_PATH = stateDir;
+
+ serviceConfig = {
+ Type = "simple";
+ DynamicUser = true;
+ Restart = "always";
+ ExecStart = "${getExe cfg.package} serve";
+ StateDirectory = "soft-serve";
+ WorkingDirectory = stateDir;
+ RuntimeDirectory = "soft-serve";
+ RuntimeDirectoryMode = "0750";
+ ProcSubset = "pid";
+ ProtectProc = "invisible";
+ UMask = "0027";
+ CapabilityBoundingSet = "";
+ ProtectHome = true;
+ PrivateDevices = true;
+ PrivateUsers = true;
+ ProtectHostname = true;
+ ProtectClock = true;
+ ProtectKernelTunables = true;
+ ProtectKernelModules = true;
+ ProtectKernelLogs = true;
+ ProtectControlGroups = true;
+ RestrictAddressFamilies = [ "AF_UNIX" "AF_INET" "AF_INET6" ];
+ RestrictNamespaces = true;
+ LockPersonality = true;
+ MemoryDenyWriteExecute = true;
+ RestrictRealtime = true;
+ RemoveIPC = true;
+ PrivateMounts = true;
+ SystemCallArchitectures = "native";
+ SystemCallFilter = [
+ "@system-service"
+ "~@cpu-emulation @debug @keyring @module @mount @obsolete @privileged @raw-io @reboot @setuid @swap"
+ ];
+ };
+ };
+ };
+
+ meta.maintainers = [ maintainers.dadada ];
+}
diff --git a/nixos/modules/services/networking/networkmanager.nix b/nixos/modules/services/networking/networkmanager.nix
index 53c847ee3ca2..d32712c8243d 100644
--- a/nixos/modules/services/networking/networkmanager.nix
+++ b/nixos/modules/services/networking/networkmanager.nix
@@ -4,6 +4,7 @@ with lib;
let
cfg = config.networking.networkmanager;
+ ini = pkgs.formats.ini { };
delegateWireless = config.networking.wireless.enable == true && cfg.unmanaged != [ ];
@@ -379,6 +380,74 @@ in
https://modemmanager.org/docs/modemmanager/fcc-unlock/#integration-with-third-party-fcc-unlock-tools.
'';
};
+ ensureProfiles = {
+ profiles = with lib.types; mkOption {
+ type = attrsOf (submodule {
+ freeformType = ini.type;
+
+ options = {
+ connection = {
+ id = lib.mkOption {
+ type = str;
+ description = "This is the name that will be displayed by NetworkManager and GUIs.";
+ };
+ type = lib.mkOption {
+ type = str;
+ description = "The connection type defines the connection kind, like vpn, wireguard, gsm, wifi and more.";
+ example = "vpn";
+ };
+ };
+ };
+ });
+ apply = (lib.filterAttrsRecursive (n: v: v != { }));
+ default = { };
+ example = {
+ home-wifi = {
+ connection = {
+ id = "home-wifi";
+ type = "wifi";
+ permissions = "";
+ };
+ wifi = {
+ mac-address-blacklist = "";
+ mode = "infrastructure";
+ ssid = "Home Wi-Fi";
+ };
+ wifi-security = {
+ auth-alg = "open";
+ key-mgmt = "wpa-psk";
+ psk = "$HOME_WIFI_PASSWORD";
+ };
+ ipv4 = {
+ dns-search = "";
+ method = "auto";
+ };
+ ipv6 = {
+ addr-gen-mode = "stable-privacy";
+ dns-search = "";
+ method = "auto";
+ };
+ };
+ };
+ description = lib.mdDoc ''
+ Declaratively define NetworkManager profiles. You can find information about the generated file format [here](https://networkmanager.dev/docs/api/latest/nm-settings-keyfile.html) and [here](https://access.redhat.com/documentation/en-us/red_hat_enterprise_linux/8/html/configuring_and_managing_networking/assembly_networkmanager-connection-profiles-in-keyfile-format_configuring-and-managing-networking).
+ You current profiles which are most likely stored in `/etc/NetworkManager/system-connections` and there is [a tool](https://github.com/janik-haag/nm2nix) to convert them to the needed nix code.
+ If you add a new ad-hoc connection via a GUI or nmtui or anything similar it should just work together with the declarative ones.
+ And if you edit a declarative profile NetworkManager will move it to the persistent storage and treat it like a ad-hoc one,
+ but there will be two profiles as soon as the systemd unit from this option runs again which can be confusing since NetworkManager tools will start displaying two profiles with the same name and probably a bit different settings depending on what you edited.
+ A profile won't be deleted even if it's removed from the config until the system reboots because that's when NetworkManager clears it's temp directory.
+ '';
+ };
+ environmentFiles = mkOption {
+ default = [];
+ type = types.listOf types.path;
+ example = [ "/run/secrets/network-manager.env" ];
+ description = lib.mdDoc ''
+ Files to load as environment file. Environment variables from this file
+ will be substituted into the static configuration file using [envsubst](https://github.com/a8m/envsubst).
+ '';
+ };
+ };
};
};
@@ -507,6 +576,30 @@ in
aliases = [ "dbus-org.freedesktop.nm-dispatcher.service" ];
};
+ systemd.services.NetworkManager-ensure-profiles = mkIf (cfg.ensureProfiles.profiles != { }) {
+ description = "Ensure that NetworkManager declarative profiles are created";
+ wantedBy = [ "multi-user.target" ];
+ before = [ "network-online.target" ];
+ script = let
+ path = id: "/run/NetworkManager/system-connections/${id}.nmconnection";
+ in ''
+ mkdir -p /run/NetworkManager/system-connections
+ '' + lib.concatMapStringsSep "\n"
+ (profile: ''
+ ${pkgs.envsubst}/bin/envsubst -i ${ini.generate (lib.escapeShellArg profile.n) profile.v} > ${path (lib.escapeShellArg profile.n)}
+ '') (lib.mapAttrsToList (n: v: { inherit n v; }) cfg.ensureProfiles.profiles)
+ + ''
+ if systemctl is-active --quiet NetworkManager; then
+ ${pkgs.networkmanager}/bin/nmcli connection reload
+ fi
+ '';
+ serviceConfig = {
+ EnvironmentFile = cfg.ensureProfiles.environmentFiles;
+ UMask = "0177";
+ Type = "oneshot";
+ };
+ };
+
# Turn off NixOS' network management when networking is managed entirely by NetworkManager
networking = mkMerge [
(mkIf (!delegateWireless) {
diff --git a/nixos/modules/services/security/fail2ban.nix b/nixos/modules/services/security/fail2ban.nix
index 7059284850a5..235f29ab8a6a 100644
--- a/nixos/modules/services/security/fail2ban.nix
+++ b/nixos/modules/services/security/fail2ban.nix
@@ -103,9 +103,9 @@ in
};
bantime = mkOption {
- default = null;
- type = types.nullOr types.str;
- example = "10m";
+ default = "10m";
+ type = types.str;
+ example = "1h";
description = lib.mdDoc "Number of seconds that a host is banned.";
};
diff --git a/nixos/modules/services/security/jitterentropy-rngd.nix b/nixos/modules/services/security/jitterentropy-rngd.nix
new file mode 100644
index 000000000000..7bfacb5ddc5d
--- /dev/null
+++ b/nixos/modules/services/security/jitterentropy-rngd.nix
@@ -0,0 +1,18 @@
+{ lib, config, pkgs, ... }:
+let
+ cfg = config.services.jitterentropy-rngd;
+in
+{
+ options.services.jitterentropy-rngd = {
+ enable =
+ lib.mkEnableOption (lib.mdDoc "jitterentropy-rngd service configuration");
+ package = lib.mkPackageOptionMD pkgs "jitterentropy-rngd" { };
+ };
+
+ config = lib.mkIf cfg.enable {
+ systemd.packages = [ cfg.package ];
+ systemd.services."jitterentropy".wantedBy = [ "basic.target" ];
+ };
+
+ meta.maintainers = with lib.maintainers; [ thillux ];
+}
diff --git a/nixos/modules/services/web-servers/nginx/default.nix b/nixos/modules/services/web-servers/nginx/default.nix
index 955d6e19064e..9eebd18855c7 100644
--- a/nixos/modules/services/web-servers/nginx/default.nix
+++ b/nixos/modules/services/web-servers/nginx/default.nix
@@ -329,7 +329,7 @@ let
listenString = { addr, port, ssl, proxyProtocol ? false, extraParameters ? [], ... }:
# UDP listener for QUIC transport protocol.
(optionalString (ssl && vhost.quic) ("
- listen ${addr}:${toString port} quic "
+ listen ${addr}${optionalString (port != null) ":${toString port}"} quic "
+ optionalString vhost.default "default_server "
+ optionalString vhost.reuseport "reuseport "
+ optionalString (extraParameters != []) (concatStringsSep " "
@@ -338,7 +338,7 @@ let
in filter isCompatibleParameter extraParameters))
+ ";"))
+ "
- listen ${addr}:${toString port} "
+ listen ${addr}${optionalString (port != null) ":${toString port}"} "
+ optionalString (ssl && vhost.http2 && oldHTTP2) "http2 "
+ optionalString ssl "ssl "
+ optionalString vhost.default "default_server "
diff --git a/nixos/modules/services/web-servers/nginx/vhost-options.nix b/nixos/modules/services/web-servers/nginx/vhost-options.nix
index 7636c1b26115..c82f02ecefec 100644
--- a/nixos/modules/services/web-servers/nginx/vhost-options.nix
+++ b/nixos/modules/services/web-servers/nginx/vhost-options.nix
@@ -31,12 +31,12 @@ with lib;
options = {
addr = mkOption {
type = str;
- description = lib.mdDoc "IP address.";
+ description = lib.mdDoc "Listen address.";
};
port = mkOption {
- type = port;
+ type = types.nullOr port;
description = lib.mdDoc "Port number.";
- default = 80;
+ default = null;
};
ssl = mkOption {
type = bool;
@@ -60,6 +60,7 @@ with lib;
example = [
{ addr = "195.154.1.1"; port = 443; ssl = true; }
{ addr = "192.154.1.1"; port = 80; }
+ { addr = "unix:/var/run/nginx.sock"; }
];
description = lib.mdDoc ''
Listen addresses and ports for this virtual host.
diff --git a/nixos/modules/system/boot/systemd/initrd.nix b/nixos/modules/system/boot/systemd/initrd.nix
index 61af2768e295..175e757cbbb6 100644
--- a/nixos/modules/system/boot/systemd/initrd.nix
+++ b/nixos/modules/system/boot/systemd/initrd.nix
@@ -358,7 +358,7 @@ in {
++ lib.optional (cfg.enableTpm2 && !(pkgs.stdenv.hostPlatform.isRiscV64 || pkgs.stdenv.hostPlatform.isArmv7)) "tpm-crb";
boot.initrd.systemd = {
- initrdBin = [pkgs.bash pkgs.coreutils cfg.package.kmod cfg.package] ++ config.system.fsPackages;
+ initrdBin = [pkgs.bash pkgs.coreutils cfg.package.kmod cfg.package];
extraBin = {
less = "${pkgs.less}/bin/less";
mount = "${cfg.package.util-linux}/bin/mount";
diff --git a/nixos/modules/tasks/filesystems/btrfs.nix b/nixos/modules/tasks/filesystems/btrfs.nix
index 82fdd6058710..87fe326c0974 100644
--- a/nixos/modules/tasks/filesystems/btrfs.nix
+++ b/nixos/modules/tasks/filesystems/btrfs.nix
@@ -52,34 +52,37 @@ in
config = mkMerge [
(mkIf enableBtrfs {
system.fsPackages = [ pkgs.btrfs-progs ];
+ })
- boot.initrd.kernelModules = mkIf inInitrd [ "btrfs" ];
- boot.initrd.availableKernelModules = mkIf inInitrd (
+ (mkIf inInitrd {
+ boot.initrd.kernelModules = [ "btrfs" ];
+ boot.initrd.availableKernelModules =
[ "crc32c" ]
++ optionals (config.boot.kernelPackages.kernel.kernelAtLeast "5.5") [
# Needed for mounting filesystems with new checksums
"xxhash_generic"
"blake2b_generic"
"sha256_generic" # Should be baked into our kernel, just to be sure
- ]
- );
+ ];
- boot.initrd.extraUtilsCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable)
+ boot.initrd.extraUtilsCommands = mkIf (!config.boot.initrd.systemd.enable)
''
copy_bin_and_libs ${pkgs.btrfs-progs}/bin/btrfs
ln -sv btrfs $out/bin/btrfsck
ln -sv btrfsck $out/bin/fsck.btrfs
'';
- boot.initrd.extraUtilsCommandsTest = mkIf (inInitrd && !config.boot.initrd.systemd.enable)
+ boot.initrd.extraUtilsCommandsTest = mkIf (!config.boot.initrd.systemd.enable)
''
$out/bin/btrfs --version
'';
- boot.initrd.postDeviceCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable)
+ boot.initrd.postDeviceCommands = mkIf (!config.boot.initrd.systemd.enable)
''
btrfs device scan
'';
+
+ boot.initrd.systemd.initrdBin = [ pkgs.btrfs-progs ];
})
(mkIf enableAutoScrub {
diff --git a/nixos/modules/tasks/filesystems/cifs.nix b/nixos/modules/tasks/filesystems/cifs.nix
index 0de292a69208..837b9e19bfb9 100644
--- a/nixos/modules/tasks/filesystems/cifs.nix
+++ b/nixos/modules/tasks/filesystems/cifs.nix
@@ -21,5 +21,7 @@ in
copy_bin_and_libs ${pkgs.cifs-utils}/sbin/mount.cifs
'';
+ boot.initrd.systemd.extraBin."mount.cifs" = mkIf inInitrd "${pkgs.cifs-utils}/sbin/mount.cifs";
+
};
}
diff --git a/nixos/modules/tasks/filesystems/ext.nix b/nixos/modules/tasks/filesystems/ext.nix
index edc0efc55213..1c34ee2c7035 100644
--- a/nixos/modules/tasks/filesystems/ext.nix
+++ b/nixos/modules/tasks/filesystems/ext.nix
@@ -25,5 +25,7 @@ in
ln -sv e2fsck $out/bin/fsck.ext4
'';
+ boot.initrd.systemd.initrdBin = lib.mkIf inInitrd [ pkgs.e2fsprogs ];
+
};
}
diff --git a/nixos/modules/tasks/filesystems/f2fs.nix b/nixos/modules/tasks/filesystems/f2fs.nix
index 035784f43df8..4f99f9a57fa6 100644
--- a/nixos/modules/tasks/filesystems/f2fs.nix
+++ b/nixos/modules/tasks/filesystems/f2fs.nix
@@ -16,5 +16,7 @@ in
boot.initrd.extraUtilsCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable) ''
copy_bin_and_libs ${pkgs.f2fs-tools}/sbin/fsck.f2fs
'';
+
+ boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.f2fs-tools ];
};
}
diff --git a/nixos/modules/tasks/filesystems/jfs.nix b/nixos/modules/tasks/filesystems/jfs.nix
index 6d80c4c657da..b5132b4caa33 100644
--- a/nixos/modules/tasks/filesystems/jfs.nix
+++ b/nixos/modules/tasks/filesystems/jfs.nix
@@ -15,5 +15,7 @@ in
boot.initrd.extraUtilsCommands = mkIf (inInitrd && !config.boot.initrd.systemd.enable) ''
copy_bin_and_libs ${pkgs.jfsutils}/sbin/fsck.jfs
'';
+
+ boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.jfsutils ];
};
}
diff --git a/nixos/modules/tasks/filesystems/reiserfs.nix b/nixos/modules/tasks/filesystems/reiserfs.nix
index 7b017a83db84..3c6a0f0cd917 100644
--- a/nixos/modules/tasks/filesystems/reiserfs.nix
+++ b/nixos/modules/tasks/filesystems/reiserfs.nix
@@ -21,5 +21,7 @@ in
ln -s reiserfsck $out/bin/fsck.reiserfs
'';
+ boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.reiserfsprogs ];
+
};
}
diff --git a/nixos/modules/tasks/filesystems/vfat.nix b/nixos/modules/tasks/filesystems/vfat.nix
index 5421b617b43b..e535e97759b2 100644
--- a/nixos/modules/tasks/filesystems/vfat.nix
+++ b/nixos/modules/tasks/filesystems/vfat.nix
@@ -21,5 +21,7 @@ in
ln -sv dosfsck $out/bin/fsck.vfat
'';
+ boot.initrd.systemd.extraBin = mkIf inInitrd [ pkgs.dosfstools ];
+
};
}
diff --git a/nixos/modules/tasks/filesystems/xfs.nix b/nixos/modules/tasks/filesystems/xfs.nix
index f81f58646551..76f31e660ad3 100644
--- a/nixos/modules/tasks/filesystems/xfs.nix
+++ b/nixos/modules/tasks/filesystems/xfs.nix
@@ -26,5 +26,7 @@ in
''
sed -i -e 's,^#!.*,#!'$out/bin/sh, $out/bin/fsck.xfs
'';
+
+ boot.initrd.systemd.initrdBin = mkIf inInitrd [ pkgs.xfsprogs.bin ];
};
}
diff --git a/nixos/modules/tasks/filesystems/zfs.nix b/nixos/modules/tasks/filesystems/zfs.nix
index 5cf863c87f27..082634ec9d01 100644
--- a/nixos/modules/tasks/filesystems/zfs.nix
+++ b/nixos/modules/tasks/filesystems/zfs.nix
@@ -90,12 +90,17 @@ let
getPoolMounts = prefix: pool:
let
+ poolFSes = getPoolFilesystems pool;
+
# Remove the "/" suffix because even though most mountpoints
# won't have it, the "/" mountpoint will, and we can't have the
# trailing slash in "/sysroot/" in stage 1.
mountPoint = fs: escapeSystemdPath (prefix + (lib.removeSuffix "/" fs.mountPoint));
+
+ hasUsr = lib.any (fs: fs.mountPoint == "/usr") poolFSes;
in
- map (x: "${mountPoint x}.mount") (getPoolFilesystems pool);
+ map (x: "${mountPoint x}.mount") poolFSes
+ ++ lib.optional hasUsr "sysusr-usr.mount";
getKeyLocations = pool: if isBool cfgZfs.requestEncryptionCredentials then {
hasKeys = cfgZfs.requestEncryptionCredentials;
@@ -632,7 +637,8 @@ in
targets.zfs-import.wantedBy = [ "zfs.target" ];
targets.zfs.wantedBy = [ "initrd.target" ];
extraBin = {
- # zpool and zfs are already in thanks to fsPackages
+ zpool = "${cfgZfs.package}/sbin/zpool";
+ zfs = "${cfgZfs.package}/sbin/zfs";
awk = "${pkgs.gawk}/bin/awk";
};
};
diff --git a/nixos/modules/virtualisation/qemu-vm.nix b/nixos/modules/virtualisation/qemu-vm.nix
index e0004df6f6b2..737a935711ae 100644
--- a/nixos/modules/virtualisation/qemu-vm.nix
+++ b/nixos/modules/virtualisation/qemu-vm.nix
@@ -267,6 +267,7 @@ let
};
storeImage = import ../../lib/make-disk-image.nix {
+ name = "nix-store-image";
inherit pkgs config lib;
additionalPaths = [ regInfo ];
format = "qcow2";
diff --git a/nixos/tests/all-tests.nix b/nixos/tests/all-tests.nix
index 33f8abf6ccd4..ef98efd7dbca 100644
--- a/nixos/tests/all-tests.nix
+++ b/nixos/tests/all-tests.nix
@@ -272,6 +272,7 @@ in {
fail2ban = handleTest ./fail2ban.nix { };
fakeroute = handleTest ./fakeroute.nix {};
fancontrol = handleTest ./fancontrol.nix {};
+ fanout = handleTest ./fanout.nix {};
fcitx5 = handleTest ./fcitx5 {};
fenics = handleTest ./fenics.nix {};
ferm = handleTest ./ferm.nix {};
@@ -559,6 +560,7 @@ in {
nginx-sso = handleTest ./nginx-sso.nix {};
nginx-status-page = handleTest ./nginx-status-page.nix {};
nginx-tmpdir = handleTest ./nginx-tmpdir.nix {};
+ nginx-unix-socket = handleTest ./nginx-unix-socket.nix {};
nginx-variants = handleTest ./nginx-variants.nix {};
nifi = handleTestOn ["x86_64-linux"] ./web-apps/nifi.nix {};
nitter = handleTest ./nitter.nix {};
@@ -732,6 +734,7 @@ in {
snapper = handleTest ./snapper.nix {};
snipe-it = runTest ./web-apps/snipe-it.nix;
soapui = handleTest ./soapui.nix {};
+ soft-serve = handleTest ./soft-serve.nix {};
sogo = handleTest ./sogo.nix {};
solanum = handleTest ./solanum.nix {};
sonarr = handleTest ./sonarr.nix {};
diff --git a/nixos/tests/fanout.nix b/nixos/tests/fanout.nix
new file mode 100644
index 000000000000..c36d34dcce0b
--- /dev/null
+++ b/nixos/tests/fanout.nix
@@ -0,0 +1,30 @@
+{ system ? builtins.currentSystem
+, config ? {}
+, pkgs ? import ../.. { inherit system config; }
+}:
+import ./make-test-python.nix ({lib, pkgs, ...}: {
+ name = "fanout";
+ meta.maintainers = [ lib.maintainers.therishidesai ];
+
+ nodes = let
+ cfg = { ... }: {
+ services.fanout = {
+ enable = true;
+ fanoutDevices = 2;
+ bufferSize = 8192;
+ };
+ };
+ in {
+ machine = cfg;
+ };
+
+ testScript = ''
+ start_all()
+
+ # mDNS.
+ machine.wait_for_unit("multi-user.target")
+
+ machine.succeed("test -c /dev/fanout0")
+ machine.succeed("test -c /dev/fanout1")
+ '';
+})
diff --git a/nixos/tests/hadoop/hadoop.nix b/nixos/tests/hadoop/hadoop.nix
index b132f4fa58b0..0de2366b1864 100644
--- a/nixos/tests/hadoop/hadoop.nix
+++ b/nixos/tests/hadoop/hadoop.nix
@@ -249,7 +249,7 @@ import ../make-test-python.nix ({ package, ... }: {
assert "standby" in client.succeed("sudo -u yarn yarn rmadmin -getAllServiceState")
client.succeed("sudo -u yarn yarn rmadmin -getAllServiceState | systemd-cat")
- assert "Estimated value of Pi is" in client.succeed("HADOOP_USER_NAME=hdfs yarn jar $(readlink $(which yarn) | sed -r 's~bin/yarn~lib/hadoop-*/share/hadoop/mapreduce/hadoop-mapreduce-examples-*.jar~g') pi 2 10")
+ assert "Estimated value of Pi is" in client.succeed("HADOOP_USER_NAME=hdfs yarn jar $(readlink $(which yarn) | sed -r 's~bin/yarn~share/hadoop/mapreduce/hadoop-mapreduce-examples-*.jar~g') pi 2 10")
assert "SUCCEEDED" in client.succeed("yarn application -list -appStates FINISHED")
'';
})
diff --git a/nixos/tests/installer.nix b/nixos/tests/installer.nix
index 3268a16967d7..5111cedf9256 100644
--- a/nixos/tests/installer.nix
+++ b/nixos/tests/installer.nix
@@ -690,6 +690,9 @@ in {
"zpool create rpool /dev/vda2",
"zfs create -o mountpoint=legacy rpool/root",
"mount -t zfs rpool/root /mnt",
+ "zfs create -o mountpoint=legacy rpool/root/usr",
+ "mkdir /mnt/usr",
+ "mount -t zfs rpool/root/usr /mnt/usr",
"udevadm settle",
)
'';
diff --git a/nixos/tests/nginx-unix-socket.nix b/nixos/tests/nginx-unix-socket.nix
new file mode 100644
index 000000000000..4640eaa171bd
--- /dev/null
+++ b/nixos/tests/nginx-unix-socket.nix
@@ -0,0 +1,27 @@
+import ./make-test-python.nix ({ pkgs, ... }:
+let
+ nginxSocketPath = "/var/run/nginx/test.sock";
+in
+{
+ name = "nginx-unix-socket";
+
+ nodes = {
+ webserver = { pkgs, lib, ... }: {
+ services.nginx = {
+ enable = true;
+ virtualHosts.localhost = {
+ serverName = "localhost";
+ listen = [{ addr = "unix:${nginxSocketPath}"; }];
+ locations."/test".return = "200 'foo'";
+ };
+ };
+ };
+ };
+
+ testScript = ''
+ webserver.wait_for_unit("nginx")
+ webserver.wait_for_open_unix_socket("${nginxSocketPath}")
+
+ webserver.succeed("curl --fail --silent --unix-socket '${nginxSocketPath}' http://localhost/test | grep '^foo$'")
+ '';
+})
diff --git a/nixos/tests/soft-serve.nix b/nixos/tests/soft-serve.nix
new file mode 100644
index 000000000000..1c4cb4c95819
--- /dev/null
+++ b/nixos/tests/soft-serve.nix
@@ -0,0 +1,102 @@
+import ./make-test-python.nix ({ pkgs, lib, ... }:
+let
+ inherit (import ./ssh-keys.nix pkgs) snakeOilPrivateKey snakeOilPublicKey;
+ sshPort = 8231;
+ httpPort = 8232;
+ statsPort = 8233;
+ gitPort = 8418;
+in
+{
+ name = "soft-serve";
+ meta.maintainers = with lib.maintainers; [ dadada ];
+ nodes = {
+ client = { pkgs, ... }: {
+ environment.systemPackages = with pkgs; [
+ curl
+ git
+ openssh
+ ];
+ environment.etc.sshKey = {
+ source = snakeOilPrivateKey;
+ mode = "0600";
+ };
+ };
+
+ server =
+ { config, ... }:
+ {
+ services.soft-serve = {
+ enable = true;
+ settings = {
+ name = "TestServer";
+ ssh.listen_addr = ":${toString sshPort}";
+ git.listen_addr = ":${toString gitPort}";
+ http.listen_addr = ":${toString httpPort}";
+ stats.listen_addr = ":${toString statsPort}";
+ initial_admin_keys = [ snakeOilPublicKey ];
+ };
+ };
+ networking.firewall.allowedTCPPorts = [ sshPort httpPort statsPort ];
+ };
+ };
+
+ testScript =
+ { ... }:
+ ''
+ SSH_PORT = ${toString sshPort}
+ HTTP_PORT = ${toString httpPort}
+ STATS_PORT = ${toString statsPort}
+ KEY = "${snakeOilPublicKey}"
+ SSH_KEY = "/etc/sshKey"
+ SSH_COMMAND = f"ssh -p {SSH_PORT} -i {SSH_KEY} -o StrictHostKeyChecking=no"
+ TEST_DIR = "/tmp/test"
+ GIT = f"git -C {TEST_DIR}"
+
+ for machine in client, server:
+ machine.wait_for_unit("network.target")
+
+ server.wait_for_unit("soft-serve.service")
+ server.wait_for_open_port(SSH_PORT)
+
+ with subtest("Get info"):
+ status, test = client.execute(f"{SSH_COMMAND} server info")
+ if status != 0:
+ raise Exception("Failed to get SSH info")
+ key = " ".join(KEY.split(" ")[0:2])
+ if not key in test:
+ raise Exception("Admin key must be configured correctly")
+
+ with subtest("Create user"):
+ client.succeed(f"{SSH_COMMAND} server user create beatrice")
+ client.succeed(f"{SSH_COMMAND} server user info beatrice")
+
+ with subtest("Create repo"):
+ client.succeed(f"git init {TEST_DIR}")
+ client.succeed(f"{GIT} config --global user.email you@example.com")
+ client.succeed(f"touch {TEST_DIR}/foo")
+ client.succeed(f"{GIT} add foo")
+ client.succeed(f"{GIT} commit --allow-empty -m test")
+ client.succeed(f"{GIT} remote add origin git@server:test")
+ client.succeed(f"GIT_SSH_COMMAND='{SSH_COMMAND}' {GIT} push -u origin master")
+ client.execute("rm -r /tmp/test")
+
+ server.wait_for_open_port(HTTP_PORT)
+
+ with subtest("Clone over HTTP"):
+ client.succeed(f"curl --connect-timeout 10 http://server:{HTTP_PORT}/")
+ client.succeed(f"git clone http://server:{HTTP_PORT}/test /tmp/test")
+ client.execute("rm -r /tmp/test")
+
+ with subtest("Clone over SSH"):
+ client.succeed(f"GIT_SSH_COMMAND='{SSH_COMMAND}' git clone git@server:test /tmp/test")
+ client.execute("rm -r /tmp/test")
+
+ with subtest("Get stats over HTTP"):
+ server.wait_for_open_port(STATS_PORT)
+ status, test = client.execute(f"curl --connect-timeout 10 http://server:{STATS_PORT}/metrics")
+ if status != 0:
+ raise Exception("Failed to get metrics from status port")
+ if not "go_gc_duration_seconds_count" in test:
+ raise Exception("Metrics did not contain key 'go_gc_duration_seconds_count'")
+ '';
+})
diff --git a/nixos/tests/zfs.nix b/nixos/tests/zfs.nix
index 800f5e43cd15..3454fbaf78fe 100644
--- a/nixos/tests/zfs.nix
+++ b/nixos/tests/zfs.nix
@@ -113,8 +113,6 @@ let
};
testScript = ''
- # TODO: Remove this when upgrading stable to zfs 2.2.0
- unstable = ${if enableUnstable then "True" else "False"};
machine.wait_for_unit("multi-user.target")
machine.succeed(
"zpool status",
@@ -136,8 +134,6 @@ let
machine.crash()
machine.wait_for_unit("multi-user.target")
machine.succeed("zfs set sharesmb=on rpool/shared_smb")
- if not unstable:
- machine.succeed("zfs share rpool/shared_smb")
machine.succeed(
"smbclient -gNL localhost | grep rpool_shared_smb",
"umount /tmp/mnt",
diff --git a/pkgs/applications/blockchains/trezor-suite/default.nix b/pkgs/applications/blockchains/trezor-suite/default.nix
index c56e6da52f0f..e5f8963e921c 100644
--- a/pkgs/applications/blockchains/trezor-suite/default.nix
+++ b/pkgs/applications/blockchains/trezor-suite/default.nix
@@ -8,7 +8,7 @@
let
pname = "trezor-suite";
- version = "23.4.2";
+ version = "23.10.1";
name = "${pname}-${version}";
suffix = {
@@ -19,8 +19,8 @@ let
src = fetchurl {
url = "https://github.com/trezor/${pname}/releases/download/v${version}/Trezor-Suite-${version}-${suffix}.AppImage";
hash = { # curl -Lfs https://github.com/trezor/trezor-suite/releases/latest/download/latest-linux{-arm64,}.yml | grep ^sha512 | sed 's/: /-/'
- aarch64-linux = "sha512-+dcogzj0mENWSAVKqUG/xyF+TD/nKpA3UiNyI2M7iiCaW+tpwO5Y0uUmzb1rFRtDsKMflDPZNWe8qMJmrtaIrA==";
- x86_64-linux = "sha512-8UyPa3hDmALiYGao451ZBQLxv9H9OLbzzHiANp4zgvjBLGNhZnPFBIYM6KGyKkgRJJiTcgd7VHCgEhPpfm0qzg==";
+ aarch64-linux = "sha512-MR9BYg6R+Oof3zh02KSh48V2m6J7JpsrYpi6gj5kTvKuCU5Ci5AwPEAvnTjHAR6xlappvoNQmeA5nCEoTWaL7A==";
+ x86_64-linux = "sha512-BqdfhYLG4z+9B7KbJGWGPml7U2fl/RQ1nZK0vdeA/cKhG0SjH0K8er9bemg60RPBXj0AeuK80v/6vMbDtyEnRQ==";
}.${stdenv.hostPlatform.system} or (throw "Unsupported system: ${stdenv.hostPlatform.system}");
};
diff --git a/pkgs/applications/editors/jetbrains/plugins/plugins.json b/pkgs/applications/editors/jetbrains/plugins/plugins.json
index d93a243b0a37..353d4a5d4b0b 100644
--- a/pkgs/applications/editors/jetbrains/plugins/plugins.json
+++ b/pkgs/applications/editors/jetbrains/plugins/plugins.json
@@ -22,10 +22,10 @@
"232.10072.21": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
"232.10072.27": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
"232.10072.28": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
+ "232.10072.31": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
+ "232.10072.32": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
"232.9921.42": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
- "232.9921.55": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
"232.9921.83": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
- "232.9921.89": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip",
"233.8264.22": "https://plugins.jetbrains.com/files/164/390591/IdeaVim-2.5.1-signed.zip"
},
"name": "ideavim"
@@ -61,10 +61,10 @@
"232.10072.21": null,
"232.10072.27": null,
"232.10072.28": null,
+ "232.10072.31": null,
+ "232.10072.32": null,
"232.9921.42": null,
- "232.9921.55": null,
"232.9921.83": null,
- "232.9921.89": null,
"233.8264.22": null
},
"name": "kotlin"
@@ -87,14 +87,14 @@
],
"builds": {
"223.8836.1185": null,
- "232.10072.15": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
- "232.10072.21": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
- "232.10072.27": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
- "232.10072.28": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
+ "232.10072.15": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip",
+ "232.10072.21": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip",
+ "232.10072.27": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip",
+ "232.10072.28": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip",
+ "232.10072.31": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip",
+ "232.10072.32": "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip",
"232.9921.42": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
- "232.9921.55": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
"232.9921.83": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
- "232.9921.89": "https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip",
"233.8264.22": "https://plugins.jetbrains.com/files/6981/407738/ini-233.8264.9.zip"
},
"name": "ini"
@@ -105,8 +105,8 @@
"phpstorm"
],
"builds": {
- "232.10072.27": "https://plugins.jetbrains.com/files/7219/408569/Symfony_Plugin-2022.1.258.zip",
- "232.9921.55": "https://plugins.jetbrains.com/files/7219/408569/Symfony_Plugin-2022.1.258.zip"
+ "232.10072.27": "https://plugins.jetbrains.com/files/7219/419684/Symfony_Plugin-2022.1.259.zip",
+ "232.10072.32": "https://plugins.jetbrains.com/files/7219/419684/Symfony_Plugin-2022.1.259.zip"
},
"name": "symfony-support"
},
@@ -117,7 +117,7 @@
],
"builds": {
"232.10072.27": "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip",
- "232.9921.55": "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip"
+ "232.10072.32": "https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip"
},
"name": "php-annotations"
},
@@ -158,10 +158,10 @@
"232.10072.21": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
"232.10072.27": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
"232.10072.28": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
+ "232.10072.31": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
+ "232.10072.32": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
"232.9921.42": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
- "232.9921.55": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
- "232.9921.83": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip",
- "232.9921.89": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip"
+ "232.9921.83": "https://plugins.jetbrains.com/files/8182/395553/intellij-rust-0.4.201.5424-232.zip"
},
"name": "-deprecated-rust"
},
@@ -186,10 +186,10 @@
"232.10072.21": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
"232.10072.27": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
"232.10072.28": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
+ "232.10072.31": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
+ "232.10072.32": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
"232.9921.42": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
- "232.9921.55": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
- "232.9921.83": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip",
- "232.9921.89": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip"
+ "232.9921.83": "https://plugins.jetbrains.com/files/8182/372556/intellij-rust-0.4.200.5420-232-beta.zip"
},
"name": "-deprecated-rust-beta"
},
@@ -207,7 +207,7 @@
"232.10072.21": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip",
"232.10072.27": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip",
"232.10072.28": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip",
- "232.9921.89": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip"
+ "232.10072.31": "https://plugins.jetbrains.com/files/8554/374977/featuresTrainer-232.9559.6.zip"
},
"name": "ide-features-trainer"
},
@@ -233,10 +233,10 @@
"232.10072.21": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
"232.10072.27": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
"232.10072.28": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
+ "232.10072.31": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
+ "232.10072.32": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
"232.9921.42": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
- "232.9921.55": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
"232.9921.83": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
- "232.9921.89": "https://plugins.jetbrains.com/files/8607/370632/NixIDEA-0.4.0.10.zip",
"233.8264.22": null
},
"name": "nixidea"
@@ -267,16 +267,16 @@
"webstorm"
],
"builds": {
- "223.8836.1185": "https://plugins.jetbrains.com/files/10037/358812/CSVEditor-3.2.1-223.zip",
- "232.10072.15": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
- "232.10072.21": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
- "232.10072.27": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
- "232.10072.28": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
- "232.9921.42": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
- "232.9921.55": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
- "232.9921.83": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
- "232.9921.89": "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip",
- "233.8264.22": "https://plugins.jetbrains.com/files/10037/243092/CSV-2.21.0.zip"
+ "223.8836.1185": "https://plugins.jetbrains.com/files/10037/417700/CSVEditor-3.2.2-223.zip",
+ "232.10072.15": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+ "232.10072.21": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+ "232.10072.27": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+ "232.10072.28": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+ "232.10072.31": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+ "232.10072.32": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+ "232.9921.42": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+ "232.9921.83": "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip",
+ "233.8264.22": "https://plugins.jetbrains.com/files/10037/417702/CSVEditor-3.2.2-233.zip"
},
"name": "csv-editor"
},
@@ -302,10 +302,10 @@
"232.10072.21": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
"232.10072.27": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
"232.10072.28": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
+ "232.10072.31": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
+ "232.10072.32": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
"232.9921.42": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
- "232.9921.55": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
"232.9921.83": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
- "232.9921.89": "https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip",
"233.8264.22": "https://plugins.jetbrains.com/files/12062/405118/keymap-vscode-233.8264.3.zip"
},
"name": "vscode-keymap"
@@ -332,10 +332,10 @@
"232.10072.21": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
"232.10072.27": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
"232.10072.28": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
+ "232.10072.31": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
+ "232.10072.32": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
"232.9921.42": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
- "232.9921.55": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
"232.9921.83": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
- "232.9921.89": "https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip",
"233.8264.22": "https://plugins.jetbrains.com/files/12559/405631/keymap-eclipse-233.8264.9.zip"
},
"name": "eclipse-keymap"
@@ -362,10 +362,10 @@
"232.10072.21": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
"232.10072.27": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
"232.10072.28": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
+ "232.10072.31": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
+ "232.10072.32": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
"232.9921.42": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
- "232.9921.55": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
"232.9921.83": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
- "232.9921.89": "https://plugins.jetbrains.com/files/13017/364038/keymap-visualStudio-232.8660.88.zip",
"233.8264.22": "https://plugins.jetbrains.com/files/13017/405636/keymap-visualStudio-233.8264.9.zip"
},
"name": "visual-studio-keymap"
@@ -392,10 +392,10 @@
"232.10072.21": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
"232.10072.27": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
"232.10072.28": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
+ "232.10072.31": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
+ "232.10072.32": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
"232.9921.42": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
- "232.9921.55": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
"232.9921.83": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
- "232.9921.89": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar",
"233.8264.22": "https://plugins.jetbrains.com/files/14059/82616/darcula-pitch-black.jar"
},
"name": "darcula-pitch-black"
@@ -422,10 +422,10 @@
"232.10072.21": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
"232.10072.27": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
"232.10072.28": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
+ "232.10072.31": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
+ "232.10072.32": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
"232.9921.42": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
- "232.9921.55": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
"232.9921.83": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
- "232.9921.89": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip",
"233.8264.22": "https://plugins.jetbrains.com/files/17718/415524/github-copilot-intellij-1.3.2.3479.zip"
},
"name": "github-copilot"
@@ -452,10 +452,10 @@
"232.10072.21": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
"232.10072.27": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
"232.10072.28": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
+ "232.10072.31": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
+ "232.10072.32": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
"232.9921.42": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
- "232.9921.55": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
"232.9921.83": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
- "232.9921.89": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip",
"233.8264.22": "https://plugins.jetbrains.com/files/18444/165585/NetBeans6.5Keymap.zip"
},
"name": "netbeans-6-5-keymap"
@@ -475,9 +475,9 @@
}
},
"files": {
- "https://plugins.jetbrains.com/files/10037/243092/CSV-2.21.0.zip": "sha256-Mfo8z2pjn+Gk1uumw5xpZQwpkqLRVqAu2Z07zjn2N1M=",
- "https://plugins.jetbrains.com/files/10037/358812/CSVEditor-3.2.1-223.zip": "sha256-l8xq7XXQheZYcP+kdnLXAO7FhfPJYwIh+ZffbttBI9s=",
- "https://plugins.jetbrains.com/files/10037/358813/CSVEditor-3.2.1-232.zip": "sha256-m9ocJSFWparZLrX1MQA0IlSH5LHodmzzVmGZ6eHml24=",
+ "https://plugins.jetbrains.com/files/10037/417699/CSVEditor-3.2.2-232.zip": "sha256-3bHSRhzvVO07mvuD6tpkiKFXTF66zCK/wpXFVb8IkfY=",
+ "https://plugins.jetbrains.com/files/10037/417700/CSVEditor-3.2.2-223.zip": "sha256-4Y/DZpCWKljaslJFsaqItq1DVJVVRlQjWpM6GLRo8QA=",
+ "https://plugins.jetbrains.com/files/10037/417702/CSVEditor-3.2.2-233.zip": "sha256-n4psF9fFFU8ohtbOndRx6i20EntjEzL3BvMObAZyOOw=",
"https://plugins.jetbrains.com/files/12062/364117/keymap-vscode-232.8660.88.zip": "sha256-q5i1eAANK+6uBYrtioKLzvJf5ALUB0K4d31Ut0vT/lE=",
"https://plugins.jetbrains.com/files/12062/405118/keymap-vscode-233.8264.3.zip": "sha256-cB3DTeWhDgAwHlxwYogd0/DuYBzo5DqaRtBvEC/p8I4=",
"https://plugins.jetbrains.com/files/12559/364124/keymap-eclipse-232.8660.88.zip": "sha256-eRCsivZbDNrc+kesa9jVsOoMFFz+WpYfSMXxPCCjWjw=",
@@ -495,7 +495,8 @@
"https://plugins.jetbrains.com/files/6954/381727/kotlin-plugin-223-1.9.10-release-459-IJ8836.35.zip": "sha256-gHkNQyWh6jtY1986aI7Qo6ZNrniPy+Yq4XLLA0pKJkA=",
"https://plugins.jetbrains.com/files/6981/407738/ini-233.8264.9.zip": "sha256-E3xWjwTxtLkOtm9748BbkKGaS4l8SlZOkj3w6VgqlFQ=",
"https://plugins.jetbrains.com/files/6981/407868/ini-232.9921.89.zip": "sha256-XIdhTQMxl/nJnntfQlHLlcyA79IS3hnGEGrXhKBFgY0=",
- "https://plugins.jetbrains.com/files/7219/408569/Symfony_Plugin-2022.1.258.zip": "sha256-O4ARifSoeL5kXnFQTs6YoLcJvdg5VHks5LIgnwwUAeQ=",
+ "https://plugins.jetbrains.com/files/6981/418297/ini-232.10072.32.zip": "sha256-eC5Zs6ph/4C3Xf6e07DfyqhBmsG3bAFLnvae1JiFzpE=",
+ "https://plugins.jetbrains.com/files/7219/419684/Symfony_Plugin-2022.1.259.zip": "sha256-3UxSPvEXXhAf3zYg2H/jja4F5fuDFWQ6SWFRvcWJ0Iw=",
"https://plugins.jetbrains.com/files/7320/346181/PHP_Annotations-9.4.0.zip": "sha256-hT5K4w4lhvNwDzDMDSvsIDGj9lyaRqglfOhlbNdqpWs=",
"https://plugins.jetbrains.com/files/7322/401058/python-ce-232.9921.77.zip": "sha256-cr4LxSz8xVzC+Zm+6LnWGLbF6aGBVLW56crCIQOawhc=",
"https://plugins.jetbrains.com/files/7322/405773/python-ce-233.8264.8.zip": "sha256-LjN0BkcnX8mVHh2dPULddVwooi9fcABkrRVhTPA7XSo=",
diff --git a/pkgs/applications/editors/jetbrains/versions.json b/pkgs/applications/editors/jetbrains/versions.json
index c95feebdb674..5bbbd9dfc7b6 100644
--- a/pkgs/applications/editors/jetbrains/versions.json
+++ b/pkgs/applications/editors/jetbrains/versions.json
@@ -67,27 +67,27 @@
"phpstorm": {
"update-channel": "PhpStorm RELEASE",
"url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}.tar.gz",
- "version": "2023.2.2",
- "sha256": "5e3dd021b82dcad0f51bded677aa87680dcc3f5d843951c48848a9191141bf1d",
- "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2.tar.gz",
- "build_number": "232.9921.55",
+ "version": "2023.2.3",
+ "sha256": "dd8d771508b277ab2a713b8f546c2ec6dbb261ba8c23072e46ec6ce2ea9ab2a0",
+ "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3.tar.gz",
+ "build_number": "232.10072.32",
"version-major-minor": "2022.3"
},
"pycharm-community": {
"update-channel": "PyCharm RELEASE",
"url-template": "https://download.jetbrains.com/python/pycharm-community-{version}.tar.gz",
- "version": "2023.2.2",
- "sha256": "2bb4f73d041b818a7b631feb3fee77036de764543c669efe9cf6766510a68e3f",
- "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2.tar.gz",
- "build_number": "232.9921.89"
+ "version": "2023.2.3",
+ "sha256": "d59dd88c1eb51cdd756433d415588c573ca944ebf6f08844b8ac8cd2e3d9937b",
+ "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3.tar.gz",
+ "build_number": "232.10072.31"
},
"pycharm-professional": {
"update-channel": "PyCharm RELEASE",
"url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}.tar.gz",
- "version": "2023.2.2",
- "sha256": "f7263b17e2456efcb5efab1eac53aafb6a0be1a7f9fbf25a419c9d7b447f6ded",
- "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2.tar.gz",
- "build_number": "232.9921.89"
+ "version": "2023.2.3",
+ "sha256": "e625fea80b72c9e12f986a8eb918425c6ef1d3f7b31117b40d122e3ce76046b1",
+ "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3.tar.gz",
+ "build_number": "232.10072.31"
},
"rider": {
"update-channel": "Rider RELEASE",
@@ -190,27 +190,27 @@
"phpstorm": {
"update-channel": "PhpStorm RELEASE",
"url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}-aarch64.tar.gz",
- "version": "2023.2.2",
- "sha256": "b3067ffa32fab0880ffce8dff000d463b86bef9b30f53fc4d41f5d4e518c7528",
- "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2-aarch64.tar.gz",
- "build_number": "232.9921.55",
+ "version": "2023.2.3",
+ "sha256": "577bea15c1208e0b842bcdb2ff0f0205144a8800fcadf87f873af7c067e0ce73",
+ "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3-aarch64.tar.gz",
+ "build_number": "232.10072.32",
"version-major-minor": "2022.3"
},
"pycharm-community": {
"update-channel": "PyCharm RELEASE",
"url-template": "https://download.jetbrains.com/python/pycharm-community-{version}-aarch64.tar.gz",
- "version": "2023.2.2",
- "sha256": "7d15908f9261ee7905b61d83d4a048fee1e3a2fea9465ada1fc459b2ea0e4d5f",
- "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2-aarch64.tar.gz",
- "build_number": "232.9921.89"
+ "version": "2023.2.3",
+ "sha256": "6fdc5238ffa4767834b11b52b650107f1c64d6a53d0e2bbc23581b6c90b67ab5",
+ "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3-aarch64.tar.gz",
+ "build_number": "232.10072.31"
},
"pycharm-professional": {
"update-channel": "PyCharm RELEASE",
"url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}-aarch64.tar.gz",
- "version": "2023.2.2",
- "sha256": "2cf259859847f7a979565f31faa60148d571206c78c9309dcdf867b76c16ef25",
- "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2-aarch64.tar.gz",
- "build_number": "232.9921.89"
+ "version": "2023.2.3",
+ "sha256": "578ecbd059ccb010682cf602e959454b296ec2e741202f236fbdb38897b296dd",
+ "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3-aarch64.tar.gz",
+ "build_number": "232.10072.31"
},
"rider": {
"update-channel": "Rider RELEASE",
@@ -313,27 +313,27 @@
"phpstorm": {
"update-channel": "PhpStorm RELEASE",
"url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}.dmg",
- "version": "2023.2.2",
- "sha256": "99a9bb313a5c141ecd1810306deaca3cf52d338edf206362b3f9d9337a27890e",
- "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2.dmg",
- "build_number": "232.9921.55",
+ "version": "2023.2.3",
+ "sha256": "7ce4ff6b344ff8ce18ef8a821ba3fd1d222f9222a9b3e65744a796379d92417e",
+ "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3.dmg",
+ "build_number": "232.10072.32",
"version-major-minor": "2022.3"
},
"pycharm-community": {
"update-channel": "PyCharm RELEASE",
"url-template": "https://download.jetbrains.com/python/pycharm-community-{version}.dmg",
- "version": "2023.2.2",
- "sha256": "f482b6d451efec897764487b116f7bf09d507a5ebfb841c33e2abd2441c3b3a7",
- "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2.dmg",
- "build_number": "232.9921.89"
+ "version": "2023.2.3",
+ "sha256": "b914bd3c0018f951bef5da9c04907355a88546ce983dcf4115bbf11556015ec7",
+ "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3.dmg",
+ "build_number": "232.10072.31"
},
"pycharm-professional": {
"update-channel": "PyCharm RELEASE",
"url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}.dmg",
- "version": "2023.2.2",
- "sha256": "830f590d63199b389bbaa955c8602fa027bc1eb25bd8ce5636474eec72745b58",
- "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2.dmg",
- "build_number": "232.9921.89"
+ "version": "2023.2.3",
+ "sha256": "b33bbd30222363cdc3091aee923ed1c309edba799616a3a681cd9a1ca94e822a",
+ "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3.dmg",
+ "build_number": "232.10072.31"
},
"rider": {
"update-channel": "Rider RELEASE",
@@ -436,27 +436,27 @@
"phpstorm": {
"update-channel": "PhpStorm RELEASE",
"url-template": "https://download.jetbrains.com/webide/PhpStorm-{version}-aarch64.dmg",
- "version": "2023.2.2",
- "sha256": "a31daeddae532324436b2d11acbd5fb657721883f17c7ef4457ac76a51bd4189",
- "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.2-aarch64.dmg",
- "build_number": "232.9921.55",
+ "version": "2023.2.3",
+ "sha256": "68d543fb2a79cd0b07ddb94a4c00d8c0c1aca7f604bc838ac92e232e763489b3",
+ "url": "https://download.jetbrains.com/webide/PhpStorm-2023.2.3-aarch64.dmg",
+ "build_number": "232.10072.32",
"version-major-minor": "2022.3"
},
"pycharm-community": {
"update-channel": "PyCharm RELEASE",
"url-template": "https://download.jetbrains.com/python/pycharm-community-{version}-aarch64.dmg",
- "version": "2023.2.2",
- "sha256": "2bcddf3e58902578745dd1803f17ebd18f4c98dc76bf48b0945afbc7bae45832",
- "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.2-aarch64.dmg",
- "build_number": "232.9921.89"
+ "version": "2023.2.3",
+ "sha256": "08c45adbb0dca219955f511993ca8150dcca235bdba3ac24c67ae035c68ba992",
+ "url": "https://download.jetbrains.com/python/pycharm-community-2023.2.3-aarch64.dmg",
+ "build_number": "232.10072.31"
},
"pycharm-professional": {
"update-channel": "PyCharm RELEASE",
"url-template": "https://download.jetbrains.com/python/pycharm-professional-{version}-aarch64.dmg",
- "version": "2023.2.2",
- "sha256": "5d4292dd0e40db35199ebcd6472d4b46c505d3357d2324690338758355e0f092",
- "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.2-aarch64.dmg",
- "build_number": "232.9921.89"
+ "version": "2023.2.3",
+ "sha256": "63d68b20963575f76937ca0ce18a8150639c47b8cf8f3d6e96fa3306191cd076",
+ "url": "https://download.jetbrains.com/python/pycharm-professional-2023.2.3-aarch64.dmg",
+ "build_number": "232.10072.31"
},
"rider": {
"update-channel": "Rider RELEASE",
diff --git a/pkgs/applications/editors/pulsar/default.nix b/pkgs/applications/editors/pulsar/default.nix
index d2162dc9c9ef..ef08ac9352dd 100644
--- a/pkgs/applications/editors/pulsar/default.nix
+++ b/pkgs/applications/editors/pulsar/default.nix
@@ -209,5 +209,14 @@ stdenv.mkDerivation rec {
license = licenses.mit;
platforms = platforms.linux;
maintainers = with maintainers; [ colamaroro ];
+ knownVulnerabilities = [
+ "CVE-2023-5217"
+ "CVE-2022-21718"
+ "CVE-2022-29247"
+ "CVE-2022-29257"
+ "CVE-2022-36077"
+ "CVE-2023-29198"
+ "CVE-2023-39956"
+ ];
};
}
diff --git a/pkgs/applications/editors/texmacs/default.nix b/pkgs/applications/editors/texmacs/default.nix
index 427d0aa3ace8..00372c1cab8b 100644
--- a/pkgs/applications/editors/texmacs/default.nix
+++ b/pkgs/applications/editors/texmacs/default.nix
@@ -1,5 +1,5 @@
-{ lib, mkDerivation, callPackage, fetchurl,
- guile_1_8, qtbase, xmodmap, which, freetype,
+{ lib, stdenv, callPackage, fetchurl,
+ guile_1_8, xmodmap, which, freetype,
libjpeg,
sqlite,
tex ? null,
@@ -8,6 +8,11 @@
python3 ? null,
cmake,
pkg-config,
+ wrapQtAppsHook,
+ xdg-utils,
+ qtbase,
+ qtsvg,
+ qtmacextras,
ghostscriptX ? null,
extraFonts ? false,
chineseFonts ? false,
@@ -15,32 +20,49 @@
koreanFonts ? false }:
let
- pname = "TeXmacs";
- version = "2.1";
+ pname = "texmacs";
+ version = "2.1.2";
common = callPackage ./common.nix {
inherit tex extraFonts chineseFonts japaneseFonts koreanFonts;
};
in
-mkDerivation {
+stdenv.mkDerivation {
inherit pname version;
src = fetchurl {
url = "https://www.texmacs.org/Download/ftp/tmftp/source/TeXmacs-${version}-src.tar.gz";
- sha256 = "1gl6k1bwrk1y7hjyl4xvlqvmk5crl4jvsk8wrfp7ynbdin6n2i48";
+ hash = "sha256-Ds9gxOwMYSttEWrawgxLHGxHyMBvt8WmyPIwBP2g/CM=";
};
- nativeBuildInputs = [ cmake pkg-config ];
+ postPatch = common.postPatch + ''
+ substituteInPlace configure \
+ --replace "-mfpmath=sse -msse2" ""
+ '';
+
+ nativeBuildInputs = [
+ guile_1_8
+ pkg-config
+ wrapQtAppsHook
+ xdg-utils
+ ] ++ lib.optionals (!stdenv.isDarwin) [
+ cmake
+ ];
+
buildInputs = [
guile_1_8
qtbase
+ qtsvg
ghostscriptX
freetype
libjpeg
sqlite
git
python3
+ ] ++ lib.optionals stdenv.isDarwin [
+ qtmacextras
];
- NIX_LDFLAGS = "-lz";
+
+ env.NIX_LDFLAGS = "-lz";
qtWrapperArgs = [
"--suffix" "PATH" ":" (lib.makeBinPath [
@@ -58,10 +80,8 @@ mkDerivation {
wrapQtApp $out/bin/texmacs
'';
- inherit (common) postPatch;
-
meta = common.meta // {
maintainers = [ lib.maintainers.roconnor ];
- platforms = lib.platforms.gnu ++ lib.platforms.linux; # arbitrary choice
+ platforms = lib.platforms.all;
};
}
diff --git a/pkgs/applications/editors/vim/plugins/generated.nix b/pkgs/applications/editors/vim/plugins/generated.nix
index ecd22ae6102b..a38f9c137edc 100644
--- a/pkgs/applications/editors/vim/plugins/generated.nix
+++ b/pkgs/applications/editors/vim/plugins/generated.nix
@@ -3333,6 +3333,18 @@ final: prev:
meta.homepage = "https://github.com/wincent/ferret/";
};
+ ferris-nvim = buildNeovimPlugin {
+ pname = "ferris.nvim";
+ version = "2023-11-21";
+ src = fetchFromGitHub {
+ owner = "mrcjkb";
+ repo = "ferris.nvim";
+ rev = "54943eaeb0d4534988d2378936052655c988c3c2";
+ sha256 = "o4yY4IHYBCnanfy7dx/wGdiPFMLMKZsYrG2SqlPRvdI=";
+ };
+ meta.homepage = "https://github.com/mrcjkb/ferris.nvim/";
+ };
+
fidget-nvim = buildVimPlugin {
pname = "fidget.nvim";
version = "2023-06-10";
diff --git a/pkgs/applications/editors/vim/plugins/vim-plugin-names b/pkgs/applications/editors/vim/plugins/vim-plugin-names
index ab353da48e24..828465764408 100644
--- a/pkgs/applications/editors/vim/plugins/vim-plugin-names
+++ b/pkgs/applications/editors/vim/plugins/vim-plugin-names
@@ -277,6 +277,7 @@ https://github.com/freddiehaddad/feline.nvim/,,
https://github.com/bakpakin/fennel.vim/,,
https://github.com/lambdalisue/fern.vim/,,
https://github.com/wincent/ferret/,,
+https://github.com/mrcjkb/ferris.nvim/,HEAD,
https://github.com/j-hui/fidget.nvim/,legacy,
https://github.com/bogado/file-line/,,
https://github.com/glacambre/firenvim/,HEAD,
diff --git a/pkgs/applications/editors/vscode/extensions/default.nix b/pkgs/applications/editors/vscode/extensions/default.nix
index c0d3415713fc..fb6e709bba20 100644
--- a/pkgs/applications/editors/vscode/extensions/default.nix
+++ b/pkgs/applications/editors/vscode/extensions/default.nix
@@ -326,8 +326,8 @@ let
mktplcRef = {
name = "astro-vscode";
publisher = "astro-build";
- version = "2.1.1";
- sha256 = "sha256-UVZOpkOHbLiwA4VfTgXxuIU8EtJLnqRa5zUVha6xQJY=";
+ version = "2.3.3";
+ sha256 = "sha256-A7+7lnCPAtSWUfHLNKbYqKuTxi2Nx05Qdh5HCkT1dnM=";
};
meta = {
changelog = "https://marketplace.visualstudio.com/items/astro-build.astro-vscode/changelog";
diff --git a/pkgs/applications/emulators/ryujinx/default.nix b/pkgs/applications/emulators/ryujinx/default.nix
index 892e6faaa94c..f4fe6f467abf 100644
--- a/pkgs/applications/emulators/ryujinx/default.nix
+++ b/pkgs/applications/emulators/ryujinx/default.nix
@@ -28,13 +28,13 @@
buildDotnetModule rec {
pname = "ryujinx";
- version = "1.1.1044"; # Based off of the official github actions builds: https://github.com/Ryujinx/Ryujinx/actions/workflows/release.yml
+ version = "1.1.1053"; # Based off of the official github actions builds: https://github.com/Ryujinx/Ryujinx/actions/workflows/release.yml
src = fetchFromGitHub {
owner = "Ryujinx";
repo = "Ryujinx";
- rev = "7afae8c69947f7a5fa9a55cee36381aef372dfba";
- sha256 = "1kf95sbb4p50b6bah75sd95660kk2a7cbjwgvqv4c4cal6c126g7";
+ rev = "28dd7d80af56701887dbb538b56aa58edaf39d91";
+ sha256 = "09h4423z18q8r8fqcd5kv34iwmy9gkmpgw8an8myrhhvkmxi3zwg";
};
dotnet-sdk = dotnetCorePackages.sdk_7_0;
diff --git a/pkgs/applications/file-managers/yazi/default.nix b/pkgs/applications/file-managers/yazi/default.nix
index 7757a1322b15..cd0476c1e00d 100644
--- a/pkgs/applications/file-managers/yazi/default.nix
+++ b/pkgs/applications/file-managers/yazi/default.nix
@@ -3,6 +3,7 @@
, lib
, makeWrapper
+, installShellFiles
, stdenv
, Foundation
@@ -30,18 +31,18 @@
rustPlatform.buildRustPackage rec {
pname = "yazi";
- version = "0.1.4";
+ version = "0.1.5";
src = fetchFromGitHub {
owner = "sxyazi";
repo = pname;
rev = "v${version}";
- hash = "sha256-ARpludMVQlZtCRAfW0cNYVmT3m9t9lunMIW24peYX6Y=";
+ hash = "sha256-FhKrq4N32uJRHGc0qRl+CIVNRW597jACcTFEgj8hiSE=";
};
- cargoHash = "sha256-dhdk5aGKv6tY8x7MmA0hWcmJBiXOXC92DlQTd/1AKtQ=";
+ cargoHash = "sha256-YUymZhDp1Pjm+W6m8Vmh2AgMCdaNt6TQQpiJwSg/gPw=";
- nativeBuildInputs = [ makeWrapper ];
+ nativeBuildInputs = [ makeWrapper installShellFiles ];
buildInputs = lib.optionals stdenv.isDarwin [ Foundation ];
postInstall = with lib;
@@ -60,6 +61,10 @@ rustPlatform.buildRustPackage rec {
''
wrapProgram $out/bin/yazi \
--prefix PATH : "${makeBinPath runtimePaths}"
+ installShellCompletion --cmd yazi \
+ --bash ./config/completions/yazi.bash \
+ --fish ./config/completions/yazi.fish \
+ --zsh ./config/completions/_yazi
'';
passthru.updateScript = nix-update-script { };
diff --git a/pkgs/applications/misc/ArchiSteamFarm/default.nix b/pkgs/applications/misc/ArchiSteamFarm/default.nix
index 60b835c719b5..1a0e90546bec 100644
--- a/pkgs/applications/misc/ArchiSteamFarm/default.nix
+++ b/pkgs/applications/misc/ArchiSteamFarm/default.nix
@@ -11,13 +11,13 @@
buildDotnetModule rec {
pname = "ArchiSteamFarm";
# nixpkgs-update: no auto update
- version = "5.4.9.3";
+ version = "5.4.12.5";
src = fetchFromGitHub {
owner = "JustArchiNET";
repo = "ArchiSteamFarm";
rev = version;
- hash = "sha256-Yp8hnMIeV+ZHY6yISJdFd1yAQipQsU5vcXgxFDvkGnA=";
+ hash = "sha256-iIYA9BnHUfsB4J7VbSLKaRdJHMW/xULJxKfv8atfAd8=";
};
dotnet-runtime = dotnetCorePackages.aspnetcore_7_0;
@@ -77,6 +77,7 @@ buildDotnetModule rec {
homepage = "https://github.com/JustArchiNET/ArchiSteamFarm";
license = licenses.asl20;
platforms = [ "x86_64-linux" "aarch64-linux" ];
+ mainProgram = "ArchiSteamFarm";
maintainers = with maintainers; [ SuperSandro2000 lom ];
};
}
diff --git a/pkgs/applications/misc/ArchiSteamFarm/deps.nix b/pkgs/applications/misc/ArchiSteamFarm/deps.nix
index 5d353bfdf6b8..6154d1ca6e2d 100644
--- a/pkgs/applications/misc/ArchiSteamFarm/deps.nix
+++ b/pkgs/applications/misc/ArchiSteamFarm/deps.nix
@@ -57,11 +57,11 @@
(fetchNuGet { pname = "Humanizer.Core.zh-Hans"; version = "2.14.1"; sha256 = "0zn99311zfn602phxyskfjq9vly0w5712z6fly8r4q0h94qa8c85"; })
(fetchNuGet { pname = "Humanizer.Core.zh-Hant"; version = "2.14.1"; sha256 = "0qxjnbdj645l5sd6y3100yyrq1jy5misswg6xcch06x8jv7zaw1p"; })
(fetchNuGet { pname = "JetBrains.Annotations"; version = "2023.2.0"; sha256 = "0nx7nrzbg9gk9skdc9x330cbr5xbsly6z9gzxm46vywf55yp8vaj"; })
- (fetchNuGet { pname = "Markdig.Signed"; version = "0.32.0"; sha256 = "0rc1d8pwypq44pr15wn8g52zbqz70swdrdmjlzccf6zvwy1vyqkc"; })
+ (fetchNuGet { pname = "Markdig.Signed"; version = "0.33.0"; sha256 = "0816lmn0varxwhdklhh5hdqp0xnfz3nlrvaf2wpkk5v1mq86216h"; })
(fetchNuGet { pname = "Microsoft.AspNetCore.JsonPatch"; version = "7.0.0"; sha256 = "1f13vsfs1rp9bmdp3khk4mk2fif932d72yxm2wszpsr239x4s2bf"; })
(fetchNuGet { pname = "Microsoft.AspNetCore.Mvc.NewtonsoftJson"; version = "7.0.0"; sha256 = "1w49rg0n5wb1m5wnays2mmym7qy7bsi2b1zxz97af2rkbw3s3hbd"; })
(fetchNuGet { pname = "Microsoft.Bcl.AsyncInterfaces"; version = "6.0.0"; sha256 = "15gqy2m14fdlvy1g59207h5kisznm355kbw010gy19vh47z8gpz3"; })
- (fetchNuGet { pname = "Microsoft.CodeCoverage"; version = "17.7.0"; sha256 = "12m9fay2d7jvj00hfpws37vflpqvz4dy4gcm25bjycg1zyfpzvly"; })
+ (fetchNuGet { pname = "Microsoft.CodeCoverage"; version = "17.7.2"; sha256 = "09mf5kpxn1a1m8ciwklhh6ascx0yqpcs5r2hvmfj80j44n3qrwhm"; })
(fetchNuGet { pname = "Microsoft.CSharp"; version = "4.7.0"; sha256 = "0gd67zlw554j098kabg887b5a6pq9kzavpa3jjy5w53ccjzjfy8j"; })
(fetchNuGet { pname = "Microsoft.Extensions.ApiDescription.Server"; version = "6.0.5"; sha256 = "1pi2bm3cm0a7jzqzmfc2r7bpcdkmk3hhjfvb2c81j7wl7xdw3624"; })
(fetchNuGet { pname = "Microsoft.Extensions.Configuration.Abstractions"; version = "6.0.0"; sha256 = "0w6wwxv12nbc3sghvr68847wc9skkdgsicrz3fx4chgng1i3xy0j"; })
@@ -71,11 +71,15 @@
(fetchNuGet { pname = "Microsoft.Extensions.Logging.Abstractions"; version = "6.0.0"; sha256 = "0b75fmins171zi6bfdcq1kcvyrirs8n91mknjnxy4c3ygi1rrnj0"; })
(fetchNuGet { pname = "Microsoft.Extensions.Options"; version = "6.0.0"; sha256 = "008pnk2p50i594ahz308v81a41mbjz9mwcarqhmrjpl2d20c868g"; })
(fetchNuGet { pname = "Microsoft.Extensions.Primitives"; version = "6.0.0"; sha256 = "1kjiw6s4yfz9gm7mx3wkhp06ghnbs95icj9hi505shz9rjrg42q2"; })
- (fetchNuGet { pname = "Microsoft.NET.Test.Sdk"; version = "17.7.0"; sha256 = "1srhqqmnf9pxdbpffr7dh0bihhf09d0iq5g6gh8ql7brfrh99lvb"; })
+ (fetchNuGet { pname = "Microsoft.IdentityModel.Abstractions"; version = "7.0.3"; sha256 = "0njmg2lygnirnfjv9gck2f5lq4ly5rgws9cpf8qj3kwcwxfp0b9s"; })
+ (fetchNuGet { pname = "Microsoft.IdentityModel.JsonWebTokens"; version = "7.0.3"; sha256 = "1ayh85xqdq8rqjk2iqcn7iaczcl7d8qg6bxk0b4rgx59fmsmbqj7"; })
+ (fetchNuGet { pname = "Microsoft.IdentityModel.Logging"; version = "7.0.3"; sha256 = "13cjqmf59k895q6gkd5ycl89mnpalckda7rhsdl11jdyr32hsfnv"; })
+ (fetchNuGet { pname = "Microsoft.IdentityModel.Tokens"; version = "7.0.3"; sha256 = "1pmhd0imh9wlhvbvvwjrpjsqvzagi2ly22nddwr4r0pi234khyz1"; })
+ (fetchNuGet { pname = "Microsoft.NET.Test.Sdk"; version = "17.7.2"; sha256 = "08g9dpp766racnh90s1sy3ncl291majgq6v2604hfw1f6zkmbjqh"; })
(fetchNuGet { pname = "Microsoft.NETCore.Platforms"; version = "5.0.0"; sha256 = "0mwpwdflidzgzfx2dlpkvvnkgkr2ayaf0s80737h4wa35gaj11rc"; })
(fetchNuGet { pname = "Microsoft.OpenApi"; version = "1.2.3"; sha256 = "07b19k89whj69j87afkz86gp9b3iybw8jqwvlgcn43m7fb2y99rr"; })
- (fetchNuGet { pname = "Microsoft.TestPlatform.ObjectModel"; version = "17.7.0"; sha256 = "1sqmk99644fx66zk2qa2ims1zl6741i3wl4rjh4z6jakd4xbc28i"; })
- (fetchNuGet { pname = "Microsoft.TestPlatform.TestHost"; version = "17.7.0"; sha256 = "1s8ap0ljqssbqp1ilgsidjr948b9szf1cbl3fgl6smxig9im4zrl"; })
+ (fetchNuGet { pname = "Microsoft.TestPlatform.ObjectModel"; version = "17.7.2"; sha256 = "0xdjkdnrvnaxqgg38y5w1l3jbppigg68cc8q9jn0p21vn48bgrxq"; })
+ (fetchNuGet { pname = "Microsoft.TestPlatform.TestHost"; version = "17.7.2"; sha256 = "1szsg1iy77f0caxzkk0ihpp4ifbfnbdbn8k0wbbhbdprxj8pr356"; })
(fetchNuGet { pname = "Microsoft.Win32.Registry"; version = "5.0.0"; sha256 = "102hvhq2gmlcbq8y2cb7hdr2dnmjzfp2k3asr1ycwrfacwyaak7n"; })
(fetchNuGet { pname = "MSTest.TestAdapter"; version = "3.1.1"; sha256 = "0y3ic8jv5jhld6gan2qfa2wyk4z57f7y4y5a47njr0jvxxnarg2c"; })
(fetchNuGet { pname = "MSTest.TestFramework"; version = "3.1.1"; sha256 = "1lbgkrbrkmw4c54g61cwbmwc4zl8hyqmp283ymvj93lq7chbxasn"; })
@@ -86,9 +90,9 @@
(fetchNuGet { pname = "Nito.AsyncEx.Tasks"; version = "5.1.2"; sha256 = "11wp47kc69sjdxrbg5pgx0wlffqlp0x5kr54ggnz2v19kmjz362v"; })
(fetchNuGet { pname = "Nito.Collections.Deque"; version = "1.1.1"; sha256 = "152564q3s0n5swfv5p5rx0ghn2sm0g2xsnbd7gv8vb9yfklv7yg8"; })
(fetchNuGet { pname = "Nito.Disposables"; version = "2.2.1"; sha256 = "1hx5k8497j34kxxgh060bvij0vfnraw90dmm3h9bmamcdi8wp80l"; })
- (fetchNuGet { pname = "NLog"; version = "5.2.3"; sha256 = "0srai3s2kk9y2jimdvw1xw86nch38q6nza598dpr81dghx3s6j6w"; })
- (fetchNuGet { pname = "NLog.Extensions.Logging"; version = "5.3.3"; sha256 = "0j19fljxbcc0bysmj7i0fmiax6sp5kjapf2llkimv7dh63rj9ckg"; })
- (fetchNuGet { pname = "NLog.Web.AspNetCore"; version = "5.3.3"; sha256 = "0rhha2lwrzwlx0q1a8w9ph9xwayl3kmmy200ygsghcd02srlazkj"; })
+ (fetchNuGet { pname = "NLog"; version = "5.2.5"; sha256 = "02fybqi9d7czz3jmhmgb8wia2hpjj5hmcnij6zsgs69rkv6hf9j0"; })
+ (fetchNuGet { pname = "NLog.Extensions.Logging"; version = "5.3.5"; sha256 = "0jzfqa12l5vvxd2j684cnm29w19v386cpm11pw8h6prpf57affaj"; })
+ (fetchNuGet { pname = "NLog.Web.AspNetCore"; version = "5.3.5"; sha256 = "0li0sw04w0a4zms5jjv1ga45wxiqlcvaw8gi0wbhiifrdzz5yckb"; })
(fetchNuGet { pname = "NuGet.Frameworks"; version = "6.5.0"; sha256 = "0s37d1p4md0k6d4cy6sq36f2dgkd9qfbzapxhkvi8awwh0vrynhj"; })
(fetchNuGet { pname = "protobuf-net"; version = "3.2.16"; sha256 = "0pwlqlq2p8my2sr8b0cvdav5cm8wpwf3s4gy7s1ba701ac2zyb9y"; })
(fetchNuGet { pname = "protobuf-net.Core"; version = "3.2.16"; sha256 = "00znhikq7valr3jaxg66cwli9hf75wkmmpf6rf8p790hf8lxq0c5"; })
@@ -108,6 +112,7 @@
(fetchNuGet { pname = "System.Composition.Runtime"; version = "7.0.0"; sha256 = "1p9xpqzx42s8cdizv6nh15hcjvl2km0rwby66nfkj4cb472l339s"; })
(fetchNuGet { pname = "System.Composition.TypedParts"; version = "7.0.0"; sha256 = "0syz7y6wgnxxgjvfqgymn9mnaa5fjy1qp06qnsvh3agr9mvcv779"; })
(fetchNuGet { pname = "System.Diagnostics.DiagnosticSource"; version = "6.0.0"; sha256 = "0rrihs9lnb1h6x4h0hn6kgfnh58qq7hx8qq99gh6fayx4dcnx3s5"; })
+ (fetchNuGet { pname = "System.IdentityModel.Tokens.Jwt"; version = "7.0.3"; sha256 = "1fls88ffq34j1gr6zay1crm27v3sjs5fa4mvj9akqjq05bxanlhk"; })
(fetchNuGet { pname = "System.Linq.Async"; version = "6.0.1"; sha256 = "10ira8hmv0i54yp9ggrrdm1c06j538sijfjpn1kmnh9j2xk5yzmq"; })
(fetchNuGet { pname = "System.Reflection.Metadata"; version = "1.6.0"; sha256 = "1wdbavrrkajy7qbdblpbpbalbdl48q3h34cchz24gvdgyrlf15r4"; })
(fetchNuGet { pname = "System.Runtime.CompilerServices.Unsafe"; version = "6.0.0"; sha256 = "0qm741kh4rh57wky16sq4m0v05fxmkjjr87krycf5vp9f0zbahbc"; })
diff --git a/pkgs/applications/misc/ArchiSteamFarm/update.sh b/pkgs/applications/misc/ArchiSteamFarm/update.sh
index 9af9acb69835..53d3ee664191 100755
--- a/pkgs/applications/misc/ArchiSteamFarm/update.sh
+++ b/pkgs/applications/misc/ArchiSteamFarm/update.sh
@@ -1,5 +1,5 @@
#!/usr/bin/env nix-shell
-#!nix-shell -I nixpkgs=./. -i bash -p curl gnused jq common-updater-scripts nix-prefetch prefetch-npm-deps
+#!nix-shell -I nixpkgs=./. -i bash -p curl gnused jq common-updater-scripts
set -euo pipefail
cd "$(dirname "${BASH_SOURCE[0]}")"
@@ -14,7 +14,7 @@ if [[ "$new_version" == "$old_version" ]]; then
fi
asf_path=$PWD
-pushd ../../../..
+cd ../../../..
if [[ "${1:-}" != "--deps-only" ]]; then
update-source-version ArchiSteamFarm "$new_version"
@@ -22,5 +22,5 @@ fi
$(nix-build -A ArchiSteamFarm.fetch-deps --no-out-link)
-popd
-"$asf_path/web-ui/update.sh"
+cd "$asf_path/web-ui"
+./update.sh
diff --git a/pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore b/pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore
new file mode 100644
index 000000000000..d8b83df9cdb6
--- /dev/null
+++ b/pkgs/applications/misc/ArchiSteamFarm/web-ui/.gitignore
@@ -0,0 +1 @@
+package-lock.json
diff --git a/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix b/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix
index 77f4e9c6e299..4dad0b1f5b6b 100644
--- a/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix
+++ b/pkgs/applications/misc/ArchiSteamFarm/web-ui/default.nix
@@ -1,19 +1,19 @@
-{ lib, fetchFromGitHub, buildNpmPackage, nodePackages, ArchiSteamFarm }:
+{ lib, fetchFromGitHub, buildNpmPackage, ArchiSteamFarm }:
-buildNpmPackage {
+buildNpmPackage rec {
pname = "asf-ui";
- inherit (ArchiSteamFarm) version;
+ version = "fceb2fb828cfa420c77dc5cde433fd519a6717d4";
src = fetchFromGitHub {
owner = "JustArchiNET";
repo = "ASF-ui";
# updated by the update script
# this is always the commit that should be used with asf-ui from the latest asf version
- rev = "0b812a7ab0d2f01a675d27f80008ad7b6972b4aa";
- hash = "sha256-ut0x/qT3DyDASW4QbNT+BF6eXHCIbTol5E+3+tirFDA=";
+ rev = version;
+ hash = "sha256-gMQWly7HN5rIV9r72Qa+gHuBuQMs9sh09od4ja4sRGU=";
};
- npmDepsHash = "sha256-HpBEoAIGejpHJnUciz4iWILcXdgpw7X1xFuXmx9Z9dw=";
+ npmDepsHash = "sha256-UDCQTRpcPDcuvPzlqTu315EkGr5G0+z7qMSsPgYQacA=";
installPhase = ''
runHook preInstall
diff --git a/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh b/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh
index 7f026383383d..6fa8e67a1217 100755
--- a/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh
+++ b/pkgs/applications/misc/ArchiSteamFarm/web-ui/update.sh
@@ -1,23 +1,19 @@
#!/usr/bin/env nix-shell
-#! nix-shell -I nixpkgs=../../../.. -i bash -p nodePackages.node2nix gnused jq curl
+#! nix-shell -I nixpkgs=../../../../.. -i bash -p curl gnused jq common-updater-scripts prefetch-npm-deps
set -eou pipefail
-cd "$(dirname "$0")"
-pushd ../../../../..
+cd "$(dirname "$0")"/../../../../..
version=$(nix-instantiate --strict --eval -A ArchiSteamFarm.version | jq -r)
-popd
-pushd "$(dirname "$0")"
+cd -
ui=$(curl ${GITHUB_TOKEN:+" -u \":$GITHUB_TOKEN\""} "https://api.github.com/repos/JustArchiNET/ArchiSteamFarm/contents/ASF-ui?ref=$version" | jq -r .sha)
curl "https://raw.githubusercontent.com/JustArchiNET/ASF-ui/$ui/package-lock.json" -o package-lock.json
-# update-source-version doesn't work for some reason
-sed -i "s/rev\\s*=\\s*.*/rev = \"$ui\";/" default.nix
-sed -i "s/hash\\s*=\\s*.*/hash = \"$(nix-prefetch fetchurl --url "https://github.com/JustArchiNET/ASF-ui/archive/$ui.tar.gz")\";/" default.nix
+cd -
+update-source-version ArchiSteamFarm.ui "$ui"
+cd -
npmDepsHash=$(prefetch-npm-deps ./package-lock.json)
sed -E 's#\bnpmDepsHash = ".*?"#npmDepsHash = "'"$npmDepsHash"'"#' -i default.nix
rm package-lock.json
-
-popd
diff --git a/pkgs/applications/misc/albert/default.nix b/pkgs/applications/misc/albert/default.nix
index a9008283dd28..ceb74f7b0a32 100644
--- a/pkgs/applications/misc/albert/default.nix
+++ b/pkgs/applications/misc/albert/default.nix
@@ -10,6 +10,7 @@
, qtscxml
, qtsvg
, qtdeclarative
+, qtwayland
, qt5compat
, wrapQtAppsHook
, nix-update-script
@@ -42,6 +43,7 @@ stdenv.mkDerivation (finalAttrs: {
qtscxml
qtsvg
qtdeclarative
+ qtwayland
qt5compat
] ++ (with python3Packages; [ python pybind11 ]);
diff --git a/pkgs/applications/misc/dasel/default.nix b/pkgs/applications/misc/dasel/default.nix
index 04804732edc4..14a8f6013f2b 100644
--- a/pkgs/applications/misc/dasel/default.nix
+++ b/pkgs/applications/misc/dasel/default.nix
@@ -6,16 +6,16 @@
buildGoModule rec {
pname = "dasel";
- version = "2.3.6";
+ version = "2.4.1";
src = fetchFromGitHub {
owner = "TomWright";
repo = "dasel";
rev = "v${version}";
- sha256 = "sha256-k+I4n05IbQT7tGzkJ0aPW6kLT1mGqwQOwoKDyal8L3w=";
+ sha256 = "sha256-zxTT/CkSbH40R7itXAx0zD+haHOoMep/W4KfalJQ/8w=";
};
- vendorHash = "sha256-Gueo8aZS5N1rLqZweXjXv7BLrtShxGDSGfbkYXhy4DQ=";
+ vendorHash = "sha256-CbR0uHtha2OoHW9mcB1I2lGJbjerbZARVN/mTstv/Y0=";
ldflags = [
"-s" "-w" "-X github.com/tomwright/dasel/v2/internal.Version=${version}"
diff --git a/pkgs/applications/misc/nwg-displays/default.nix b/pkgs/applications/misc/nwg-displays/default.nix
index f0fc2b1bb368..18ba079088af 100644
--- a/pkgs/applications/misc/nwg-displays/default.nix
+++ b/pkgs/applications/misc/nwg-displays/default.nix
@@ -14,13 +14,13 @@
python310Packages.buildPythonApplication rec {
pname = "nwg-displays";
- version = "0.3.7";
+ version = "0.3.8";
src = fetchFromGitHub {
owner = "nwg-piotr";
repo = "nwg-displays";
rev = "v${version}";
- hash = "sha256-Y405ZeOSpc1aPKEzFdvlgJgpGAi9HUR+Hvx63uYdp88=";
+ hash = "sha256-9v5TQTliUEnynoGDf1UXsQ9Ym7x2gPmx4QiRJH5BId4=";
};
nativeBuildInputs = [
diff --git a/pkgs/applications/misc/nwg-panel/default.nix b/pkgs/applications/misc/nwg-panel/default.nix
index a4d333e594c3..90864dee69ba 100644
--- a/pkgs/applications/misc/nwg-panel/default.nix
+++ b/pkgs/applications/misc/nwg-panel/default.nix
@@ -15,13 +15,13 @@
python3Packages.buildPythonApplication rec {
pname = "nwg-panel";
- version = "0.9.13";
+ version = "0.9.14";
src = fetchFromGitHub {
owner = "nwg-piotr";
repo = "nwg-panel";
rev = "v${version}";
- hash = "sha256-dP/FbMrjPextwedQeLJHM6f/a+EuZ+hQSLrH/rF2XOg=";
+ hash = "sha256-ThcB/BhnJbBHUoRh120iqN6LMGOnkekzALTTgd8uUx4=";
};
# No tests
diff --git a/pkgs/applications/misc/obsidian/default.nix b/pkgs/applications/misc/obsidian/default.nix
index 78967c55a5d7..43ea198d62c9 100644
--- a/pkgs/applications/misc/obsidian/default.nix
+++ b/pkgs/applications/misc/obsidian/default.nix
@@ -12,7 +12,7 @@
let
inherit (stdenv.hostPlatform) system;
pname = "obsidian";
- version = "1.4.14";
+ version = "1.4.16";
appname = "Obsidian";
meta = with lib; {
description = "A powerful knowledge base that works on top of a local folder of plain text Markdown files";
@@ -25,7 +25,7 @@ let
filename = if stdenv.isDarwin then "Obsidian-${version}-universal.dmg" else "obsidian-${version}.tar.gz";
src = fetchurl {
url = "https://github.com/obsidianmd/obsidian-releases/releases/download/v${version}/${filename}";
- hash = if stdenv.isDarwin then "sha256-5cVKlZJDtXOkil+RohijCcqyJVTrysmqyTvJR0dDAuc=" else "sha256-qFSQer37Nkh3A3oVAFP/0qXzPWJ7SqY2GYA6b1iaYmE=";
+ hash = if stdenv.isDarwin then "sha256-ydLWr+Snkza9G+R7HbPuUdoZsL25Uj+KDos67Mq/urY=" else "sha256-PBKLGs3MZyarSMiWnjqY7d9bQrKu2uLAvLUufpHLxcw=";
};
icon = fetchurl {
diff --git a/pkgs/applications/networking/browsers/brave/default.nix b/pkgs/applications/networking/browsers/brave/default.nix
index 8466850808cb..c3495160029f 100644
--- a/pkgs/applications/networking/browsers/brave/default.nix
+++ b/pkgs/applications/networking/browsers/brave/default.nix
@@ -92,11 +92,11 @@ in
stdenv.mkDerivation rec {
pname = "brave";
- version = "1.59.117";
+ version = "1.59.120";
src = fetchurl {
url = "https://github.com/brave/brave-browser/releases/download/v${version}/brave-browser_${version}_amd64.deb";
- sha256 = "sha256-yckxTKAgglk6YRXist9RZufZdI22iitecmb01NmYPGQ=";
+ sha256 = "sha256-fkIU6XuydF6Bo8V0uS4NObh2fRuKxOWMqVft81uUs9Q=";
};
dontConfigure = true;
diff --git a/pkgs/applications/networking/browsers/chromium/common.nix b/pkgs/applications/networking/browsers/chromium/common.nix
index 22d71e8975f8..2a686f87d164 100644
--- a/pkgs/applications/networking/browsers/chromium/common.nix
+++ b/pkgs/applications/networking/browsers/chromium/common.nix
@@ -67,16 +67,16 @@ let
]);
clangFormatPython3 = fetchurl {
url = "https://chromium.googlesource.com/chromium/tools/build/+/e77882e0dde52c2ccf33c5570929b75b4a2a2522/recipes/recipe_modules/chromium/resources/clang-format?format=TEXT";
- sha256 = "0ic3hn65dimgfhakli1cyf9j3cxcqsf1qib706ihfhmlzxf7256l";
+ hash = "sha256-1BRxXP+0QgejAWdFHJzGrLMhk/MsRDoVdK/GVoyFg0U=";
};
# The additional attributes for creating derivations based on the chromium
# source tree.
extraAttrs = buildFun base;
- githubPatch = { commit, sha256, revert ? false }: fetchpatch {
+ githubPatch = { commit, hash, revert ? false }: fetchpatch {
url = "https://github.com/chromium/chromium/commit/${commit}.patch";
- inherit sha256 revert;
+ inherit hash revert;
};
mkGnFlags =
@@ -118,7 +118,7 @@ let
libExecPath = "$out/libexec/${packageName}";
ungoogler = ungoogled-chromium {
- inherit (upstream-info.deps.ungoogled-patches) rev sha256;
+ inherit (upstream-info.deps.ungoogled-patches) rev hash;
};
# There currently isn't a (much) more concise way to get a stdenv
@@ -148,10 +148,10 @@ let
else throw "no chromium Rosetta Stone entry for os: ${platform.config}";
};
- recompressTarball = { version, sha256 ? "" }: fetchzip {
+ recompressTarball = { version, hash ? "" }: fetchzip {
name = "chromium-${version}.tar.zstd";
url = "https://commondatastorage.googleapis.com/chromium-browser-official/chromium-${version}.tar.xz";
- inherit sha256;
+ inherit hash;
nativeBuildInputs = [ zstd ];
@@ -180,7 +180,7 @@ let
inherit (upstream-info) version;
inherit packageName buildType buildPath;
- src = recompressTarball { inherit version; inherit (upstream-info) sha256; };
+ src = recompressTarball { inherit version; inherit (upstream-info) hash; };
nativeBuildInputs = [
ninja pkg-config
@@ -250,7 +250,7 @@ let
(githubPatch {
# Reland [clang] Disable autoupgrading debug info in ThinLTO builds
commit = "54969766fd2029c506befc46e9ce14d67c7ed02a";
- sha256 = "sha256-Vryjg8kyn3cxWg3PmSwYRG6zrHOqYWBMSdEMGiaPg6M=";
+ hash = "sha256-Vryjg8kyn3cxWg3PmSwYRG6zrHOqYWBMSdEMGiaPg6M=";
revert = true;
})
];
@@ -315,9 +315,6 @@ let
sed -i -e '/lib_loader.*Load/s!"\(libudev\.so\)!"${lib.getLib systemd}/lib/\1!' \
device/udev_linux/udev?_loader.cc
'' + ''
- sed -i -e '/libpci_loader.*Load/s!"\(libpci\.so\)!"${pciutils}/lib/\1!' \
- gpu/config/gpu_info_collector_linux.cc
-
# Allow to put extensions into the system-path.
sed -i -e 's,/usr,/run/current-system/sw,' chrome/common/chrome_paths.cc
@@ -479,9 +476,10 @@ let
postFixup = ''
# Make sure that libGLESv2 and libvulkan are found by dlopen.
+ # libpci (from pciutils) is needed by dlopen in angle/src/gpu_info_util/SystemInfo_libpci.cpp
chromiumBinary="$libExecPath/$packageName"
origRpath="$(patchelf --print-rpath "$chromiumBinary")"
- patchelf --set-rpath "${lib.makeLibraryPath [ libGL vulkan-loader ]}:$origRpath" "$chromiumBinary"
+ patchelf --set-rpath "${lib.makeLibraryPath [ libGL vulkan-loader pciutils ]}:$origRpath" "$chromiumBinary"
'';
passthru = {
diff --git a/pkgs/applications/networking/browsers/chromium/default.nix b/pkgs/applications/networking/browsers/chromium/default.nix
index 5677bc37e844..7c2c75e74974 100644
--- a/pkgs/applications/networking/browsers/chromium/default.nix
+++ b/pkgs/applications/networking/browsers/chromium/default.nix
@@ -57,7 +57,7 @@ let
gnChromium = buildPackages.gn.overrideAttrs (oldAttrs: {
inherit (upstream-info.deps.gn) version;
src = fetchgit {
- inherit (upstream-info.deps.gn) url rev sha256;
+ inherit (upstream-info.deps.gn) url rev hash;
};
});
});
@@ -80,12 +80,12 @@ let
chromeSrc =
let
# Use the latest stable Chrome version if necessary:
- version = if chromium.upstream-info.sha256bin64 != null
+ version = if chromium.upstream-info.hash_deb_amd64 != null
then chromium.upstream-info.version
else (import ./upstream-info.nix).stable.version;
- sha256 = if chromium.upstream-info.sha256bin64 != null
- then chromium.upstream-info.sha256bin64
- else (import ./upstream-info.nix).stable.sha256bin64;
+ hash = if chromium.upstream-info.hash_deb_amd64 != null
+ then chromium.upstream-info.hash_deb_amd64
+ else (import ./upstream-info.nix).stable.hash_deb_amd64;
in fetchurl {
urls = map (repo: "${repo}/${pkgName}/${pkgName}_${version}-1_amd64.deb") [
"https://dl.google.com/linux/chrome/deb/pool/main/g"
@@ -93,7 +93,7 @@ let
"http://mirror.pcbeta.com/google/chrome/deb/pool/main/g"
"http://repo.fdzh.org/chrome/deb/pool/main/g"
];
- inherit sha256;
+ inherit hash;
};
mkrpath = p: "${lib.makeSearchPathOutput "lib" "lib64" p}:${lib.makeLibraryPath p}";
diff --git a/pkgs/applications/networking/browsers/chromium/ungoogled.nix b/pkgs/applications/networking/browsers/chromium/ungoogled.nix
index 549d2853776f..cf3d0a7d73ad 100644
--- a/pkgs/applications/networking/browsers/chromium/ungoogled.nix
+++ b/pkgs/applications/networking/browsers/chromium/ungoogled.nix
@@ -6,10 +6,10 @@
}:
{ rev
-, sha256
+, hash
}:
-stdenv.mkDerivation rec {
+stdenv.mkDerivation {
pname = "ungoogled-chromium";
version = rev;
@@ -17,7 +17,7 @@ stdenv.mkDerivation rec {
src = fetchFromGitHub {
owner = "ungoogled-software";
repo = "ungoogled-chromium";
- inherit rev sha256;
+ inherit rev hash;
};
dontBuild = true;
diff --git a/pkgs/applications/networking/browsers/chromium/update.py b/pkgs/applications/networking/browsers/chromium/update.py
index fd8f36778405..60267331cc27 100755
--- a/pkgs/applications/networking/browsers/chromium/update.py
+++ b/pkgs/applications/networking/browsers/chromium/update.py
@@ -59,9 +59,9 @@ def prefetch_src_sri_hash(attr_path, version):
def nix_prefetch_url(url, algo='sha256'):
"""Prefetches the content of the given URL."""
- print(f'nix-prefetch-url {url}')
- out = subprocess.check_output(['nix-prefetch-url', '--type', algo, url])
- return out.decode('utf-8').rstrip()
+ print(f'nix store prefetch-file {url}')
+ out = subprocess.check_output(['nix', 'store', 'prefetch-file', '--json', '--hash-type', algo, url])
+ return json.loads(out)['hash']
def nix_prefetch_git(url, rev):
@@ -96,9 +96,9 @@ def get_chromedriver(channel):
return {
'version': channel['version'],
- 'sha256_linux': nix_prefetch_url(get_chromedriver_url('linux64')),
- 'sha256_darwin': nix_prefetch_url(get_chromedriver_url('mac-x64')),
- 'sha256_darwin_aarch64': nix_prefetch_url(get_chromedriver_url('mac-arm64'))
+ 'hash_linux': nix_prefetch_url(get_chromedriver_url('linux64')),
+ 'hash_darwin': nix_prefetch_url(get_chromedriver_url('mac-x64')),
+ 'hash_darwin_aarch64': nix_prefetch_url(get_chromedriver_url('mac-arm64'))
}
@@ -113,7 +113,7 @@ def get_channel_dependencies(version):
'version': datetime.fromisoformat(gn['date']).date().isoformat(),
'url': gn['url'],
'rev': gn['rev'],
- 'sha256': gn['sha256']
+ 'hash': gn['hash']
}
}
@@ -222,11 +222,11 @@ with urlopen(RELEASES_URL) as resp:
google_chrome_suffix = channel_name
try:
- channel['sha256'] = prefetch_src_sri_hash(
+ channel['hash'] = prefetch_src_sri_hash(
channel_name_to_attr_name(channel_name),
release["version"]
)
- channel['sha256bin64'] = nix_prefetch_url(
+ channel['hash_deb_amd64'] = nix_prefetch_url(
f'{DEB_URL}/google-chrome-{google_chrome_suffix}/' +
f'google-chrome-{google_chrome_suffix}_{release["version"]}-1_amd64.deb')
except subprocess.CalledProcessError:
@@ -241,7 +241,7 @@ with urlopen(RELEASES_URL) as resp:
ungoogled_repo_url = 'https://github.com/ungoogled-software/ungoogled-chromium.git'
channel['deps']['ungoogled-patches'] = {
'rev': release['ungoogled_tag'],
- 'sha256': nix_prefetch_git(ungoogled_repo_url, release['ungoogled_tag'])['sha256']
+ 'hash': nix_prefetch_git(ungoogled_repo_url, release['ungoogled_tag'])['hash']
}
with open(UNGOOGLED_FLAGS_PATH, 'w') as out:
out.write(get_ungoogled_chromium_gn_flags(release['ungoogled_tag']))
diff --git a/pkgs/applications/networking/browsers/chromium/upstream-info.nix b/pkgs/applications/networking/browsers/chromium/upstream-info.nix
index b8004a7d4b39..29a15907cb36 100644
--- a/pkgs/applications/networking/browsers/chromium/upstream-info.nix
+++ b/pkgs/applications/networking/browsers/chromium/upstream-info.nix
@@ -3,63 +3,63 @@
deps = {
gn = {
rev = "811d332bd90551342c5cbd39e133aa276022d7f8";
- sha256 = "0jlg3d31p346na6a3yk0x29pm6b7q03ck423n5n6mi8nv4ybwajq";
+ hash = "sha256-WCq+PNkWxWpssUOQyQbAZ5l6k+hg+qGMsoaMG0Ybj0o=";
url = "https://gn.googlesource.com/gn";
version = "2023-08-01";
};
};
- sha256 = "0c3adrrgpnhm8g1546ask9pf17qj1sjgb950mj0rv4snxvddi75j";
- sha256bin64 = "11w1di146mjb9ql30df9yk9x4b9amc6514jzyfbf09mqsrw88dvr";
+ hash = "sha256-spzY2u5Wk52BrKCk9aQOEp/gbppaGVLCQxXa+3JuajA=";
+ hash_deb_amd64 = "sha256-eTeEeNa4JuCW81+SUAyrKi3S0/TJNTAoTktWQ0JsgYc=";
version = "117.0.5938.22";
};
dev = {
deps = {
gn = {
rev = "cc56a0f98bb34accd5323316e0292575ff17a5d4";
- sha256 = "1ly7z48v147bfdb1kqkbc98myxpgqq3g6vgr8bjx1ikrk17l82ab";
+ hash = "sha256-SwlET5h5xtDlQvlt8wbG73ZfUWJr4hlWc+uQsBH5x9M=";
url = "https://gn.googlesource.com/gn";
version = "2023-08-10";
};
};
- sha256 = "16dq27lsywrn2xlgr5g46gdv15p30sihfamli4vkv3zxzfxdjisv";
- sha256bin64 = "11y09hsy7y1vg65xfilq44ffsmn15dqy80fa57psj1kin4a52v2x";
+ hash = "sha256-W0fZuvv9jz03ibQqB6MG45aw2zPklfxoFzZzr+kRuJk=";
+ hash_deb_amd64 = "sha256-XWxRFLFxBqnvKcoB5HErwVbtHCGYRteLeTv44zVMwIc=";
version = "118.0.5966.0";
};
stable = {
chromedriver = {
- sha256_darwin = "0y973bs4dbdrl152bfiq5avsp6h27j3v1kwgcgxk1d0g293322xs";
- sha256_darwin_aarch64 =
- "04qrhr52qc9rhmslgsh2yymsix9cv32g39xbpf8576scihfdngv8";
- sha256_linux = "1hy3s6j20h03ria033kfxd3rq259davvpjny4gpvznzklns71vi1";
+ hash_darwin = "sha256-ugsxRhIPtDD7Y4/PsIc8Apqrtyo4uiVKoLmtRvQaJ3k=";
+ hash_darwin_aarch64 =
+ "sha256-aD/bHIxMm1OQu6un8cTYLPWoq/cC6kd1hTkxLEqGGRM=";
+ hash_linux = "sha256-Ie5wtKXz27/vI97Ku7dqqQicR+tujgFUzANAIKTRw8M=";
version = "118.0.5993.70";
};
deps = {
gn = {
rev = "cc56a0f98bb34accd5323316e0292575ff17a5d4";
- sha256 = "1ly7z48v147bfdb1kqkbc98myxpgqq3g6vgr8bjx1ikrk17l82ab";
+ hash = "sha256-SwlET5h5xtDlQvlt8wbG73ZfUWJr4hlWc+uQsBH5x9M=";
url = "https://gn.googlesource.com/gn";
version = "2023-08-10";
};
};
- sha256 = "sha256-CTkw92TiRD2tkYu5a5dy8fjpR2MMOMCvcbxXhJ36Bp8=";
- sha256bin64 = "06rbsjh4khhl408181ns5nsdwasklb277fdjfajdv5h1j9a190k3";
+ hash = "sha256-CTkw92TiRD2tkYu5a5dy8fjpR2MMOMCvcbxXhJ36Bp8=";
+ hash_deb_amd64 = "sha256-Y4IUVJIBlt2kcrK5c8SiUyvetC3aBhQQIBTCSaDUKxs=";
version = "118.0.5993.88";
};
ungoogled-chromium = {
deps = {
gn = {
rev = "cc56a0f98bb34accd5323316e0292575ff17a5d4";
- sha256 = "1ly7z48v147bfdb1kqkbc98myxpgqq3g6vgr8bjx1ikrk17l82ab";
+ hash = "sha256-SwlET5h5xtDlQvlt8wbG73ZfUWJr4hlWc+uQsBH5x9M=";
url = "https://gn.googlesource.com/gn";
version = "2023-08-10";
};
ungoogled-patches = {
rev = "118.0.5993.88-1";
- sha256 = "17j47d64l97ascp85h8cnfnr5wr4va3bdk95wmagqss7ym5c7zsf";
+ hash = "sha256-Tv/DSvVHa/xU5SXNtobaJPOSrbMMwYIu0+okSkw7RJ4=";
};
};
- sha256 = "sha256-CTkw92TiRD2tkYu5a5dy8fjpR2MMOMCvcbxXhJ36Bp8=";
- sha256bin64 = "06rbsjh4khhl408181ns5nsdwasklb277fdjfajdv5h1j9a190k3";
+ hash = "sha256-CTkw92TiRD2tkYu5a5dy8fjpR2MMOMCvcbxXhJ36Bp8=";
+ hash_deb_amd64 = "sha256-Y4IUVJIBlt2kcrK5c8SiUyvetC3aBhQQIBTCSaDUKxs=";
version = "118.0.5993.88";
};
}
diff --git a/pkgs/applications/networking/browsers/firefox/packages.nix b/pkgs/applications/networking/browsers/firefox/packages.nix
index 6d7e0198829f..94f01b8af398 100644
--- a/pkgs/applications/networking/browsers/firefox/packages.nix
+++ b/pkgs/applications/networking/browsers/firefox/packages.nix
@@ -30,11 +30,11 @@
firefox-beta = buildMozillaMach rec {
pname = "firefox-beta";
- version = "119.0b4";
+ version = "119.0b9";
applicationName = "Mozilla Firefox Beta";
src = fetchurl {
url = "mirror://mozilla/firefox/releases/${version}/source/firefox-${version}.source.tar.xz";
- sha512 = "7c067d759602608e527d032f7a3772df827a5b5c4270992c05abda726fcd665f4f2c5380e684623ed108364ace4afaed8b5959f75a4b0540edd5ae30422b0e54";
+ sha512 = "11d07474e3ca72a4e2f60053882e09a215e0d29d6830d0cd41447bb67370118356090af7adcbacd7703ad9fcdda83c9f909419c86b8f3bf2eacd9ca3d3aa3f54";
};
meta = {
@@ -58,12 +58,12 @@
firefox-devedition = (buildMozillaMach rec {
pname = "firefox-devedition";
- version = "119.0b4";
+ version = "119.0b9";
applicationName = "Mozilla Firefox Developer Edition";
branding = "browser/branding/aurora";
src = fetchurl {
url = "mirror://mozilla/devedition/releases/${version}/source/firefox-${version}.source.tar.xz";
- sha512 = "ded00bc1e090bdca5f32160d980cec47590bb952a6c7f1dc8f4df30fa452cad8c47a3c6d20cf3e8345fd5811777b475354d71d704c866fb49396a83c8a795bcb";
+ sha512 = "ce3e2adb3171aa05c7af3b7a4ea25eaafbc109c522b90e26aad577192a0902000fb7d705fa5707a9a7d0be2ab1c0cddc5a98abbe6549e1377c0a1d765bda62eb";
};
meta = {
diff --git a/pkgs/applications/networking/cluster/cloudfoundry-cli/default.nix b/pkgs/applications/networking/cluster/cloudfoundry-cli/default.nix
index 0371e8c813bd..2204a9405027 100644
--- a/pkgs/applications/networking/cluster/cloudfoundry-cli/default.nix
+++ b/pkgs/applications/networking/cluster/cloudfoundry-cli/default.nix
@@ -2,15 +2,15 @@
buildGoModule rec {
pname = "cloudfoundry-cli";
- version = "8.7.3";
+ version = "8.7.4";
src = fetchFromGitHub {
owner = "cloudfoundry";
repo = "cli";
rev = "v${version}";
- sha256 = "sha256-2ABsxoGRRUfa09tVPmn1IXDR2IXIewg/b/fmQnaKLoY=";
+ sha256 = "sha256-W4+2ugRSSP3HgmyQJKGCPMX7cmE7Fk3iovBOgBen+q8=";
};
- vendorHash = "sha256-k2NI9zyeQM4PJo2wE3WkG5sntJGISwmz4xqQVChu8WQ=";
+ vendorHash = "sha256-klbKL/c7L7kHPadDa/FkpuAgHYQmuLQK6yFhph52KsU=";
subPackages = [ "." ];
diff --git a/pkgs/applications/networking/cluster/eks-node-viewer/default.nix b/pkgs/applications/networking/cluster/eks-node-viewer/default.nix
index b4f9ce722e79..80538f0f111c 100644
--- a/pkgs/applications/networking/cluster/eks-node-viewer/default.nix
+++ b/pkgs/applications/networking/cluster/eks-node-viewer/default.nix
@@ -2,16 +2,16 @@
buildGoModule rec {
pname = "eks-node-viewer";
- version = "0.4.3";
+ version = "0.5.0";
src = fetchFromGitHub {
owner = "awslabs";
repo = pname;
rev = "v${version}";
- sha256 = "sha256-570wOLUtKKzDDLLDrAOPAnAUpZeAqrwKsQWoHCBjKKk=";
+ sha256 = "sha256-kfX9BzARDWUOBIu67j60K38uwkRELxd/gXtEHOHAXS8=";
};
- vendorHash = "sha256-kRRUaA/psQDmcM1ZhzdZE3eyw8DWZpesJVA2zVfORGk=";
+ vendorHash = "sha256-7axI7R8cTntc1IcOwVPmPj8MHeIvhbnkYKQdqu5fZOU=";
ldflags = [
"-s"
diff --git a/pkgs/applications/networking/cluster/flink/default.nix b/pkgs/applications/networking/cluster/flink/default.nix
index f0547dcf5609..70c70d9ead43 100644
--- a/pkgs/applications/networking/cluster/flink/default.nix
+++ b/pkgs/applications/networking/cluster/flink/default.nix
@@ -22,7 +22,7 @@ stdenv.mkDerivation rec {
--prefix PATH : ${jre}/bin
cat <> $out/opt/flink/conf/flink-conf.yaml
- env.java.home: ${jre}"
+ env.java.home: ${jre}
env.log.dir: /tmp/flink-logs
EOF
'';
diff --git a/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix b/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix
new file mode 100644
index 000000000000..7d5d2918e9b9
--- /dev/null
+++ b/pkgs/applications/networking/cluster/hadoop/containerExecutor.nix
@@ -0,0 +1,37 @@
+{ version, stdenv, fetchurl, lib, cmake, openssl, platformAttrs, ... }:
+
+stdenv.mkDerivation (finalAttrs: {
+ pname = "hadoop-yarn-containerexecutor";
+ inherit version;
+
+ src = fetchurl {
+ url = "mirror://apache/hadoop/common/hadoop-${finalAttrs.version}/hadoop-${finalAttrs.version}-src.tar.gz";
+ hash = platformAttrs.${stdenv.system}.srcHash;
+ };
+ sourceRoot = "hadoop-${finalAttrs.version}-src/hadoop-yarn-project/hadoop-yarn/"
+ +"hadoop-yarn-server/hadoop-yarn-server-nodemanager/src";
+
+ nativeBuildInputs = [ cmake ];
+ buildInputs = [ openssl ];
+ cmakeFlags = [ "-DHADOOP_CONF_DIR=/run/wrappers/yarn-nodemanager/etc/hadoop" ];
+
+ installPhase = ''
+ mkdir $out
+ mv target/var/empty/local/bin $out/
+ '';
+
+ meta = with lib; {
+ homepage = "https://hadoop.apache.org/";
+ description = "Framework for distributed processing of large data sets across clusters of computers";
+ license = licenses.asl20;
+
+ longDescription = ''
+ The Hadoop YARN Container Executor is a native component responsible for managing the lifecycle of containers
+ on individual nodes in a Hadoop YARN cluster. It launches, monitors, and terminates containers, ensuring that
+ resources like CPU and memory are allocated according to the policies defined in the ResourceManager.
+ '';
+
+ maintainers = with maintainers; [ illustris ];
+ platforms = filter (strings.hasSuffix "linux") (attrNames platformAttrs);
+ };
+})
diff --git a/pkgs/applications/networking/cluster/hadoop/default.nix b/pkgs/applications/networking/cluster/hadoop/default.nix
index 65512de2031b..d5bae9ad885b 100644
--- a/pkgs/applications/networking/cluster/hadoop/default.nix
+++ b/pkgs/applications/networking/cluster/hadoop/default.nix
@@ -19,6 +19,8 @@
, nixosTests
, sparkSupport ? true
, spark
+, libtirpc
+, callPackage
}:
with lib;
@@ -26,40 +28,75 @@ with lib;
assert elem stdenv.system [ "x86_64-linux" "x86_64-darwin" "aarch64-linux" "aarch64-darwin" ];
let
- common = { pname, platformAttrs, untarDir ? "${pname}-${version}", jdk, openssl ? null, nativeLibs ? [ ], libPatches ? "", tests }:
- stdenv.mkDerivation rec {
- inherit pname jdk libPatches untarDir openssl;
+ common = { pname, platformAttrs, jdk, tests }:
+ stdenv.mkDerivation (finalAttrs: {
+ inherit pname jdk;
version = platformAttrs.${stdenv.system}.version or (throw "Unsupported system: ${stdenv.system}");
src = fetchurl {
- url = "mirror://apache/hadoop/common/hadoop-${version}/hadoop-${version}" + optionalString stdenv.isAarch64 "-aarch64" + ".tar.gz";
+ url = "mirror://apache/hadoop/common/hadoop-${finalAttrs.version}/hadoop-${finalAttrs.version}"
+ + optionalString stdenv.isAarch64 "-aarch64" + ".tar.gz";
inherit (platformAttrs.${stdenv.system}) hash;
};
doCheck = true;
+ # Build the container executor binary from source
+ # InstallPhase is not lazily evaluating containerExecutor for some reason
+ containerExecutor = if stdenv.isLinux then (callPackage ./containerExecutor.nix {
+ inherit (finalAttrs) version;
+ inherit platformAttrs;
+ }) else "";
+
nativeBuildInputs = [ makeWrapper ]
- ++ optionals (stdenv.isLinux && (nativeLibs != [ ] || libPatches != "")) [ autoPatchelfHook ];
- buildInputs = [ openssl ] ++ nativeLibs;
+ ++ optionals stdenv.isLinux [ autoPatchelfHook ];
+ buildInputs = optionals stdenv.isLinux [ stdenv.cc.cc.lib openssl protobuf zlib snappy libtirpc ];
installPhase = ''
- mkdir -p $out/{lib/${untarDir}/conf,bin,lib}
- mv * $out/lib/${untarDir}
+ mkdir $out
+ mv * $out/
'' + optionalString stdenv.isLinux ''
- # All versions need container-executor, but some versions can't use autoPatchelf because of broken SSL versions
- patchelf --set-interpreter ${glibc.out}/lib64/ld-linux-x86-64.so.2 $out/lib/${untarDir}/bin/container-executor
- '' + ''
- for n in $(find $out/lib/${untarDir}/bin -type f ! -name "*.*"); do
- makeWrapper "$n" "$out/bin/$(basename $n)"\
- --set-default JAVA_HOME ${jdk.home}\
- --set-default HADOOP_HOME $out/lib/${untarDir}\
- --run "test -d /etc/hadoop-conf && export HADOOP_CONF_DIR=\''${HADOOP_CONF_DIR-'/etc/hadoop-conf/'}"\
- --set-default HADOOP_CONF_DIR $out/lib/${untarDir}/etc/hadoop/\
- --prefix PATH : "${makeBinPath [ bash coreutils which]}"\
- --prefix JAVA_LIBRARY_PATH : "${makeLibraryPath buildInputs}"
+ for n in $(find ${finalAttrs.containerExecutor}/bin -type f); do
+ ln -sf "$n" $out/bin
done
- '' + optionalString sparkSupport ''
+
+ # these libraries are loaded at runtime by the JVM
+ ln -s ${getLib cyrus_sasl}/lib/libsasl2.so $out/lib/native/libsasl2.so.2
+ ln -s ${getLib openssl}/lib/libcrypto.so $out/lib/native/
+ ln -s ${getLib zlib}/lib/libz.so.1 $out/lib/native/
+ ln -s ${getLib zstd}/lib/libzstd.so.1 $out/lib/native/
+ ln -s ${getLib bzip2}/lib/libbz2.so.1 $out/lib/native/
+ ln -s ${getLib snappy}/lib/libsnappy.so.1 $out/lib/native/
+
+ # libjvm.so is in different paths for java 8 and 11
+ # libnativetask.so in hadooop 3 and libhdfs.so in hadoop 2 depend on it
+ find $out/lib/native/ -name 'libnativetask.so*' -o -name 'libhdfs.so*' | \
+ xargs -n1 patchelf --add-rpath $(dirname $(find ${finalAttrs.jdk.home} -name libjvm.so | head -n1))
+
+ # NixOS/nixpkgs#193370
+ # This workaround is needed to use protobuf 3.19
+ # hadoop 3.3+ depends on protobuf 3.18, 3.2 depends on 3.8
+ find $out/lib/native -name 'libhdfspp.so*' | \
+ xargs -r -n1 patchelf --replace-needed libprotobuf.so.${
+ if (versionAtLeast finalAttrs.version "3.3") then "18"
+ else "8"
+ } libprotobuf.so
+
+ patchelf --replace-needed libcrypto.so.1.1 libcrypto.so \
+ $out/lib/native/{libhdfs{pp,}.so*,examples/{pipes-sort,wordcount-nopipe,wordcount-part,wordcount-simple}}
+
+ '' + ''
+ for n in $(find $out/bin -type f ! -name "*.*"); do
+ wrapProgram "$n"\
+ --set-default JAVA_HOME ${finalAttrs.jdk.home}\
+ --set-default HADOOP_HOME $out/\
+ --run "test -d /etc/hadoop-conf && export HADOOP_CONF_DIR=\''${HADOOP_CONF_DIR-'/etc/hadoop-conf/'}"\
+ --set-default HADOOP_CONF_DIR $out/etc/hadoop/\
+ --prefix PATH : "${makeBinPath [ bash coreutils which]}"\
+ --prefix JAVA_LIBRARY_PATH : "${makeLibraryPath finalAttrs.buildInputs}"
+ done
+ '' + (optionalString sparkSupport ''
# Add the spark shuffle service jar to YARN
- cp ${spark.src}/yarn/spark-${spark.version}-yarn-shuffle.jar $out/lib/${untarDir}/share/hadoop/yarn/
- '' + libPatches;
+ cp ${spark.src}/yarn/spark-${spark.version}-yarn-shuffle.jar $out/share/hadoop/yarn/
+ '');
passthru = { inherit tests; };
@@ -83,7 +120,7 @@ let
maintainers = with maintainers; [ illustris ];
platforms = attrNames platformAttrs;
} (attrByPath [ stdenv.system "meta" ] {} platformAttrs);
- };
+ });
in
{
# Different version of hadoop support different java runtime versions
@@ -91,48 +128,29 @@ in
hadoop_3_3 = common rec {
pname = "hadoop";
platformAttrs = rec {
- x86_64-linux = {
- version = "3.3.5";
- hash = "sha256-RG4FypL6I6YGF6ixeUbe3kcoGvFQQEFhfLfV9i50JSo=";
- };
- x86_64-darwin = x86_64-linux;
- aarch64-linux = {
- version = "3.3.5";
- hash = "sha256-qcKjbE881isauWBxIv+NY0UFbYit704/Re8Kdl6x1LA=";
- };
- aarch64-darwin = aarch64-linux;
+ x86_64-linux = {
+ version = "3.3.6";
+ hash = "sha256-9RlQWcDUECrap//xf3sqhd+Qa8tuGZSHFjGfmXhkGgQ=";
+ srcHash = "sha256-4OEsVhBNV9CJ+PN4FgCduUCVA9/el5yezSCZ6ko3+bU=";
+ };
+ x86_64-darwin = x86_64-linux;
+ aarch64-linux = x86_64-linux // {
+ hash = "sha256-5Lv2uA72BJEva5v2yncyPe5gKNCNOPNsoHffVt6KXQ0=";
+ };
+ aarch64-darwin = aarch64-linux;
};
- untarDir = "${pname}-${platformAttrs.${stdenv.system}.version}";
jdk = jdk11_headless;
- inherit openssl;
# TODO: Package and add Intel Storage Acceleration Library
- nativeLibs = [ stdenv.cc.cc.lib protobuf zlib snappy ];
- libPatches = ''
- ln -s ${getLib cyrus_sasl}/lib/libsasl2.so $out/lib/${untarDir}/lib/native/libsasl2.so.2
- ln -s ${getLib openssl}/lib/libcrypto.so $out/lib/${untarDir}/lib/native/
- ln -s ${getLib zlib}/lib/libz.so.1 $out/lib/${untarDir}/lib/native/
- ln -s ${getLib zstd}/lib/libzstd.so.1 $out/lib/${untarDir}/lib/native/
- ln -s ${getLib bzip2}/lib/libbz2.so.1 $out/lib/${untarDir}/lib/native/
- '' + optionalString stdenv.isLinux ''
- # libjvm.so for Java >=11
- patchelf --add-rpath ${jdk.home}/lib/server $out/lib/${untarDir}/lib/native/libnativetask.so.1.0.0
- # Java 8 has libjvm.so at a different path
- patchelf --add-rpath ${jdk.home}/jre/lib/amd64/server $out/lib/${untarDir}/lib/native/libnativetask.so.1.0.0
- # NixOS/nixpkgs#193370
- # This workaround is needed to use protobuf 3.19
- patchelf --replace-needed libprotobuf.so.18 libprotobuf.so $out/lib/${untarDir}/lib/native/libhdfspp.so
- '';
tests = nixosTests.hadoop;
};
- hadoop_3_2 = common rec {
+ hadoop_3_2 = common {
pname = "hadoop";
platformAttrs.x86_64-linux = {
version = "3.2.4";
hash = "sha256-qt2gpMr+NHuiVR+/zFRzRyRKG725/ZNBIM69z9J9wNw=";
+ srcHash = "sha256-F9nGD3mZZ1eJf3Ec3AJGE9YBcL/HiagskcdKQhCn/sw=";
};
jdk = jdk8_headless;
- # not using native libs because of broken openssl_1_0_2 dependency
- # can be manually overridden
tests = nixosTests.hadoop_3_2;
};
hadoop2 = common rec {
@@ -140,6 +158,7 @@ in
platformAttrs.x86_64-linux = {
version = "2.10.2";
hash = "sha256-xhA4zxqIRGNhIeBnJO9dLKf/gx/Bq+uIyyZwsIafEyo=";
+ srcHash = "sha256-ucxCyXiJo8aL6aNMhZgKEbn8sGKOoMPVREbMGSfSdAI=";
};
jdk = jdk8_headless;
tests = nixosTests.hadoop2;
diff --git a/pkgs/applications/networking/cluster/terraform-providers/providers.json b/pkgs/applications/networking/cluster/terraform-providers/providers.json
index 32f29dea87ca..efd18b33da1e 100644
--- a/pkgs/applications/networking/cluster/terraform-providers/providers.json
+++ b/pkgs/applications/networking/cluster/terraform-providers/providers.json
@@ -953,11 +953,11 @@
"vendorHash": null
},
"project": {
- "hash": "sha256-D+UBv6JEbJKGfwTJU7/W5N6otOLW2lq6+euUKpoJ+To=",
+ "hash": "sha256-UO9GBBoOzA1stMq8naXWtxomme6CVdlngVCLQlbZDv0=",
"homepage": "https://registry.terraform.io/providers/jfrog/project",
"owner": "jfrog",
"repo": "terraform-provider-project",
- "rev": "v1.3.2",
+ "rev": "v1.3.3",
"spdx": "Apache-2.0",
"vendorHash": "sha256-Tj+NefCIacwpPS9rNPPxV2lLeKsXJMZhf9Xo+Rzz6gI="
},
@@ -1279,11 +1279,11 @@
"vendorHash": "sha256-4ulRYzb4bzk0TztT04CwqlnMGw8tp7YnoCm2/NqGN7Y="
},
"vultr": {
- "hash": "sha256-65QWogqHR5RYUXBYjM50PNQSuVWYGtqtULTGNy1ivag=",
+ "hash": "sha256-8pj+udTNTjT/tXggOaIOThRQkYoI3v68rEssSUojM2A=",
"homepage": "https://registry.terraform.io/providers/vultr/vultr",
"owner": "vultr",
"repo": "terraform-provider-vultr",
- "rev": "v2.16.3",
+ "rev": "v2.16.4",
"spdx": "MPL-2.0",
"vendorHash": null
},
diff --git a/pkgs/applications/networking/cluster/terragrunt/default.nix b/pkgs/applications/networking/cluster/terragrunt/default.nix
index 1e6c86915acd..65cddcbc34d4 100644
--- a/pkgs/applications/networking/cluster/terragrunt/default.nix
+++ b/pkgs/applications/networking/cluster/terragrunt/default.nix
@@ -5,16 +5,16 @@
buildGoModule rec {
pname = "terragrunt";
- version = "0.52.1";
+ version = "0.52.3";
src = fetchFromGitHub {
owner = "gruntwork-io";
repo = pname;
rev = "refs/tags/v${version}";
- hash = "sha256-t1GAcOZAYdfrI0lsyKUEBbnJaGzuFP0+Mz3Yrv4Bmik=";
+ hash = "sha256-o/4L7TBdFFHuPOKAO/wP0IBixQtZHGr1GSNlsEpq710=";
};
- vendorHash = "sha256-NSrZVLQ3Qbnp94qCV7NbrEav/7LCRbTov+B2vzbuvdM=";
+ vendorHash = "sha256-RmzSKt5qt9Qb4GDrfs4dJEhGQW/jFbXPn+AOLzEyo6c=";
doCheck = false;
diff --git a/pkgs/applications/networking/gopher/sacc/default.nix b/pkgs/applications/networking/gopher/sacc/default.nix
index 994423870398..686f671e13a5 100644
--- a/pkgs/applications/networking/gopher/sacc/default.nix
+++ b/pkgs/applications/networking/gopher/sacc/default.nix
@@ -4,11 +4,11 @@
stdenv.mkDerivation rec {
pname = "sacc";
- version = "1.06";
+ version = "1.07";
src = fetchurl {
url = "ftp://bitreich.org/releases/sacc/sacc-${version}.tar.gz";
- hash = "sha512-eoleQy4dKLfZsrsqUybKMjUIdqLIDTncbBnnU0fXKkhH8apP8R8H6Kmt6hTqcbhNcIkNzBcP9s4Ld54dZYa0+g==";
+ hash = "sha256-LdEeZH+JWb7iEEzikAXaxG0N5GMPxjgTId4THLgdU2w=";
};
inherit patches;
diff --git a/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix b/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix
index 7ae6a8a11abe..d6118db16f3c 100644
--- a/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix
+++ b/pkgs/applications/networking/instant-messengers/signal-desktop/default.nix
@@ -1,12 +1,12 @@
{ callPackage }: builtins.mapAttrs (pname: attrs: callPackage ./generic.nix (attrs // { inherit pname; })) {
signal-desktop = {
dir = "Signal";
- version = "6.32.0";
- hash = "sha256-FZ2wG3nkgIndeoUfXag/9jftXGDSY/MNpT8mqSZpJzA=";
+ version = "6.34.1";
+ hash = "sha256-1kffRXPQmtxIsLZVOgPXDnxUmY59q+1umy25cditRhw=";
};
signal-desktop-beta = {
dir = "Signal Beta";
- version = "6.33.0-beta.1";
- hash = "sha256-FLCZvRYUysiE8BLMJVnn0hOkA3km0z383AjN6JvOyWI=";
+ version = "6.35.0-beta.2";
+ hash = "sha256-TgzqKGt3ojkjq+mIu0EtqXfnnZ/xulWjiuS5/0dlwIM=";
};
}
diff --git a/pkgs/applications/networking/p2p/tremotesf/default.nix b/pkgs/applications/networking/p2p/tremotesf/default.nix
index 6880d8472167..4cd7358d2b77 100644
--- a/pkgs/applications/networking/p2p/tremotesf/default.nix
+++ b/pkgs/applications/networking/p2p/tremotesf/default.nix
@@ -15,13 +15,13 @@
stdenv.mkDerivation (finalAttrs: {
pname = "tremotesf";
- version = "2.4.0";
+ version = "2.5.0";
src = fetchFromGitHub {
owner = "equeim";
repo = "tremotesf2";
rev = finalAttrs.version;
- hash = "sha256-TKtBgMpCWIUl1bohAKCbTcZX2uaPmzeWut/OeNs/rME=";
+ hash = "sha256-mxk2BRUuet3XSNaKt2Dnnxe5dliazd1ArRSnKyoAp1s=";
# We need this for src/libtremotesf
fetchSubmodules = true;
};
diff --git a/pkgs/applications/networking/sync/rclone/default.nix b/pkgs/applications/networking/sync/rclone/default.nix
index 2e6dd8fa7fde..cad0829b9c2b 100644
--- a/pkgs/applications/networking/sync/rclone/default.nix
+++ b/pkgs/applications/networking/sync/rclone/default.nix
@@ -41,6 +41,10 @@ buildGoModule rec {
${rcloneBin}/bin/rclone genautocomplete $shell rclone.$shell
installShellCompletion rclone.$shell
done
+
+ # filesystem helpers
+ ln -s $out/bin/rclone $out/bin/rclonefs
+ ln -s $out/bin/rclone $out/bin/mount.rclone
'' + lib.optionalString (enableCmount && !stdenv.isDarwin)
# use --suffix here to ensure we don't shadow /run/wrappers/bin/fusermount,
# as the setuid wrapper is required as non-root on NixOS.
diff --git a/pkgs/applications/science/biology/bowtie2/default.nix b/pkgs/applications/science/biology/bowtie2/default.nix
index e5c9c2864225..356e90555f8d 100644
--- a/pkgs/applications/science/biology/bowtie2/default.nix
+++ b/pkgs/applications/science/biology/bowtie2/default.nix
@@ -1,26 +1,62 @@
-{ lib, stdenv, fetchFromGitHub, cmake, tbb, zlib, python3, perl }:
+{ lib
+, stdenv
+, fetchFromGitHub
+, cmake
+, perl
+, python3
+, tbb
+, zlib
+, runCommand
+, bowtie2
+}:
-stdenv.mkDerivation rec {
+stdenv.mkDerivation (finalAttrs: {
pname = "bowtie2";
version = "2.5.2";
src = fetchFromGitHub {
owner = "BenLangmead";
- repo = pname;
- rev = "v${version}";
- sha256 = "sha256-Bem4SHY/74suZPDbw/rwKMLBn3bRq5ooHbBoVnKuYk0=";
+ repo = "bowtie2";
+ rev = "refs/tags/v${finalAttrs.version}";
+ fetchSubmodules = true;
+ hash = "sha256-rWeopeYuCk9ZhJX2SFCcxZWcjXjjTiVRiwkzLQcIgd0=";
};
+ # because of this flag, gcc on aarch64 cannot find the Threads
+ # Could NOT find Threads (missing: Threads_FOUND)
+ # TODO: check with other distros and report upstream
+ postPatch = ''
+ substituteInPlace CMakeLists.txt \
+ --replace "-m64" ""
+ '';
+
nativeBuildInputs = [ cmake ];
buildInputs = [ tbb zlib python3 perl ];
+ cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"];
+
+ # ctest fails because of missing dependencies between tests
+ doCheck = false;
+
+ passthru.tests = {
+ ctest = runCommand "${finalAttrs.pname}-test" { } ''
+ mkdir $out
+ ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10
+ ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small
+ ${bowtie2}/bin/bowtie2-inspect-s $out/small
+ ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large
+ ${bowtie2}/bin/bowtie2-inspect-l $out/large
+ '';
+ };
+
meta = with lib; {
description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";
- license = licenses.gpl3;
+ license = licenses.gpl3Plus;
homepage = "http://bowtie-bio.sf.net/bowtie2";
+ changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}";
maintainers = with maintainers; [ rybern ];
platforms = platforms.all;
- broken = stdenv.isAarch64; # only x86 is supported
+ mainProgram = "bowtie2";
};
-}
+})
diff --git a/pkgs/applications/video/kodi/addons/netflix/default.nix b/pkgs/applications/video/kodi/addons/netflix/default.nix
index 5a3089d1936d..3352ae4c63d3 100644
--- a/pkgs/applications/video/kodi/addons/netflix/default.nix
+++ b/pkgs/applications/video/kodi/addons/netflix/default.nix
@@ -24,6 +24,6 @@ buildKodiAddon rec {
homepage = "https://github.com/CastagnaIT/plugin.video.netflix";
description = "Netflix VOD Services Add-on";
license = licenses.mit;
- maintainers = teams.kodi.members;
+ maintainers = teams.kodi.members ++ [ maintainers.pks ];
};
}
diff --git a/pkgs/applications/video/kodi/addons/youtube/default.nix b/pkgs/applications/video/kodi/addons/youtube/default.nix
index bdc4be3a23fa..3d3683ed8776 100644
--- a/pkgs/applications/video/kodi/addons/youtube/default.nix
+++ b/pkgs/applications/video/kodi/addons/youtube/default.nix
@@ -1,13 +1,15 @@
-{ lib, buildKodiAddon, fetchzip, addonUpdateScript, six, requests, infotagger, inputstreamhelper }:
+{ lib, buildKodiAddon, fetchFromGitHub, six, requests, infotagger, inputstreamhelper }:
buildKodiAddon rec {
pname = "youtube";
namespace = "plugin.video.youtube";
- version = "7.0.1";
+ version = "7.0.2.2";
- src = fetchzip {
- url = "https://mirrors.kodi.tv/addons/nexus/${namespace}/${namespace}-${version}.zip";
- sha256 = "sha256-Wdju7d2kFX0V1J1TB75qEVq0UWN2xYYFNlD8UTt1New=";
+ src = fetchFromGitHub {
+ owner = "anxdpanic";
+ repo = "plugin.video.youtube";
+ rev = "v${version}";
+ hash = "sha256-BUeE/8oQYBiq4XgIp4nv0hjEQz3nnkDWCnAf4kpptwk=";
};
propagatedBuildInputs = [
@@ -19,9 +21,6 @@ buildKodiAddon rec {
passthru = {
pythonPath = "resources/lib";
- updateScript = addonUpdateScript {
- attrPath = "kodi.packages.youtube";
- };
};
meta = with lib; {
diff --git a/pkgs/build-support/dart/build-dart-application/default.nix b/pkgs/build-support/dart/build-dart-application/default.nix
index be1fd7277671..76328e5645f6 100644
--- a/pkgs/build-support/dart/build-dart-application/default.nix
+++ b/pkgs/build-support/dart/build-dart-application/default.nix
@@ -1,6 +1,7 @@
-{ lib, stdenv, fetchDartDeps, runCommand, writeText, dartHooks, makeWrapper, dart, cacert, nodejs, darwin }:
+{ lib, stdenv, callPackage, fetchDartDeps, runCommand, writeText, dartHooks, makeWrapper, dart, cacert, nodejs, darwin, jq }:
-{ pubGetScript ? "dart pub get"
+{ sdkSetupScript ? ""
+, pubGetScript ? "dart pub get"
# Output type to produce. Can be any kind supported by dart
# https://dart.dev/tools/dart-compile#types-of-output
@@ -18,12 +19,16 @@
, dartEntryPoints ? null
# Used when wrapping aot, jit, kernel, and js builds.
# Set to null to disable wrapping.
-, dartRuntimeCommand ?
- if dartOutputType == "aot-snapshot" then "${dart}/bin/dartaotruntime"
- else if (dartOutputType == "jit-snapshot" || dartOutputType == "kernel") then "${dart}/bin/dart"
- else if dartOutputType == "js" then "${nodejs}/bin/node"
- else null
+, dartRuntimeCommand ? if dartOutputType == "aot-snapshot" then "${dart}/bin/dartaotruntime"
+ else if (dartOutputType == "jit-snapshot" || dartOutputType == "kernel") then "${dart}/bin/dart"
+ else if dartOutputType == "js" then "${nodejs}/bin/node"
+ else null
+, runtimeDependencies ? [ ]
+, extraWrapProgramArgs ? ""
+, customPackageOverrides ? { }
+, autoDepsList ? false
+, depsListFile ? null
, pubspecLockFile ? null
, vendorHash ? ""
, ...
@@ -38,37 +43,81 @@ let
'';
}) {
buildDrvArgs = args;
- inherit pubGetScript vendorHash pubspecLockFile;
+ inherit sdkSetupScript pubGetScript vendorHash pubspecLockFile;
};
- inherit (dartHooks.override { inherit dart; }) dartConfigHook dartBuildHook dartInstallHook;
-in
-assert !(builtins.isString dartOutputType && dartOutputType != "") ->
- throw "dartOutputType must be a non-empty string";
-stdenv.mkDerivation (args // {
- inherit pubGetScript dartCompileCommand dartOutputType dartRuntimeCommand
- dartCompileFlags dartJitFlags;
+ inherit (dartHooks.override { inherit dart; }) dartConfigHook dartBuildHook dartInstallHook dartFixupHook;
+
+ baseDerivation = stdenv.mkDerivation (finalAttrs: args // {
+ inherit sdkSetupScript pubGetScript dartCompileCommand dartOutputType
+ dartRuntimeCommand dartCompileFlags dartJitFlags runtimeDependencies;
dartEntryPoints =
if (dartEntryPoints != null)
then writeText "entrypoints.json" (builtins.toJSON dartEntryPoints)
else null;
- nativeBuildInputs = (args.nativeBuildInputs or [ ]) ++ [
- dart
- dartDeps
- dartConfigHook
- dartBuildHook
- dartInstallHook
- makeWrapper
- ] ++ lib.optionals stdenv.isDarwin [
- darwin.sigtool
- ];
+ runtimeDependencyLibraryPath = lib.makeLibraryPath finalAttrs.runtimeDependencies;
- # When stripping, it seems some ELF information is lost and the dart VM cli
- # runs instead of the expected program. Don't strip if it's an exe output.
- dontStrip = args.dontStrip or (dartOutputType == "exe");
+ nativeBuildInputs = (args.nativeBuildInputs or [ ]) ++ [
+ dart
+ dartDeps
+ dartConfigHook
+ dartBuildHook
+ dartInstallHook
+ dartFixupHook
+ makeWrapper
+ jq
+ ] ++ lib.optionals stdenv.isDarwin [
+ darwin.sigtool
+ ];
- passthru = { inherit dartDeps; } // (args.passthru or { });
+ preUnpack = ''
+ ${lib.optionalString (!autoDepsList) ''
+ if ! { [ '${lib.boolToString (depsListFile != null)}' = 'true' ] ${lib.optionalString (depsListFile != null) "&& cmp -s <(jq -Sc . '${depsListFile}') <(jq -Sc . '${finalAttrs.passthru.dartDeps.depsListFile}')"}; }; then
+ echo 1>&2 -e '\nThe dependency list file was either not given or differs from the expected result.' \
+ '\nPlease choose one of the following solutions:' \
+ '\n - Duplicate the following file and pass it to the depsListFile argument.' \
+ '\n ${finalAttrs.passthru.dartDeps.depsListFile}' \
+ '\n - Set autoDepsList to true (not supported by Hydra or permitted in Nixpkgs)'.
+ exit 1
+ fi
+ ''}
+ ${args.preUnpack or ""}
+ '';
- meta = (args.meta or { }) // { platforms = args.meta.platforms or dart.meta.platforms; };
-})
+ # When stripping, it seems some ELF information is lost and the dart VM cli
+ # runs instead of the expected program. Don't strip if it's an exe output.
+ dontStrip = args.dontStrip or (dartOutputType == "exe");
+
+ passthru = { inherit dartDeps; } // (args.passthru or { });
+
+ meta = (args.meta or { }) // { platforms = args.meta.platforms or dart.meta.platforms; };
+ });
+
+ packageOverrideRepository = (callPackage ../../../development/compilers/dart/package-overrides { }) // customPackageOverrides;
+ productPackages = builtins.filter (package: package.kind != "dev")
+ (if autoDepsList
+ then lib.importJSON dartDeps.depsListFile
+ else
+ if depsListFile == null
+ then [ ]
+ else lib.importJSON depsListFile);
+in
+assert !(builtins.isString dartOutputType && dartOutputType != "") ->
+throw "dartOutputType must be a non-empty string";
+builtins.foldl'
+ (prev: package:
+ if packageOverrideRepository ? ${package.name}
+ then
+ prev.overrideAttrs
+ (packageOverrideRepository.${package.name} {
+ inherit (package)
+ name
+ version
+ kind
+ source
+ dependencies;
+ })
+ else prev)
+ baseDerivation
+ productPackages
diff --git a/pkgs/build-support/dart/build-dart-application/hooks/dart-config-hook.sh b/pkgs/build-support/dart/build-dart-application/hooks/dart-config-hook.sh
index 3e901995237d..f22d7d2ce64d 100644
--- a/pkgs/build-support/dart/build-dart-application/hooks/dart-config-hook.sh
+++ b/pkgs/build-support/dart/build-dart-application/hooks/dart-config-hook.sh
@@ -3,6 +3,9 @@
dartConfigHook() {
echo "Executing dartConfigHook"
+ echo "Setting up SDK"
+ eval "$sdkSetupScript"
+
echo "Installing dependencies"
eval doPubGet "$pubGetScript" --offline
diff --git a/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh b/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh
new file mode 100644
index 000000000000..c5a9bedd0665
--- /dev/null
+++ b/pkgs/build-support/dart/build-dart-application/hooks/dart-fixup-hook.sh
@@ -0,0 +1,32 @@
+# shellcheck shell=bash
+
+dartFixupHook() {
+ echo "Executing dartFixupHook"
+
+ declare -a wrapProgramArgs
+
+ # Add runtime library dependencies to the LD_LIBRARY_PATH.
+ # For some reason, the RUNPATH of the executable is not used to load dynamic libraries in dart:ffi with DynamicLibrary.open().
+ #
+ # This could alternatively be fixed with patchelf --add-needed, but this would cause all the libraries to be opened immediately,
+ # which is not what application authors expect.
+ echo "$runtimeDependencyLibraryPath"
+ if [[ ! -z "$runtimeDependencyLibraryPath" ]]; then
+ wrapProgramArgs+=(--suffix LD_LIBRARY_PATH : \"$runtimeDependencyLibraryPath\")
+ fi
+
+ if [[ ! -z "$extraWrapProgramArgs" ]]; then
+ wrapProgramArgs+=("$extraWrapProgramArgs")
+ fi
+
+ if [ ${#wrapProgramArgs[@]} -ne 0 ]; then
+ for f in "$out"/bin/*; do
+ echo "Wrapping $f..."
+ eval "wrapProgram \"$f\" ${wrapProgramArgs[@]}"
+ done
+ fi
+
+ echo "Finished dartFixupHook"
+}
+
+postFixupHooks+=(dartFixupHook)
diff --git a/pkgs/build-support/dart/build-dart-application/hooks/default.nix b/pkgs/build-support/dart/build-dart-application/hooks/default.nix
index 463061c54a8d..134989426d96 100644
--- a/pkgs/build-support/dart/build-dart-application/hooks/default.nix
+++ b/pkgs/build-support/dart/build-dart-application/hooks/default.nix
@@ -12,4 +12,7 @@
dartInstallHook = makeSetupHook {
name = "dart-install-hook";
} ./dart-install-hook.sh;
+ dartFixupHook = makeSetupHook {
+ name = "dart-fixup-hook";
+ } ./dart-fixup-hook.sh;
}
diff --git a/pkgs/build-support/dart/fetch-dart-deps/default.nix b/pkgs/build-support/dart/fetch-dart-deps/default.nix
index e523b60797eb..51052cae18f4 100644
--- a/pkgs/build-support/dart/fetch-dart-deps/default.nix
+++ b/pkgs/build-support/dart/fetch-dart-deps/default.nix
@@ -169,6 +169,8 @@ let
dart pub deps --json | jq .packages > $out
runHook postBuild
'';
+
+ dontInstall = true;
} // (removeAttrs buildDrvInheritArgs [ "name" "pname" ]));
# As of Dart 3.0.0, Pub checks the revision of cached Git-sourced packages.
diff --git a/pkgs/build-support/flutter/default.nix b/pkgs/build-support/flutter/default.nix
index a0ed1211ed81..3e136211655b 100644
--- a/pkgs/build-support/flutter/default.nix
+++ b/pkgs/build-support/flutter/default.nix
@@ -1,34 +1,28 @@
{ lib
, callPackage
-, stdenvNoCC
, runCommand
, makeWrapper
, wrapGAppsHook
-, llvmPackages_13
+, fetchDartDeps
+, buildDartApplication
, cacert
, glib
, flutter
-, jq
}:
# absolutely no mac support for now
{ pubGetScript ? "flutter pub get"
, flutterBuildFlags ? [ ]
-, runtimeDependencies ? [ ]
-, customPackageOverrides ? { }
-, autoDepsList ? false
-, depsListFile ? null
-, vendorHash ? ""
-, pubspecLockFile ? null
-, nativeBuildInputs ? [ ]
-, preUnpack ? ""
-, postFixup ? ""
, extraWrapProgramArgs ? ""
, ...
}@args:
-let
- flutterSetupScript = ''
+
+(buildDartApplication.override {
+ dart = flutter;
+ fetchDartDeps = fetchDartDeps.override { dart = flutter; };
+}) (args // {
+ sdkSetupScript = ''
# Pub needs SSL certificates. Dart normally looks in a hardcoded path.
# https://github.com/dart-lang/sdk/blob/3.1.0/runtime/bin/security_context_linux.cc#L48
#
@@ -54,136 +48,56 @@ let
flutter config --enable-linux-desktop >/dev/null
'';
- deps = callPackage ../dart/fetch-dart-deps { dart = flutter; } {
- sdkSetupScript = flutterSetupScript;
- inherit pubGetScript vendorHash pubspecLockFile;
- buildDrvArgs = args;
- };
+ nativeBuildInputs = (args.nativeBuildInputs or [ ]) ++ [ wrapGAppsHook ];
+ buildInputs = (args.buildInputs or [ ]) ++ [ glib ];
- baseDerivation = llvmPackages_13.stdenv.mkDerivation (finalAttrs: args // {
- inherit flutterBuildFlags runtimeDependencies;
+ dontDartBuild = true;
+ buildPhase = args.buildPhase or ''
+ runHook preBuild
- outputs = [ "out" "debug" ];
+ mkdir -p build/flutter_assets/fonts
- nativeBuildInputs = [
- makeWrapper
- deps
- flutter
- jq
- glib
- wrapGAppsHook
- ] ++ nativeBuildInputs;
+ doPubGet flutter pub get --offline -v
+ flutter build linux -v --release --split-debug-info="$debug" ${builtins.concatStringsSep " " (map (flag: "\"${flag}\"") flutterBuildFlags)}
- dontWrapGApps = true;
+ runHook postBuild
+ '';
- preUnpack = ''
- ${lib.optionalString (!autoDepsList) ''
- if ! { [ '${lib.boolToString (depsListFile != null)}' = 'true' ] ${lib.optionalString (depsListFile != null) "&& cmp -s <(jq -Sc . '${depsListFile}') <(jq -Sc . '${finalAttrs.passthru.depsListFile}')"}; }; then
- echo 1>&2 -e '\nThe dependency list file was either not given or differs from the expected result.' \
- '\nPlease choose one of the following solutions:' \
- '\n - Duplicate the following file and pass it to the depsListFile argument.' \
- '\n ${finalAttrs.passthru.depsListFile}' \
- '\n - Set autoDepsList to true (not supported by Hydra or permitted in Nixpkgs)'.
- exit 1
- fi
- ''}
+ dontDartInstall = true;
+ installPhase = args.installPhase or ''
+ runHook preInstall
- ${preUnpack}
- '';
+ built=build/linux/*/release/bundle
- configurePhase = ''
- runHook preConfigure
+ mkdir -p $out/bin
+ mv $built $out/app
- ${flutterSetupScript}
+ for f in $(find $out/app -iname "*.desktop" -type f); do
+ install -D $f $out/share/applications/$(basename $f)
+ done
- runHook postConfigure
- '';
+ for f in $(find $out/app -maxdepth 1 -type f); do
+ ln -s $f $out/bin/$(basename $f)
+ done
- buildPhase = ''
- runHook preBuild
+ # make *.so executable
+ find $out/app -iname "*.so" -type f -exec chmod +x {} +
- mkdir -p build/flutter_assets/fonts
+ # remove stuff like /build/source/packages/ubuntu_desktop_installer/linux/flutter/ephemeral
+ for f in $(find $out/app -executable -type f); do
+ if patchelf --print-rpath "$f" | grep /build; then # this ignores static libs (e,g. libapp.so) also
+ echo "strip RPath of $f"
+ newrp=$(patchelf --print-rpath $f | sed -r "s|/build.*ephemeral:||g" | sed -r "s|/build.*profile:||g")
+ patchelf --set-rpath "$newrp" "$f"
+ fi
+ done
- doPubGet flutter pub get --offline -v
- flutter build linux -v --release --split-debug-info="$debug" ${builtins.concatStringsSep " " (map (flag: "\"${flag}\"") finalAttrs.flutterBuildFlags)}
+ runHook postInstall
+ '';
- runHook postBuild
- '';
-
- installPhase = ''
- runHook preInstall
-
- built=build/linux/*/release/bundle
-
- mkdir -p $out/bin
- mv $built $out/app
-
- for f in $(find $out/app -iname "*.desktop" -type f); do
- install -D $f $out/share/applications/$(basename $f)
- done
-
- for f in $(find $out/app -maxdepth 1 -type f); do
- ln -s $f $out/bin/$(basename $f)
- done
-
- # make *.so executable
- find $out/app -iname "*.so" -type f -exec chmod +x {} +
-
- # remove stuff like /build/source/packages/ubuntu_desktop_installer/linux/flutter/ephemeral
- for f in $(find $out/app -executable -type f); do
- if patchelf --print-rpath "$f" | grep /build; then # this ignores static libs (e,g. libapp.so) also
- echo "strip RPath of $f"
- newrp=$(patchelf --print-rpath $f | sed -r "s|/build.*ephemeral:||g" | sed -r "s|/build.*profile:||g")
- patchelf --set-rpath "$newrp" "$f"
- fi
- done
-
- runHook postInstall
- '';
-
- postFixup = ''
- # Add runtime library dependencies to the LD_LIBRARY_PATH.
- # For some reason, the RUNPATH of the executable is not used to load dynamic libraries in dart:ffi with DynamicLibrary.open().
- #
- # This could alternatively be fixed with patchelf --add-needed, but this would cause all the libraries to be opened immediately,
- # which is not what application authors expect.
- for f in "$out"/bin/*; do
- wrapProgram "$f" \
- --suffix LD_LIBRARY_PATH : '${lib.makeLibraryPath finalAttrs.runtimeDependencies}' \
- ''${gappsWrapperArgs[@]} \
- ${extraWrapProgramArgs}
- done
-
- ${postFixup}
- '';
-
- passthru = (args.passthru or {}) // {
- inherit (deps) depsListFile;
- };
- });
-
- packageOverrideRepository = (callPackage ../../development/compilers/flutter/package-overrides { }) // customPackageOverrides;
- productPackages = builtins.filter (package: package.kind != "dev")
- (if autoDepsList
- then lib.importJSON deps.depsListFile
- else
- if depsListFile == null
- then [ ]
- else lib.importJSON depsListFile);
-in
-builtins.foldl'
- (prev: package:
- if packageOverrideRepository ? ${package.name}
- then
- prev.overrideAttrs
- (packageOverrideRepository.${package.name} {
- inherit (package)
- name
- version
- kind
- source
- dependencies;
- })
- else prev)
- baseDerivation
- productPackages
+ dontWrapGApps = true;
+ extraWrapProgramArgs = ''
+ ''${gappsWrapperArgs[@]} \
+ ${extraWrapProgramArgs}
+ '';
+})
diff --git a/pkgs/build-support/kernel/make-initrd-ng/src/main.rs b/pkgs/build-support/kernel/make-initrd-ng/src/main.rs
index 53096a842329..daa688976c6c 100644
--- a/pkgs/build-support/kernel/make-initrd-ng/src/main.rs
+++ b/pkgs/build-support/kernel/make-initrd-ng/src/main.rs
@@ -195,7 +195,7 @@ fn handle_path(
.wrap_err_with(|| format!("failed to resolve symlink of {:?}", source))?;
// Create the link, then push its target to the queue
- if !target.exists() {
+ if !target.exists() && !target.is_symlink() {
unix::fs::symlink(&link_target, &target).wrap_err_with(|| {
format!("failed to symlink {:?} to {:?}", link_target, target)
})?;
diff --git a/pkgs/by-name/al/alpine-make-rootfs/package.nix b/pkgs/by-name/al/alpine-make-rootfs/package.nix
new file mode 100644
index 000000000000..1fcfc23710a5
--- /dev/null
+++ b/pkgs/by-name/al/alpine-make-rootfs/package.nix
@@ -0,0 +1,33 @@
+{ stdenvNoCC, lib, fetchFromGitHub, makeWrapper, apk-tools, coreutils, findutils, gnugrep, gnused, gnutar, gzip, rsync, util-linux, wget
+}:
+stdenvNoCC.mkDerivation rec {
+ pname = "alpine-make-rootfs";
+ version = "0.7.0";
+
+ src = fetchFromGitHub {
+ owner = "alpinelinux";
+ repo = "alpine-make-rootfs";
+ rev = "v${version}";
+ hash = "sha256-B5qYQ6ah4hFZfb3S5vwgevh7aEHI3YGLoA+IyipaDck=";
+ };
+
+ nativeBuildInputs = [ makeWrapper ];
+
+ dontBuild = true;
+ makeFlags = [ "PREFIX=$(out)" ];
+
+ postInstall = ''
+ wrapProgram $out/bin/alpine-make-rootfs --set PATH ${lib.makeBinPath [
+ apk-tools coreutils findutils gnugrep gnused gnutar gzip rsync util-linux wget
+ ]}
+ '';
+
+ meta = with lib; {
+ homepage = "https://github.com/alpinelinux/alpine-make-rootfs";
+ description = "Make customized Alpine Linux rootfs (base image) for containers";
+ mainProgram = "alpine-make-rootfs";
+ maintainers = with maintainers; [ danielsidhion ];
+ license = licenses.mit;
+ platforms = platforms.linux;
+ };
+}
diff --git a/pkgs/development/libraries/argagg/default.nix b/pkgs/by-name/ar/argagg/package.nix
similarity index 73%
rename from pkgs/development/libraries/argagg/default.nix
rename to pkgs/by-name/ar/argagg/package.nix
index 7ff9eaac1e3e..bb8507abbe97 100644
--- a/pkgs/development/libraries/argagg/default.nix
+++ b/pkgs/by-name/ar/argagg/package.nix
@@ -4,27 +4,22 @@
, cmake
}:
-stdenv.mkDerivation rec {
+stdenv.mkDerivation (finalAttrs: {
pname = "argagg";
- version = "0.4.6";
+ version = "0.4.7";
src = fetchFromGitHub {
owner = "vietjtnguyen";
- repo = pname;
- rev = version;
- hash = "sha256-MCtlAPfwdJpgfS8IH+zlcgaaxZ5AsP4hJvbZAFtOa4o=";
+ repo = "argagg";
+ rev = finalAttrs.version;
+ hash = "sha256-G0PzoKpUyb1MaziLvHgasq98jPODUu4EgPzywRjuIN8=";
};
- patches = [
- # Fix compilation of macro catch statement
- ./0001-catch.diff
- ];
-
nativeBuildInputs = [
cmake
];
- meta = with lib; {
+ meta = {
homepage = "https://github.com/vietjtnguyen/argagg";
description = "Argument Aggregator";
longDescription = ''
@@ -38,9 +33,9 @@ stdenv.mkDerivation rec {
types until you access them, so the result structures end up just being
pointers into the original command line argument C-strings.
'';
- license = licenses.mit;
- maintainers = with maintainers; [ AndersonTorres ];
- platforms = with platforms; all;
+ license = lib.licenses.mit;
+ maintainers = with lib.maintainers; [ AndersonTorres ];
+ platforms = lib.platforms.all;
badPlatforms = [ "aarch64-darwin" ];
};
-}
+})
diff --git a/pkgs/development/libraries/argtable/default.nix b/pkgs/by-name/ar/argtable/package.nix
similarity index 71%
rename from pkgs/development/libraries/argtable/default.nix
rename to pkgs/by-name/ar/argtable/package.nix
index 9752b9600397..18206202691c 100644
--- a/pkgs/development/libraries/argtable/default.nix
+++ b/pkgs/by-name/ar/argtable/package.nix
@@ -4,29 +4,29 @@
, cmake
}:
-stdenv.mkDerivation rec {
+stdenv.mkDerivation (finalAttrs: {
pname = "argtable";
- version = "3.2.1";
- srcVersion = "v${version}.52f24e5";
+ version = "3.2.2";
+ srcVersion = "v${finalAttrs.version}.f25c624";
src = fetchFromGitHub {
owner = "argtable";
repo = "argtable3";
- rev = srcVersion;
- hash = "sha256-HFsk91uJXQ0wpvAQxP4/yZwRQx9kLH7KgB3Y/+zcZC0=";
+ rev = finalAttrs.srcVersion;
+ hash = "sha256-X89xFLDs6NEgjzzwy8kplvTgukQd/CV3Xa9A3JXecf4=";
};
nativeBuildInputs = [ cmake ];
cmakeFlags = [
- "-DBUILD_SHARED_LIBS=ON"
+ (lib.cmakeBool "BUILD_SHARED_LIBS" true)
];
postPatch = ''
patchShebangs tools/build
'';
- meta = with lib; {
+ meta = {
homepage = "https://github.com/argtable/argtable3";
description = "A single-file, ANSI C command-line parsing library";
longDescription = ''
@@ -37,11 +37,11 @@ stdenv.mkDerivation rec {
handling logic and textual descriptions of the command line syntax, which
are essential but tedious to implement for a robust CLI program.
'';
- license = with licenses; bsd3;
- maintainers = with maintainers; [ AndersonTorres artuuge ];
- platforms = with platforms; all;
+ license = lib.licenses.bsd3;
+ maintainers = with lib.maintainers; [ AndersonTorres artuuge ];
+ platforms = lib.platforms.all;
};
-}
+})
# TODO: a NixOS test suite
# TODO: multiple outputs
# TODO: documentation
diff --git a/pkgs/by-name/ba/bashly/Gemfile b/pkgs/by-name/ba/bashly/Gemfile
new file mode 100644
index 000000000000..b5d29f5f4c59
--- /dev/null
+++ b/pkgs/by-name/ba/bashly/Gemfile
@@ -0,0 +1,2 @@
+source 'https://rubygems.org'
+gem 'bashly'
diff --git a/pkgs/by-name/ba/bashly/Gemfile.lock b/pkgs/by-name/ba/bashly/Gemfile.lock
new file mode 100644
index 000000000000..0021014b3728
--- /dev/null
+++ b/pkgs/by-name/ba/bashly/Gemfile.lock
@@ -0,0 +1,59 @@
+GEM
+ remote: https://rubygems.org/
+ specs:
+ bashly (1.1.1)
+ colsole (>= 0.8.1, < 2)
+ completely (~> 0.6.1)
+ filewatcher (~> 2.0)
+ gtx (~> 0.1)
+ lp (~> 0.2)
+ mister_bin (~> 0.7)
+ psych (>= 3.3.2, < 7)
+ tty-markdown (~> 0.7)
+ colsole (1.0.0)
+ completely (0.6.1)
+ colsole (>= 0.8.1, < 2)
+ mister_bin (~> 0.7)
+ docopt_ng (0.7.1)
+ filewatcher (2.1.0)
+ module_methods (~> 0.1.0)
+ gtx (0.1.0)
+ kramdown (2.4.0)
+ rexml
+ lp (0.2.1)
+ mister_bin (0.7.6)
+ colsole (>= 0.8.1, < 2)
+ docopt_ng (~> 0.7, >= 0.7.1)
+ module_methods (0.1.0)
+ pastel (0.8.0)
+ tty-color (~> 0.5)
+ psych (5.1.1.1)
+ stringio
+ rexml (3.2.6)
+ rouge (4.1.3)
+ stringio (3.0.8)
+ strings (0.2.1)
+ strings-ansi (~> 0.2)
+ unicode-display_width (>= 1.5, < 3.0)
+ unicode_utils (~> 1.4)
+ strings-ansi (0.2.0)
+ tty-color (0.6.0)
+ tty-markdown (0.7.2)
+ kramdown (>= 1.16.2, < 3.0)
+ pastel (~> 0.8)
+ rouge (>= 3.14, < 5.0)
+ strings (~> 0.2.0)
+ tty-color (~> 0.5)
+ tty-screen (~> 0.8)
+ tty-screen (0.8.1)
+ unicode-display_width (2.5.0)
+ unicode_utils (1.4.0)
+
+PLATFORMS
+ x86_64-linux
+
+DEPENDENCIES
+ bashly
+
+BUNDLED WITH
+ 2.3.26
diff --git a/pkgs/by-name/ba/bashly/gemset.nix b/pkgs/by-name/ba/bashly/gemset.nix
new file mode 100644
index 000000000000..e24c0b3483d7
--- /dev/null
+++ b/pkgs/by-name/ba/bashly/gemset.nix
@@ -0,0 +1,231 @@
+{
+ bashly = {
+ dependencies = ["colsole" "completely" "filewatcher" "gtx" "lp" "mister_bin" "psych" "tty-markdown"];
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "1rhzbpv8j5qcm5a84m4vzrryb0j8z90q6djbpid4ay2fr492kvkq";
+ type = "gem";
+ };
+ version = "1.1.1";
+ };
+ colsole = {
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "1fvf6dz2wsvjk7q24z0dm8lajq3p2l6i5ywf3mxj683rmhwq49bg";
+ type = "gem";
+ };
+ version = "1.0.0";
+ };
+ completely = {
+ dependencies = ["colsole" "mister_bin"];
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "01nk1cigb09z6rjy41qrhqf58cgpqm43xwjdkz33mfmwrnz04cw1";
+ type = "gem";
+ };
+ version = "0.6.1";
+ };
+ docopt_ng = {
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "0rsnl5s7k2s1gl4n4dg68ssg577kf11sl4a4l2lb2fpswj718950";
+ type = "gem";
+ };
+ version = "0.7.1";
+ };
+ filewatcher = {
+ dependencies = ["module_methods"];
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "03f9v57c5zag09mi10yjhdx7y0vv2w5wrnwzbij9hhkwh43rk077";
+ type = "gem";
+ };
+ version = "2.1.0";
+ };
+ gtx = {
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "10hfhicvv371gy1i16x6vry1xglvxl0zh7qr6f14pqsx32qih6ff";
+ type = "gem";
+ };
+ version = "0.1.0";
+ };
+ kramdown = {
+ dependencies = ["rexml"];
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "1ic14hdcqxn821dvzki99zhmcy130yhv5fqfffkcf87asv5mnbmn";
+ type = "gem";
+ };
+ version = "2.4.0";
+ };
+ lp = {
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "0ns1aza32n929w7smg1dsn4g6qlfi7k1jrvssyn35cicmwn0gyyr";
+ type = "gem";
+ };
+ version = "0.2.1";
+ };
+ mister_bin = {
+ dependencies = ["colsole" "docopt_ng"];
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "0xx8cxvzcn47zsnshcllf477x4rbssrchvp76929qnsg5k9q7fas";
+ type = "gem";
+ };
+ version = "0.7.6";
+ };
+ module_methods = {
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "1886wjscfripgzlmyvcd0jmlzwr6hxvklm2a5rm32dw5bf7bvjki";
+ type = "gem";
+ };
+ version = "0.1.0";
+ };
+ pastel = {
+ dependencies = ["tty-color"];
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "0xash2gj08dfjvq4hy6l1z22s5v30fhizwgs10d6nviggpxsj7a8";
+ type = "gem";
+ };
+ version = "0.8.0";
+ };
+ psych = {
+ dependencies = ["stringio"];
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "0wjzrkssjfjpynij5dpycyflhqbjvi1gc2j73xgq3b196s1d3c24";
+ type = "gem";
+ };
+ version = "5.1.1.1";
+ };
+ rexml = {
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "05i8518ay14kjbma550mv0jm8a6di8yp5phzrd8rj44z9qnrlrp0";
+ type = "gem";
+ };
+ version = "3.2.6";
+ };
+ rouge = {
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "19drl3x8fw65v3mpy7fk3cf3dfrywz5alv98n2rm4pp04vdn71lw";
+ type = "gem";
+ };
+ version = "4.1.3";
+ };
+ stringio = {
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "0ix96dxbjqlpymdigb4diwrifr0bq7qhsrng95fkkp18av326nqk";
+ type = "gem";
+ };
+ version = "3.0.8";
+ };
+ strings = {
+ dependencies = ["strings-ansi" "unicode-display_width" "unicode_utils"];
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "1yynb0qhhhplmpzavfrrlwdnd1rh7rkwzcs4xf0mpy2wr6rr6clk";
+ type = "gem";
+ };
+ version = "0.2.1";
+ };
+ strings-ansi = {
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "120wa6yjc63b84lprglc52f40hx3fx920n4dmv14rad41rv2s9lh";
+ type = "gem";
+ };
+ version = "0.2.0";
+ };
+ tty-color = {
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "0aik4kmhwwrmkysha7qibi2nyzb4c8kp42bd5vxnf8sf7b53g73g";
+ type = "gem";
+ };
+ version = "0.6.0";
+ };
+ tty-markdown = {
+ dependencies = ["kramdown" "pastel" "rouge" "strings" "tty-color" "tty-screen"];
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "04f599zn5rfndq4d9l0acllfpc041bzdkkz2h6x0dl18f2wivn0y";
+ type = "gem";
+ };
+ version = "0.7.2";
+ };
+ tty-screen = {
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "18jr6s1cg8yb26wzkqa6874q0z93rq0y5aw092kdqazk71y6a235";
+ type = "gem";
+ };
+ version = "0.8.1";
+ };
+ unicode-display_width = {
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "1d0azx233nags5jx3fqyr23qa2rhgzbhv8pxp46dgbg1mpf82xky";
+ type = "gem";
+ };
+ version = "2.5.0";
+ };
+ unicode_utils = {
+ groups = ["default"];
+ platforms = [];
+ source = {
+ remotes = ["https://rubygems.org"];
+ sha256 = "0h1a5yvrxzlf0lxxa1ya31jcizslf774arnsd89vgdhk4g7x08mr";
+ type = "gem";
+ };
+ version = "1.4.0";
+ };
+}
diff --git a/pkgs/by-name/ba/bashly/package.nix b/pkgs/by-name/ba/bashly/package.nix
new file mode 100644
index 000000000000..5a3d6661caa2
--- /dev/null
+++ b/pkgs/by-name/ba/bashly/package.nix
@@ -0,0 +1,38 @@
+{ lib
+, stdenvNoCC
+, bundlerApp
+}:
+
+let
+ bashlyBundlerApp = bundlerApp {
+ pname = "bashly";
+ gemdir = ./.;
+ exes = [ "bashly" ];
+ };
+in
+stdenvNoCC.mkDerivation (finalAttrs: {
+ name = "bashly";
+
+ dontUnpack = true;
+
+ installPhase = ''
+ runHook preInstall
+
+ mkdir $out;
+ cd $out;
+
+ mkdir bin; pushd bin;
+ ln -vs ${bashlyBundlerApp}/bin/bashly;
+
+ runHook postInstall
+ '';
+
+ meta = {
+ description = "Bash command line framework and CLI generator";
+ homepage = "https://github.com/DannyBen/bashly";
+ license = lib.licenses.mit;
+ mainProgram = "bashly";
+ maintainers = with lib.maintainers; [ drupol ];
+ platforms = lib.platforms.unix;
+ };
+})
diff --git a/pkgs/by-name/db/dbus-cpp/package.nix b/pkgs/by-name/db/dbus-cpp/package.nix
new file mode 100644
index 000000000000..2e834111c9d9
--- /dev/null
+++ b/pkgs/by-name/db/dbus-cpp/package.nix
@@ -0,0 +1,127 @@
+{ stdenv
+, lib
+, fetchFromGitLab
+, fetchpatch
+, gitUpdater
+, testers
+, boost
+, cmake
+, dbus
+, doxygen
+, graphviz
+, gtest
+, libxml2
+, lomiri
+, pkg-config
+, process-cpp
+, properties-cpp
+}:
+
+stdenv.mkDerivation (finalAttrs: {
+ pname = "dbus-cpp";
+ version = "5.0.3";
+
+ src = fetchFromGitLab {
+ owner = "ubports";
+ repo = "development/core/lib-cpp/dbus-cpp";
+ rev = finalAttrs.version;
+ hash = "sha256-t8SzPRUuKeEchT8vAsITf8MwbgHA+mR5C9CnkdVyX7s=";
+ };
+
+ outputs = [
+ "out"
+ "dev"
+ "doc"
+ "examples"
+ ];
+
+ patches = [
+ # Handle already-stolen dbus call better
+ # Remove when version > 5.0.3
+ (fetchpatch {
+ name = "0001-dbus-cpp-src-Dont-steal-a-pending-dbus-call-more-then-once.patch";
+ url = "https://gitlab.com/ubports/development/core/lib-cpp/dbus-cpp/-/commit/9f3d1ff2b1c6c732285949c3dbb35e40cf55ea92.patch";
+ hash = "sha256-xzOCIJVsK2J+X9RsV930R9uw6h4UxqwSaNOgv8v4qQU=";
+ })
+
+ # Fix GCC13 compilation
+ # Remove when version > 5.0.3
+ (fetchpatch {
+ name = "0002-dbus-cpp-Add-missing-headers-for-GCC13.patch";
+ url = "https://gitlab.com/ubports/development/core/lib-cpp/dbus-cpp/-/commit/c761b1eec084962dbe64d35d7f7b86dcbe57a3f7.patch";
+ hash = "sha256-/tKe3iHWxP9jWtpdgwwRynj8565u9LxCt4WXJDXzgX4=";
+ })
+ ];
+
+ postPatch = ''
+ substituteInPlace doc/CMakeLists.txt \
+ --replace 'DESTINATION share/''${CMAKE_PROJECT_NAME}/doc' 'DESTINATION ''${CMAKE_INSTALL_DOCDIR}'
+
+ # Warning on aarch64-linux breaks build due to -Werror
+ substituteInPlace CMakeLists.txt \
+ --replace '-Werror' ""
+
+ # pkg-config output patching hook expects prefix variable here
+ substituteInPlace data/dbus-cpp.pc.in \
+ --replace 'includedir=''${exec_prefix}' 'includedir=''${prefix}'
+ '' + lib.optionalString (!finalAttrs.doCheck) ''
+ sed -i -e '/add_subdirectory(tests)/d' CMakeLists.txt
+ '';
+
+ strictDeps = true;
+
+ nativeBuildInputs = [
+ cmake
+ doxygen
+ graphviz
+ pkg-config
+ ];
+
+ buildInputs = [
+ boost
+ lomiri.cmake-extras
+ dbus
+ libxml2
+ process-cpp
+ properties-cpp
+ ];
+
+ nativeCheckInputs = [
+ dbus
+ ];
+
+ checkInputs = [
+ gtest
+ ];
+
+ cmakeFlags = [
+ "-DDBUS_CPP_ENABLE_DOC_GENERATION=ON"
+ ];
+
+ # Too flaky on ARM CI & for some amd64 users
+ doCheck = false;
+
+ # DBus, parallelism messes with communication
+ enableParallelChecking = false;
+
+ preFixup = ''
+ moveToOutput libexec/examples $examples
+ '';
+
+ passthru = {
+ tests.pkg-config = testers.testMetaPkgConfig finalAttrs.finalPackage;
+ updateScript = gitUpdater { };
+ };
+
+ meta = with lib; {
+ description = "A dbus-binding leveraging C++-11";
+ homepage = "https://gitlab.com/ubports/development/core/lib-cpp/dbus-cpp";
+ license = licenses.lgpl3Only;
+ maintainers = with maintainers; [ OPNA2608 ];
+ mainProgram = "dbus-cppc";
+ platforms = platforms.linux;
+ pkgConfigModules = [
+ "dbus-cpp"
+ ];
+ };
+})
diff --git a/pkgs/by-name/fi/firewalk/package.nix b/pkgs/by-name/fi/firewalk/package.nix
new file mode 100644
index 000000000000..8909a61062c7
--- /dev/null
+++ b/pkgs/by-name/fi/firewalk/package.nix
@@ -0,0 +1,27 @@
+{ lib
+, stdenv
+, fetchurl
+, libnet
+, libpcap
+, libdnet
+}:
+
+stdenv.mkDerivation (finalAttrs: {
+ pname = "firewalk";
+ version = "5.0";
+
+ src = fetchurl {
+ url = "https://salsa.debian.org/pkg-security-team/firewalk/-/archive/upstream/${finalAttrs.version}/firewalk-upstream-${finalAttrs.version}.tar.gz";
+ hash = "sha256-f0sHzcH3faeg7epfpWXbgaHrRWaWBKMEqLdy38+svGo=";
+ };
+
+ buildInputs = [ libnet libpcap libdnet ];
+
+ meta = with lib; {
+ description = "Gateway ACL scanner";
+ homepage = "http://packetfactory.openwall.net/projects/firewalk/";
+ license = licenses.bsd2;
+ maintainers = with maintainers; [ tochiaha ];
+ platforms = platforms.linux;
+ };
+})
diff --git a/pkgs/by-name/fl/flip/package.nix b/pkgs/by-name/fl/flip/package.nix
new file mode 100644
index 000000000000..f7957c0990b0
--- /dev/null
+++ b/pkgs/by-name/fl/flip/package.nix
@@ -0,0 +1,32 @@
+{
+ stdenv,
+ lib,
+ fetchFromGitHub,
+ cmake
+}:
+
+stdenv.mkDerivation {
+ pname = "flip";
+ version = "1.2";
+
+ src = fetchFromGitHub {
+ owner = "NVlabs";
+ repo = "flip";
+ rev = "8303adb2060d69423d040453995f4ad1a030a1cc";
+ hash = "sha256-jSB79qOtnW/cjApIDcLRqGabnzCIwS7saA+aF1TcyV0=";
+ };
+
+ nativeBuildInputs = [
+ cmake
+ ];
+
+ enableParallelBuilding = true;
+
+ meta = with lib; {
+ description = "A tool for visualizing and communicating the errors in rendered images.";
+ license = licenses.bsd3;
+ platforms = platforms.unix;
+ maintainers = with maintainers; [ zmitchell ];
+ mainProgram = "flip";
+ };
+}
diff --git a/pkgs/by-name/hi/hifile/package.nix b/pkgs/by-name/hi/hifile/package.nix
new file mode 100644
index 000000000000..bf2bda5100dc
--- /dev/null
+++ b/pkgs/by-name/hi/hifile/package.nix
@@ -0,0 +1,41 @@
+{ lib, appimageTools, fetchurl }:
+
+let
+ version = "0.9.9.5";
+ pname = "hifile";
+
+ src = fetchurl {
+ url = "https://www.hifile.app/files/HiFile-${version}.AppImage";
+ hash = "sha256-Ks/NLPm5loo9q8pT0LdtfcrC38203beNE74sbEpyuJM=";
+ };
+
+ appimageContents = appimageTools.extractType2 {
+ inherit pname version src;
+ };
+
+in
+appimageTools.wrapType2 rec {
+ inherit pname version src;
+
+ extraInstallCommands = ''
+ mv $out/bin/${pname}-${version} $out/bin/${pname}
+
+ install -m 444 -D ${appimageContents}/HiFile.desktop $out/share/applications/HiFile.desktop
+ install -m 444 -D ${appimageContents}/HiFile.png $out/share/icons/hicolor/512x512/apps/HiFile.png
+ substituteInPlace $out/share/applications/HiFile.desktop \
+ --replace 'Exec=HiFile' 'Exec=${pname}'
+ '';
+
+ meta = with lib; {
+ description = "Dual-pane graphical file manager for Windows, macOS and Linux";
+ longDescription = ''
+ HiFile is the next evolution of file managers. Its mission is to increase your productivity whenever you work with files or folders. It aims to be better in every way - more convenient, more versatile, more efficient, more elegant, more customizable, and more fun.
+ '';
+ homepage = "https://www.hifile.app/";
+ downloadPage = "https://www.hifile.app/download";
+ license = licenses.unfree;
+ sourceProvenance = with sourceTypes; [ binaryNativeCode ];
+ maintainers = with maintainers; [ ymstnt ];
+ platforms = [ "x86_64-linux" ];
+ };
+}
diff --git a/pkgs/by-name/ji/jitterentropy-rngd/package.nix b/pkgs/by-name/ji/jitterentropy-rngd/package.nix
new file mode 100644
index 000000000000..feb7d1e2fb12
--- /dev/null
+++ b/pkgs/by-name/ji/jitterentropy-rngd/package.nix
@@ -0,0 +1,34 @@
+{ lib, stdenv, fetchFromGitHub }:
+
+stdenv.mkDerivation rec {
+ pname = "jitterentropy-rngd";
+ version = "1.2.8";
+
+ src = fetchFromGitHub {
+ owner = "smuellerDD";
+ repo = pname;
+ rev = "v${version}";
+ hash = "sha256-LDym636ss3B1G/vrqatu9g5vbVEeDX0JQcxZ/IxGeY0=";
+ };
+
+ enableParallelBuilding = true;
+
+ installPhase = ''
+ runHook preInstall
+
+ mkdir -p $out
+ make install DESTDIR= PREFIX=$out UNITDIR=$out/lib/systemd/system
+
+ runHook postInstall
+ '';
+
+ meta = with lib; {
+ description = ''A random number generator, which injects entropy to the kernel'';
+ homepage = "https://github.com/smuellerDD/jitterentropy-rngd";
+ changelog = "https://github.com/smuellerDD/jitterentropy-rngd/releases/tag/v${version}";
+ license = [ licenses.gpl2Only licenses.bsd3 ];
+ platforms = platforms.linux;
+ maintainers = with maintainers; [ thillux ];
+ mainProgram = "jitterentropy-rngd";
+ };
+}
diff --git a/pkgs/by-name/ko/konbucase/package.nix b/pkgs/by-name/ko/konbucase/package.nix
new file mode 100644
index 000000000000..75876d990661
--- /dev/null
+++ b/pkgs/by-name/ko/konbucase/package.nix
@@ -0,0 +1,52 @@
+{ lib
+, stdenv
+, fetchFromGitHub
+, meson
+, ninja
+, vala
+, pkg-config
+, wrapGAppsHook
+, pantheon
+, gtksourceview5
+}:
+
+stdenv.mkDerivation (finalAttrs: {
+ pname = "konbucase";
+ version = "4.1.1";
+
+ src = fetchFromGitHub {
+ owner = "ryonakano";
+ repo = "konbucase";
+ rev = finalAttrs.version;
+ hash = "sha256-g3EDa9EXymi6c8dRHFZYGEAT7k8M2TXUAzZVKTnLzyk=";
+ fetchSubmodules = true;
+ };
+
+ nativeBuildInputs = [
+ meson
+ ninja
+ vala
+ pkg-config
+ wrapGAppsHook
+ ];
+
+ buildInputs = [
+ pantheon.granite7
+ gtksourceview5
+ ];
+
+ postInstall = ''
+ mv $out/bin/com.github.ryonakano.konbucase $out/bin/konbucase
+ substituteInPlace $out/share/applications/com.github.ryonakano.konbucase.desktop \
+ --replace 'Exec=com.github.ryonakano.konbucase' 'Exec=${placeholder "out"}/bin/konbucase'
+ '';
+
+ meta = with lib; {
+ homepage = "https://github.com/ryonakano/konbucase";
+ description = "A case converting app suitable for coding or typing";
+ license = licenses.gpl3Only;
+ maintainers = with maintainers; [ galaxy ];
+ platforms = platforms.linux;
+ mainProgram = "konbucase";
+ };
+})
diff --git a/pkgs/by-name/on/onedriver/package.nix b/pkgs/by-name/on/onedriver/package.nix
new file mode 100644
index 000000000000..f4087401ea92
--- /dev/null
+++ b/pkgs/by-name/on/onedriver/package.nix
@@ -0,0 +1,64 @@
+{ buildGoModule
+, fetchFromGitHub
+, lib
+, pkg-config
+, webkitgtk
+, glib
+, fuse
+, installShellFiles
+}:
+let
+ pname = "onedriver";
+ version = "0.13.0-2";
+
+ src = fetchFromGitHub {
+ owner = "jstaf";
+ repo = "onedriver";
+ rev = "v${version}";
+ hash = "sha256-Bcjgmx9a4pTRhkzR3tbOB6InjvuH71qomv4t+nRNc+w=";
+ };
+in
+buildGoModule {
+ inherit pname version src;
+ vendorHash = "sha256-OOiiKtKb+BiFkoSBUQQfqm4dMfDW3Is+30Kwcdg8LNA=";
+
+ nativeBuildInputs = [ pkg-config installShellFiles ];
+ buildInputs = [ webkitgtk glib fuse ];
+
+ ldflags = [ "-X github.com/jstaf/onedriver/cmd/common.commit=v${version}" ];
+
+ subPackages = [
+ "cmd/onedriver"
+ "cmd/onedriver-launcher"
+ ];
+
+ postInstall = ''
+ echo "Running postInstall"
+ install -Dm644 ./resources/onedriver.svg $out/share/icons/onedriver/onedriver.svg
+ install -Dm644 ./resources/onedriver.png $out/share/icons/onedriver/onedriver.png
+ install -Dm644 ./resources/onedriver-128.png $out/share/icons/onedriver/onedriver-128.png
+
+ install -Dm644 ./resources/onedriver.desktop $out/share/applications/onedriver.desktop
+
+ mkdir -p $out/share/man/man1
+ installManPage ./resources/onedriver.1
+
+ substituteInPlace $out/share/applications/onedriver.desktop \
+ --replace "/usr/bin/onedriver-launcher" "$out/bin/onedriver-launcher" \
+ --replace "/usr/share/icons" "$out/share/icons"
+ '';
+
+ meta = with lib; {
+ description = "A network filesystem for Linux";
+ longDescription = ''
+ onedriver is a network filesystem that gives your computer direct access to your files on Microsoft OneDrive.
+ This is not a sync client. Instead of syncing files, onedriver performs an on-demand download of files when
+ your computer attempts to use them. onedriver allows you to use files on OneDrive as if they were files on
+ your local computer.
+ '';
+ inherit (src.meta) homepage;
+ license = licenses.gpl3Plus;
+ maintainers = [ maintainers.massimogengarelli ];
+ platforms = platforms.linux;
+ };
+}
diff --git a/pkgs/by-name/pr/presenterm/package.nix b/pkgs/by-name/pr/presenterm/package.nix
index e3c42056a275..6e09e86f2059 100644
--- a/pkgs/by-name/pr/presenterm/package.nix
+++ b/pkgs/by-name/pr/presenterm/package.nix
@@ -2,16 +2,16 @@
rustPlatform.buildRustPackage rec {
pname = "presenterm";
- version = "0.2.0";
+ version = "0.2.1";
src = fetchFromGitHub {
owner = "mfontanini";
repo = "presenterm";
- rev = version;
- hash = "sha256-mNWnUUezKIffh5gMgMMdvApNZZTxxB8XrL0jFLyBxuk=";
+ rev = "v${version}";
+ hash = "sha256-sXVMVU34gxZKGNye6hoyv07a7N7f6UbivA6thbSOeZA=";
};
- cargoHash = "sha256-JLPJLhWN/yXpPIHa+FJ2aQ/GDUFKtZ7t+/8rvR8WNKM=";
+ cargoHash = "sha256-PsDaXMws/8hEvAZwClQ4okGuryg1iKg0IBr7Xp2QYBE=";
meta = with lib; {
description = "A terminal based slideshow tool";
diff --git a/pkgs/applications/editors/tecoc/default.nix b/pkgs/by-name/te/tecoc/package.nix
similarity index 95%
rename from pkgs/applications/editors/tecoc/default.nix
rename to pkgs/by-name/te/tecoc/package.nix
index 778115dfbfa7..a5531b3aa874 100644
--- a/pkgs/applications/editors/tecoc/default.nix
+++ b/pkgs/by-name/te/tecoc/package.nix
@@ -72,7 +72,7 @@ stdenv.mkDerivation (finalAttrs: {
TECOC is a portable C implementation of TECO-11.
'';
license = {
- url = "https://github.com/blakemcbride/TECOC/tree/master/doc/readme-1st.txt";
+ url = "https://github.com/blakemcbride/TECOC/blob/${finalAttrs.src.rev}/doc/readme-1st.txt";
};
maintainers = [ lib.maintainers.AndersonTorres ];
platforms = lib.platforms.unix;
diff --git a/pkgs/by-name/tp/tpm2-totp/package.nix b/pkgs/by-name/tp/tpm2-totp/package.nix
new file mode 100644
index 000000000000..766c6e138af6
--- /dev/null
+++ b/pkgs/by-name/tp/tpm2-totp/package.nix
@@ -0,0 +1,46 @@
+{ lib
+, stdenv
+, fetchFromGitHub
+, tpm2-tss
+, autoreconfHook
+, autoconf-archive
+, pkg-config
+, qrencode
+}:
+
+stdenv.mkDerivation rec {
+ pname = "tpm2-totp";
+ version = "0.3.0";
+
+ src = fetchFromGitHub {
+ owner = "tpm2-software";
+ repo = "tpm2-totp";
+ rev = "v${version}";
+ hash = "sha256-aeWhI2GQcWa0xAqlmHfcbCMg78UqcD6eanLlEVNVnRM=";
+ };
+
+ preConfigure = ''
+ echo '0.3.0' > VERSION
+ '';
+
+ nativeBuildInputs = [
+ autoreconfHook
+ autoconf-archive
+ pkg-config
+ ];
+
+ buildInputs = [
+ tpm2-tss
+ qrencode
+ ];
+
+ meta = with lib; {
+ description = "Attest the trustworthiness of a device against a human using time-based one-time passwords";
+ homepage = "https://github.com/tpm2-software/tpm2-totp";
+ changelog = "https://github.com/tpm2-software/tpm2-totp/blob/${src.rev}/CHANGELOG.md";
+ license = licenses.bsd3;
+ mainProgram = "tpm2-totp";
+ platforms = platforms.all;
+ maintainers = with maintainers; [ raitobezarius ];
+ };
+}
diff --git a/pkgs/by-name/tr/trealla/package.nix b/pkgs/by-name/tr/trealla/package.nix
index 1a9d5569f235..6aee9c1598b9 100644
--- a/pkgs/by-name/tr/trealla/package.nix
+++ b/pkgs/by-name/tr/trealla/package.nix
@@ -17,13 +17,13 @@
assert lib.elem lineEditingLibrary [ "isocline" "readline" ];
stdenv.mkDerivation (finalAttrs: {
pname = "trealla";
- version = "2.28.12";
+ version = "2.29.36";
src = fetchFromGitHub {
owner = "trealla-prolog";
repo = "trealla";
rev = "v${finalAttrs.version}";
- hash = "sha256-uWCpCjYFtK2pNeHHZWhWI6YZ+cllQpkKz//nHracl5s=";
+ hash = "sha256-tQp2DOBW71Wm1aQqspW9tuH8aM8ir+ilZiENdElB/+0=";
};
postPatch = ''
diff --git a/pkgs/by-name/xs/xsct/package.nix b/pkgs/by-name/xs/xsct/package.nix
new file mode 100644
index 000000000000..80023f676c49
--- /dev/null
+++ b/pkgs/by-name/xs/xsct/package.nix
@@ -0,0 +1,38 @@
+{ stdenv
+, lib
+, fetchFromGitHub
+, gitUpdater
+, libX11
+, libXrandr
+}:
+
+stdenv.mkDerivation (finalAttrs: {
+ pname = "xsct";
+ version = "2.0";
+
+ src = fetchFromGitHub {
+ owner = "faf0";
+ repo = "sct";
+ rev = finalAttrs.version;
+ hash = "sha256-XhrkaK85I/U2ChO5mZYah/TaXz03yahfMEbfgzXqytU=";
+ };
+
+ buildInputs = [
+ libX11
+ libXrandr
+ ];
+
+ makeFlags = [
+ "PREFIX=${placeholder "out"}"
+ ];
+
+ passthru.updateScript = gitUpdater { };
+
+ meta = with lib; {
+ description = "Set color temperature of screen";
+ homepage = "https://github.com/faf0/sct";
+ license = licenses.unlicense;
+ maintainers = with maintainers; [ OPNA2608 ];
+ platforms = with platforms; linux ++ freebsd ++ openbsd;
+ };
+})
diff --git a/pkgs/data/themes/nordic/default.nix b/pkgs/data/themes/nordic/default.nix
index 8d977671fe7d..c8e956c3f83d 100644
--- a/pkgs/data/themes/nordic/default.nix
+++ b/pkgs/data/themes/nordic/default.nix
@@ -3,6 +3,7 @@
, fetchFromGitHub
, gtk-engine-murrine
, jdupes
+, libsForQt5
}:
stdenv.mkDerivation rec {
@@ -79,6 +80,15 @@ stdenv.mkDerivation rec {
nativeBuildInputs = [ jdupes ];
+ buildInputs = with libsForQt5; [
+ plasma-framework
+ qtgraphicaleffects
+ plasma-workspace
+ breeze-icons
+ ];
+
+ dontWrapQtApps = true;
+
propagatedUserEnvPkgs = [ gtk-engine-murrine ];
installPhase = ''
diff --git a/pkgs/data/themes/orchis-theme/default.nix b/pkgs/data/themes/orchis-theme/default.nix
index 2d07ac3ae380..351c1c22207c 100644
--- a/pkgs/data/themes/orchis-theme/default.nix
+++ b/pkgs/data/themes/orchis-theme/default.nix
@@ -26,13 +26,13 @@ lib.checkListOfEnum "${pname}: theme tweaks" validTweaks tweaks
stdenvNoCC.mkDerivation
rec {
inherit pname;
- version = "2023-05-27";
+ version = "2023-10-20";
src = fetchFromGitHub {
repo = "Orchis-theme";
owner = "vinceliuice";
rev = version;
- hash = "sha256-I1a8y9dAJqFgnhyMqfupSdGvbbScf6tSYKlAhAzY4Dk=";
+ hash = "sha256-GhSzTtbuvbAuXxKNm29sJX5kXE2s2jMDB6Ww6Q7GNSo=";
};
nativeBuildInputs = [ gtk3 sassc ];
diff --git a/pkgs/development/compilers/flutter/package-overrides/default.nix b/pkgs/development/compilers/dart/package-overrides/default.nix
similarity index 100%
rename from pkgs/development/compilers/flutter/package-overrides/default.nix
rename to pkgs/development/compilers/dart/package-overrides/default.nix
diff --git a/pkgs/development/compilers/flutter/package-overrides/flutter-secure-storage-linux/default.nix b/pkgs/development/compilers/dart/package-overrides/flutter-secure-storage-linux/default.nix
similarity index 100%
rename from pkgs/development/compilers/flutter/package-overrides/flutter-secure-storage-linux/default.nix
rename to pkgs/development/compilers/dart/package-overrides/flutter-secure-storage-linux/default.nix
diff --git a/pkgs/development/compilers/flutter/package-overrides/handy-window/default.nix b/pkgs/development/compilers/dart/package-overrides/handy-window/default.nix
similarity index 100%
rename from pkgs/development/compilers/flutter/package-overrides/handy-window/default.nix
rename to pkgs/development/compilers/dart/package-overrides/handy-window/default.nix
diff --git a/pkgs/development/compilers/flutter/package-overrides/matrix/default.nix b/pkgs/development/compilers/dart/package-overrides/matrix/default.nix
similarity index 100%
rename from pkgs/development/compilers/flutter/package-overrides/matrix/default.nix
rename to pkgs/development/compilers/dart/package-overrides/matrix/default.nix
diff --git a/pkgs/development/compilers/flutter/package-overrides/olm/default.nix b/pkgs/development/compilers/dart/package-overrides/olm/default.nix
similarity index 100%
rename from pkgs/development/compilers/flutter/package-overrides/olm/default.nix
rename to pkgs/development/compilers/dart/package-overrides/olm/default.nix
diff --git a/pkgs/development/compilers/flix/default.nix b/pkgs/development/compilers/flix/default.nix
index 47a84a6e5f2d..9ce582623fe1 100644
--- a/pkgs/development/compilers/flix/default.nix
+++ b/pkgs/development/compilers/flix/default.nix
@@ -2,11 +2,11 @@
stdenvNoCC.mkDerivation rec {
pname = "flix";
- version = "0.40.0";
+ version = "0.41.0";
src = fetchurl {
url = "https://github.com/flix/flix/releases/download/v${version}/flix.jar";
- sha256 = "sha256-NVQY2TgIR9ROy4x8PWxCjuaOkNx0bcUA4oZHjpQbHc4=";
+ sha256 = "sha256-bDeqwk+grkCxmGE9H8Ks7Q8KvLxNCzaLe44DlR6E7YE=";
};
dontUnpack = true;
diff --git a/pkgs/development/compilers/mrustc/default.nix b/pkgs/development/compilers/mrustc/default.nix
index 6570199f8523..eae17cbce91f 100644
--- a/pkgs/development/compilers/mrustc/default.nix
+++ b/pkgs/development/compilers/mrustc/default.nix
@@ -4,9 +4,9 @@
}:
let
- version = "0.10";
+ version = "0.10.1";
tag = "v${version}";
- rev = "b364724f15fd6fce8234ad8add68107c23a22151";
+ rev = "b6754f574f8846eb842feba4ccbeeecb10bdfacc";
in
stdenv.mkDerivation rec {
@@ -18,7 +18,7 @@ stdenv.mkDerivation rec {
owner = "thepowersgang";
repo = "mrustc";
rev = tag;
- sha256 = "0f7kh4n2663sn0z3xib8gzw0s97qpvwag40g2vs3bfjlrbpgi9z0";
+ hash = "sha256-sYnx5dUTaQbK4ugnSzAJwIUwZKPUhThmNA+WlY+LEWc=";
};
postPatch = ''
diff --git a/pkgs/development/compilers/rust/rustfmt.nix b/pkgs/development/compilers/rust/rustfmt.nix
index b53be1633d56..40f6237dbe98 100644
--- a/pkgs/development/compilers/rust/rustfmt.nix
+++ b/pkgs/development/compilers/rust/rustfmt.nix
@@ -38,6 +38,7 @@ rustPlatform.buildRustPackage rec {
description = "A tool for formatting Rust code according to style guidelines";
homepage = "https://github.com/rust-lang-nursery/rustfmt";
license = with licenses; [ mit asl20 ];
+ mainProgram = "rustfmt";
maintainers = with maintainers; [ globin basvandijk ];
};
}
diff --git a/pkgs/development/embedded/stm32/stm32cubemx/default.nix b/pkgs/development/embedded/stm32/stm32cubemx/default.nix
index a9384d9b2b8b..e3e0f2672cf2 100644
--- a/pkgs/development/embedded/stm32/stm32cubemx/default.nix
+++ b/pkgs/development/embedded/stm32/stm32cubemx/default.nix
@@ -13,11 +13,11 @@ let
in
stdenv.mkDerivation rec {
pname = "stm32cubemx";
- version = "6.9.1";
+ version = "6.9.2";
src = fetchzip {
url = "https://sw-center.st.com/packs/resource/library/stm32cube_mx_v${builtins.replaceStrings ["."] [""] version}-lin.zip";
- sha256 = "sha256-KTbIRj7DkWoC2h/TLKjVduvsKVSue28kGOL34JqBVx4=";
+ sha256 = "sha256-x3ZRMtTvFGz2/0gJMx4zOx9rSnrSkCEl3pj5raeyVHg=";
stripRoot = false;
};
diff --git a/pkgs/development/libraries/argagg/0001-catch.diff b/pkgs/development/libraries/argagg/0001-catch.diff
deleted file mode 100644
index f99649d56812..000000000000
--- a/pkgs/development/libraries/argagg/0001-catch.diff
+++ /dev/null
@@ -1,20 +0,0 @@
---- old/test/doctest.h 2019-03-05 18:04:06.143740733 +0300
-+++ new/test/doctest.h 2019-03-05 18:04:43.577284916 +0300
-@@ -1307,7 +1307,7 @@
- __FILE__, __LINE__, #expr, #as); \
- try { \
- expr; \
-- } catch(as) { \
-+ } catch(as e) { \
- _DOCTEST_RB.m_threw = true; \
- _DOCTEST_RB.m_threw_as = true; \
- } catch(...) { _DOCTEST_RB.m_threw = true; } \
-@@ -1332,7 +1332,7 @@
- #define DOCTEST_REQUIRE_THROWS(expr) DOCTEST_ASSERT_THROWS(expr, DT_REQUIRE_THROWS)
-
- #define DOCTEST_WARN_THROWS_AS(expr, ex) DOCTEST_ASSERT_THROWS_AS(expr, ex, DT_WARN_THROWS_AS)
--#define DOCTEST_CHECK_THROWS_AS(expr, ex) DOCTEST_ASSERT_THROWS_AS(expr, ex, DT_CHECK_THROWS_AS)
-+#define DOCTEST_CHECK_THROWS_AS(expr, ex) DOCTEST_ASSERT_THROWS_AS(expr, const ex &, DT_CHECK_THROWS_AS)
- #define DOCTEST_REQUIRE_THROWS_AS(expr, ex) DOCTEST_ASSERT_THROWS_AS(expr, ex, DT_REQUIRE_THROWS_AS)
-
- #define DOCTEST_WARN_NOTHROW(expr) DOCTEST_ASSERT_NOTHROW(expr, DT_WARN_NOTHROW)
diff --git a/pkgs/development/libraries/duckdb/default.nix b/pkgs/development/libraries/duckdb/default.nix
index ea152c0cc099..c9f6711780b0 100644
--- a/pkgs/development/libraries/duckdb/default.nix
+++ b/pkgs/development/libraries/duckdb/default.nix
@@ -15,13 +15,13 @@ let
in
stdenv.mkDerivation rec {
pname = "duckdb";
- version = "0.9.0";
+ version = "0.9.1";
src = fetchFromGitHub {
owner = pname;
repo = pname;
rev = "v${version}";
- hash = "sha256-EKvDH7RwOC4Gu/lturrfnGpzXnJ9azIwAFeuVoa6L/Y=";
+ hash = "sha256-UG/vV/6WxVLq9mdze8pSDFJIekOgGsg93dzMq6eP6Dg=";
};
patches = [ ./version.patch ];
@@ -106,10 +106,12 @@ stdenv.mkDerivation rec {
'';
meta = with lib; {
- homepage = "https://github.com/duckdb/duckdb";
+ changelog = "https://github.com/duckdb/duckdb/releases/tag/v${version}";
description = "Embeddable SQL OLAP Database Management System";
+ homepage = "https://duckdb.org/";
license = licenses.mit;
- platforms = platforms.all;
+ mainProgram = "duckdb";
maintainers = with maintainers; [ costrouc cpcloud ];
+ platforms = platforms.all;
};
}
diff --git a/pkgs/development/libraries/duckdb/version.patch b/pkgs/development/libraries/duckdb/version.patch
index 9b368eac5dbc..f40785b43079 100644
--- a/pkgs/development/libraries/duckdb/version.patch
+++ b/pkgs/development/libraries/duckdb/version.patch
@@ -56,25 +56,3 @@ index 2b49e11288..0a4a69b9a0 100644
message(STATUS "git hash ${GIT_COMMIT_HASH}, version ${DUCKDB_VERSION}")
-diff --git a/tools/pythonpkg/setup.py b/tools/pythonpkg/setup.py
-index fdf2911019..c363cc518a 100644
---- a/tools/pythonpkg/setup.py
-+++ b/tools/pythonpkg/setup.py
-@@ -163,8 +163,6 @@ if 'BUILD_HTTPFS' in os.environ:
- for ext in extensions:
- toolchain_args.extend(['-DDUCKDB_EXTENSION_{}_LINKED'.format(ext.upper())])
-
--toolchain_args.extend(['-DDUCKDB_EXTENSION_AUTOLOAD_DEFAULT=1', '-DDUCKDB_EXTENSION_AUTOINSTALL_DEFAULT=1'])
--
-
- class get_pybind_include(object):
- def __init__(self, user=False):
-@@ -343,7 +341,7 @@ setup(
- packages=packages,
- include_package_data=True,
- python_requires='>=3.7.0',
-- setup_requires=setup_requires + ["setuptools_scm<7.0.0", 'pybind11>=2.6.0'],
-+ setup_requires=setup_requires + ["setuptools_scm", 'pybind11>=2.6.0'],
- use_scm_version=setuptools_scm_conf,
- tests_require=['google-cloud-storage', 'mypy', 'pytest'],
- classifiers=[
diff --git a/pkgs/development/libraries/ldb/default.nix b/pkgs/development/libraries/ldb/default.nix
index 95547fb6382a..de1af1f447e8 100644
--- a/pkgs/development/libraries/ldb/default.nix
+++ b/pkgs/development/libraries/ldb/default.nix
@@ -17,11 +17,11 @@
stdenv.mkDerivation rec {
pname = "ldb";
- version = "2.7.2";
+ version = "2.8.0";
src = fetchurl {
url = "mirror://samba/ldb/${pname}-${version}.tar.gz";
- hash = "sha256-Ju5y1keFTmYtmWQ+srLTQWVavzH0mQg41mUPtc+SCcg=";
+ hash = "sha256-NY3KEPzScgeshXoNf0NaRtvGzR98ENu4QMGTG/GWXwg=";
};
outputs = [ "out" "dev" ];
diff --git a/pkgs/development/libraries/libspf2/default.nix b/pkgs/development/libraries/libspf2/default.nix
index b7bef2973523..997e89b82397 100644
--- a/pkgs/development/libraries/libspf2/default.nix
+++ b/pkgs/development/libraries/libspf2/default.nix
@@ -1,23 +1,18 @@
-{ lib, stdenv, fetchFromGitHub, autoreconfHook, fetchpatch }:
+{ lib, stdenv, fetchFromGitHub, autoreconfHook }:
stdenv.mkDerivation rec {
pname = "libspf2";
- version = "2.2.12";
+ version = "2.2.13";
src = fetchFromGitHub {
owner = "helsinki-systems";
repo = "libspf2";
rev = "v${version}";
- sha256 = "03iiaafdcwh220pqignk407h6klrakwz0zkb8iwk6nkwipkwvhsx";
+ hash = "sha256-tkCHP3B1sBb0+scHBjX5lCvaeSrZryfaGKye02LFlYs=";
};
- patches = [
- # glibc-2.34 compat
- (fetchpatch {
- url = "https://raw.githubusercontent.com/gentoo/gentoo/dbb8a5c9f749cc11e61cfe558f164b165cbc30cb/mail-filter/libspf2/files/libspf2-1.2.11-undefined-dn_.patch";
- sha256 = "sha256-6JVVkVGCcFJsNeBdVTPcLhW4KoHLY4ai/KXDMliXgPA=";
- })
- ];
+ nativeBuildInputs = [ autoreconfHook ];
+ strictDeps = true;
postPatch = ''
# disable static bins compilation
@@ -28,9 +23,6 @@ stdenv.mkDerivation rec {
-e '/bin_PROGRAMS/s/spf_example_static//' src/spf_example/Makefile.am
'';
- # autoreconf necessary because we modified automake files
- nativeBuildInputs = [ autoreconfHook ];
-
doCheck = true;
meta = with lib; {
diff --git a/pkgs/development/libraries/libunarr/default.nix b/pkgs/development/libraries/libunarr/default.nix
index 1feafabfd4df..c1e0881bf3ff 100644
--- a/pkgs/development/libraries/libunarr/default.nix
+++ b/pkgs/development/libraries/libunarr/default.nix
@@ -6,11 +6,11 @@
stdenv.mkDerivation rec {
pname = "libunarr";
- version = "1.1.0";
+ version = "1.1.1";
src = fetchurl {
url = "https://github.com/selmf/unarr/releases/download/v${version}/unarr-${version}.tar.xz";
- hash = "sha256-5wCnhjoj+GTmaeDTCrUnm1Wt9SsWAbQcPSYM//FNeOA=";
+ hash = "sha256-Mo76BOqZbdOJFrEkeozxdqwpuFyvkhdONNMZmN5BdNI=";
};
postPatch = lib.optionalString stdenv.isDarwin ''
diff --git a/pkgs/development/libraries/openxr-loader/default.nix b/pkgs/development/libraries/openxr-loader/default.nix
index 1abc8a2633c6..53bfa41a8e25 100644
--- a/pkgs/development/libraries/openxr-loader/default.nix
+++ b/pkgs/development/libraries/openxr-loader/default.nix
@@ -2,13 +2,13 @@
stdenv.mkDerivation rec {
pname = "openxr-loader";
- version = "1.0.30";
+ version = "1.0.31";
src = fetchFromGitHub {
owner = "KhronosGroup";
repo = "OpenXR-SDK-Source";
rev = "release-${version}";
- sha256 = "sha256-lF8Pauyi+zSNVnpHqq86J3SGUTM6AhFmnT48eyFoYco=";
+ sha256 = "sha256-qK8l/v6nLuMAitz7DfVDjJyVjEmkeD2jgJkG5qOMCcQ=";
};
nativeBuildInputs = [ cmake python3 pkg-config ];
diff --git a/pkgs/development/libraries/science/chemistry/tblite/default.nix b/pkgs/development/libraries/science/chemistry/tblite/default.nix
index 0f05315b9d88..7cc64937dc13 100644
--- a/pkgs/development/libraries/science/chemistry/tblite/default.nix
+++ b/pkgs/development/libraries/science/chemistry/tblite/default.nix
@@ -1,6 +1,7 @@
{ stdenv
, lib
, fetchFromGitHub
+, fetchpatch
, cmake
, gfortran
, blas
@@ -26,6 +27,14 @@ stdenv.mkDerivation rec {
hash = "sha256-R7CAFG/x55k5Ieslxeq+DWq1wPip4cI+Yvn1cBbeVNs=";
};
+ patches = [
+ # toml-f 0.4 compatibility
+ (fetchpatch {
+ url = "https://github.com/tblite/tblite/commit/da759fd02b8fbf470a5c6d3df9657cca6b1d0a9a.diff";
+ hash = "sha256-VaeA2VyK+Eas432HMSpJ0lXxHBBNGpfkUO1eHeWpYl0=";
+ })
+ ];
+
nativeBuildInputs = [ cmake gfortran ];
buildInputs = [
diff --git a/pkgs/development/libraries/toml-f/default.nix b/pkgs/development/libraries/toml-f/default.nix
index d28447c40046..696e41ac71cc 100644
--- a/pkgs/development/libraries/toml-f/default.nix
+++ b/pkgs/development/libraries/toml-f/default.nix
@@ -8,13 +8,13 @@
stdenv.mkDerivation rec {
pname = "toml-f";
- version = "0.3.1";
+ version = "0.4.1";
src = fetchFromGitHub {
owner = pname;
repo = pname;
rev = "v${version}";
- hash = "sha256-8FbnUkeJUP4fiuJCroAVDo6U2M7ZkFLpG2OYrapMYtU=";
+ hash = "sha256-sCU0uMdcXIA5O964hlK37cOrLTlk1CJeTcWD9FhevOs=";
};
nativeBuildInputs = [ gfortran cmake ];
diff --git a/pkgs/development/lua-modules/generated-packages.nix b/pkgs/development/lua-modules/generated-packages.nix
index 636c411acca4..f344bd948515 100644
--- a/pkgs/development/lua-modules/generated-packages.nix
+++ b/pkgs/development/lua-modules/generated-packages.nix
@@ -478,6 +478,30 @@ buildLuarocksPackage {
};
}) {};
+ferris-nvim = callPackage({ fetchzip, buildLuarocksPackage, lua, luaOlder }:
+buildLuarocksPackage {
+ pname = "ferris.nvim";
+ version = "2.0.0-1";
+ knownRockspec = (fetchurl {
+ url = "mirror://luarocks/ferris.nvim-2.0.0-1.rockspec";
+ sha256 = "00d3x2hbs8625ky50r2w08c6idcx3bkrk0rks5qd8yh7v61nj53h";
+ }).outPath;
+ src = fetchzip {
+ url = "https://github.com/mrcjkb/ferris.nvim/archive/2.0.0.zip";
+ sha256 = "1fb18k0ylb06h4ifs9k6lfc42y74xpavzwkqy55lfdkmlbc7jmhy";
+ };
+
+ disabled = (luaOlder "5.1");
+ propagatedBuildInputs = [ lua ];
+
+ meta = {
+ homepage = "https://github.com/mrcjkb/ferris.nvim";
+ description = "Supercharge your Rust experience in Neovim! A heavily modified fork of rust-tools.nvim";
+ maintainers = with lib.maintainers; [ mrcjkb ];
+ license.fullName = "GPL-2.0";
+ };
+}) {};
+
fifo = callPackage({ fetchzip, lua, buildLuarocksPackage }:
buildLuarocksPackage {
pname = "fifo";
diff --git a/pkgs/development/node-packages/node-packages.json b/pkgs/development/node-packages/node-packages.json
index 74801b581eaa..f0e9b379f429 100644
--- a/pkgs/development/node-packages/node-packages.json
+++ b/pkgs/development/node-packages/node-packages.json
@@ -166,6 +166,7 @@
, "markdown-link-check"
, "mastodon-bot"
, "mathjax"
+, "mathjax-node-cli"
, "meat"
, "mocha"
, "multi-file-swagger"
diff --git a/pkgs/development/node-packages/node-packages.nix b/pkgs/development/node-packages/node-packages.nix
index 2035839ec0fa..2686f65e3b21 100644
--- a/pkgs/development/node-packages/node-packages.nix
+++ b/pkgs/development/node-packages/node-packages.nix
@@ -19057,6 +19057,15 @@ let
sha512 = "0yayqDxWQbqk3ojkYqUKqaAQ6AfNKeKWRNA8kR0WXzAsdHpP4BIaOmMAG87JGuO6qcobyW4GjxHd9PmhEd+T9w==";
};
};
+ "cliui-4.1.0" = {
+ name = "cliui";
+ packageName = "cliui";
+ version = "4.1.0";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/cliui/-/cliui-4.1.0.tgz";
+ sha512 = "4FG+RSG9DL7uEwRUZXZn3SS34DiDPfzP0VOiEwtUWlE+AR2EIg+hSyvrIgUUfhdgR/UkAeW2QHgeP+hWrXs7jQ==";
+ };
+ };
"cliui-5.0.0" = {
name = "cliui";
packageName = "cliui";
@@ -32416,6 +32425,15 @@ let
sha512 = "xgs2NH9AE66ucSq4cNG1nhSFghr5l6tdL15Pk+jl46bmmBapgoaY/AacXyaDznAqmGL99TiLSQgO/XazFSKYeQ==";
};
};
+ "invert-kv-2.0.0" = {
+ name = "invert-kv";
+ packageName = "invert-kv";
+ version = "2.0.0";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/invert-kv/-/invert-kv-2.0.0.tgz";
+ sha512 = "wPVv/y/QQ/Uiirj/vh3oP+1Ww+AWehmi1g5fFWGPF6IpCBCDVrhgHRMvrLfdYcwDh3QJbGXDW4JAuzxElLSqKA==";
+ };
+ };
"iota-array-1.0.0" = {
name = "iota-array";
packageName = "iota-array";
@@ -34720,6 +34738,15 @@ let
sha512 = "SdRK2C7jjs4k/kT2mwtO07KJN9RnjxtKn03d9JVj6c3j9WwaLcFYsICYDnLAzY0hp+wG2nxl+Cm2jWLiNVYb8g==";
};
};
+ "jsdom-11.12.0" = {
+ name = "jsdom";
+ packageName = "jsdom";
+ version = "11.12.0";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/jsdom/-/jsdom-11.12.0.tgz";
+ sha512 = "y8Px43oyiBM13Zc1z780FrfNLJCXTL40EWlty/LXUtcjykRBNgLlCjWXpfSPBl2iv+N7koQN+dvqszHZgT/Fjw==";
+ };
+ };
"jsdom-14.1.0" = {
name = "jsdom";
packageName = "jsdom";
@@ -35917,6 +35944,15 @@ let
sha512 = "YiGkH6EnGrDGqLMITnGjXtGmNtjoXw9SVUzcaos8RBi7Ps0VBylkq+vOcY9QE5poLasPCR849ucFUkl0UzUyOw==";
};
};
+ "lcid-2.0.0" = {
+ name = "lcid";
+ packageName = "lcid";
+ version = "2.0.0";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/lcid/-/lcid-2.0.0.tgz";
+ sha512 = "avPEb8P8EGnwXKClwsNUgryVjllcRqtMYa49NTsbQagYuT1DcXnl1915oxWjoyGrXR6zH/Y0Zc96xWsPcoDKeA==";
+ };
+ };
"ldap-filter-0.3.3" = {
name = "ldap-filter";
packageName = "ldap-filter";
@@ -35971,6 +36007,15 @@ let
sha512 = "IpSVCk9AYvLHo5ctcIXxOBpMWUe+4TKN3VPWAKUbJikkmsGp0VrSM8IttVc32D6J4WUsiPE6aEFRNmIoF/gdow==";
};
};
+ "left-pad-1.3.0" = {
+ name = "left-pad";
+ packageName = "left-pad";
+ version = "1.3.0";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/left-pad/-/left-pad-1.3.0.tgz";
+ sha512 = "XI5MPzVNApjAyhQzphX8BkmKsKUxD4LdyK24iZeQGinBN9yTQT3bFlCBy/aVx2HrNcqQGsdot8ghrjyrvMCoEA==";
+ };
+ };
"less-4.2.0" = {
name = "less";
packageName = "less";
@@ -38528,6 +38573,33 @@ let
sha512 = "rUxjysqif/BZQH2yhd5Aaq7vXMSx9NdEsQcyA07uEzIvxgI7zIr33gGsh+RU0/XjmQpCW7RsVof1vlkvQVCK5A==";
};
};
+ "mathjax-2.7.9" = {
+ name = "mathjax";
+ packageName = "mathjax";
+ version = "2.7.9";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/mathjax/-/mathjax-2.7.9.tgz";
+ sha512 = "NOGEDTIM9+MrsqnjPEjVGNx4q0GQxqm61yQwSK+/5S59i26wId5IC5gNu9/bu8+CCVl5p9G2IHcAl/wJa+5+BQ==";
+ };
+ };
+ "mathjax-node-2.1.1" = {
+ name = "mathjax-node";
+ packageName = "mathjax-node";
+ version = "2.1.1";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/mathjax-node/-/mathjax-node-2.1.1.tgz";
+ sha512 = "i29tvqD8yHPB2WhrGV5rvliYnKwTT8a/TO8SCnuYtatpSHxLGy3aF7lDTVLD6B1bfuVMTFB6McZu2TBxk0XGeg==";
+ };
+ };
+ "mathjax-node-sre-3.0.3" = {
+ name = "mathjax-node-sre";
+ packageName = "mathjax-node-sre";
+ version = "3.0.3";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/mathjax-node-sre/-/mathjax-node-sre-3.0.3.tgz";
+ sha512 = "SBwqD3DEgdYyPQv7vUBqH/uCr0eOI23PbffzmhelFPY8KdVANZkE2hssJA0Dfl23y7uEefsoVOryckMLEmmzaw==";
+ };
+ };
"mathml-tag-names-2.1.3" = {
name = "mathml-tag-names";
packageName = "mathml-tag-names";
@@ -43272,6 +43344,15 @@ let
sha512 = "PRT7ZORmwu2MEFt4/fv3Q+mEfN4zetKxufQrkShY2oGvUms9r8otu5HfdyIFHkYXjO7laNsoVGmM2MANfuTA8g==";
};
};
+ "os-locale-3.1.0" = {
+ name = "os-locale";
+ packageName = "os-locale";
+ version = "3.1.0";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/os-locale/-/os-locale-3.1.0.tgz";
+ sha512 = "Z8l3R4wYWM40/52Z+S265okfFj8Kt2cC2MKY+xNi3kFs+XGI7WXu/I309QQQYbRW4ijiZ+yxs9pqEhJh0DqW3Q==";
+ };
+ };
"os-paths-4.4.0" = {
name = "os-paths";
packageName = "os-paths";
@@ -44271,6 +44352,15 @@ let
sha512 = "rgO9Zg5LLLkfJF9E6CCmXlSE4UVceloys8JrFqCcHloC3usd/kJCyPDwH2SOlzix2j3xaP9sUX3e8+kvkuleAA==";
};
};
+ "parse5-4.0.0" = {
+ name = "parse5";
+ packageName = "parse5";
+ version = "4.0.0";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/parse5/-/parse5-4.0.0.tgz";
+ sha512 = "VrZ7eOd3T1Fk4XWNXMgiGBK/z0MG48BWG2uQNU4I72fkQuKUTZpl+u9k+CxEG0twMVzSmXEEz12z5Fnw1jIQFA==";
+ };
+ };
"parse5-5.1.0" = {
name = "parse5";
packageName = "parse5";
@@ -52254,6 +52344,15 @@ let
sha512 = "1klA3Gi5PD1Wv9Q0wUoOQN1IWAuPu0D1U03ThXTr0cJ20+/iq2tHSDnK7Kk/0LXJ1ztUB2/1Os0wKmfyNgUQfg==";
};
};
+ "speech-rule-engine-2.4.0" = {
+ name = "speech-rule-engine";
+ packageName = "speech-rule-engine";
+ version = "2.4.0";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/speech-rule-engine/-/speech-rule-engine-2.4.0.tgz";
+ sha512 = "7IXDmpGiQOJWUPVy/rcayqi1aTCrhcQ/bVACu2oyueEuiYzPW8GebYRF4LeyMROL/E0kxkO5U66t0aFWCv0QCQ==";
+ };
+ };
"speed-limiter-1.0.2" = {
name = "speed-limiter";
packageName = "speed-limiter";
@@ -59455,6 +59554,15 @@ let
sha512 = "saE57nupxk6v3HY35+jzBwYa0rKSy0XR8JSxZPwgLr7ys0IBzhGviA1/TUGJLmSVqs8pb9AnvICXEuOHLprYTw==";
};
};
+ "whatwg-url-6.5.0" = {
+ name = "whatwg-url";
+ packageName = "whatwg-url";
+ version = "6.5.0";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/whatwg-url/-/whatwg-url-6.5.0.tgz";
+ sha512 = "rhRZRqx/TLJQWUpQ6bmrt2UV4f0HCQ463yQuONJqC6fO2VoEb1pTYddbe59SkYq87aoM5A3bdhMZiUiVws+fzQ==";
+ };
+ };
"whatwg-url-7.1.0" = {
name = "whatwg-url";
packageName = "whatwg-url";
@@ -59590,6 +59698,15 @@ let
sha512 = "qe9UWWpkeG5yzZ0tNYxDmd7vo58HDBc39mZ0xWWpolAGADdFOzkfamWLDxkOWcvHQKVmdTyQdLD4NOfjLWTKew==";
};
};
+ "wicked-good-xpath-1.3.0" = {
+ name = "wicked-good-xpath";
+ packageName = "wicked-good-xpath";
+ version = "1.3.0";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/wicked-good-xpath/-/wicked-good-xpath-1.3.0.tgz";
+ sha512 = "Gd9+TUn5nXdwj/hFsPVx5cuHHiF5Bwuc30jZ4+ronF1qHK5O7HD0sgmXWSEgwKquT3ClLoKPVbO6qGwVwLzvAw==";
+ };
+ };
"wide-align-1.1.5" = {
name = "wide-align";
packageName = "wide-align";
@@ -60094,6 +60211,15 @@ let
sha512 = "61a+9LgtYZxTq1hAonhX8Xwpo2riK4IOR/BIVxioFbCfc3QFKmpE4x9dLExfLHKtUfVZigYa36tThVhO57erEw==";
};
};
+ "ws-5.2.3" = {
+ name = "ws";
+ packageName = "ws";
+ version = "5.2.3";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/ws/-/ws-5.2.3.tgz";
+ sha512 = "jZArVERrMsKUatIdnLzqvcfydI85dvd/Fp1u/VOpfdDWQ4c9qWXe+VIeAbQ5FrDwciAkr+lzofXLz3Kuf26AOA==";
+ };
+ };
"ws-6.1.4" = {
name = "ws";
packageName = "ws";
@@ -60472,6 +60598,15 @@ let
sha512 = "yS2uJflVQs6n+CyjHoaBmVSqIDevTAWrzMmjG1Gc7h1qQ7uVozNhEPJAwZXWyGQ/Gafo3fCwrcaokezLPupVyQ==";
};
};
+ "xmldom-sre-0.1.31" = {
+ name = "xmldom-sre";
+ packageName = "xmldom-sre";
+ version = "0.1.31";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/xmldom-sre/-/xmldom-sre-0.1.31.tgz";
+ sha512 = "f9s+fUkX04BxQf+7mMWAp5zk61pciie+fFLC9hX9UVvCeJQfNHRHXpeo5MPcR0EUf57PYLdt+ZO4f3Ipk2oZUw==";
+ };
+ };
"xmlhttprequest-https://github.com/LearnBoost/node-XMLHttpRequest/archive/0f36d0b5ebc03d85f860d42a64ae9791e1daa433.tar.gz" = {
name = "xmlhttprequest";
packageName = "xmlhttprequest";
@@ -60680,6 +60815,15 @@ let
sha512 = "C/FsVVhht4iPQYXOInoxUM/1ELSf9EsgKH34FofQOp6hwCPrW4vG4w5++TED3xRUo8gD7l0P1J1dLlDYzODsTQ==";
};
};
+ "yargs-12.0.5" = {
+ name = "yargs";
+ packageName = "yargs";
+ version = "12.0.5";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/yargs/-/yargs-12.0.5.tgz";
+ sha512 = "Lhz8TLaYnxq/2ObqHDql8dX8CJi97oHxrjUcYtzKbbykPtVW9WB+poxI+NM2UIzsMgNCZTIf0AQwsjK5yMAqZw==";
+ };
+ };
"yargs-13.3.2" = {
name = "yargs";
packageName = "yargs";
@@ -60788,6 +60932,15 @@ let
sha512 = "VCIyR1wJoEBZUqk5PA+oOBF6ypbwh5aNB3I50guxAL/quggdfs4TtNHQrSazFA3fYZ+tEqfs0zIGlv0c/rgjbQ==";
};
};
+ "yargs-parser-11.1.1" = {
+ name = "yargs-parser";
+ packageName = "yargs-parser";
+ version = "11.1.1";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/yargs-parser/-/yargs-parser-11.1.1.tgz";
+ sha512 = "C6kB/WJDiaxONLJQnF8ccx9SEeoTTLek8RVbaOIsrAUS8VrBEXfmeSnCZxygc+XC2sNMBIwOOnfcxiynjHsVSQ==";
+ };
+ };
"yargs-parser-13.1.2" = {
name = "yargs-parser";
packageName = "yargs-parser";
@@ -86065,6 +86218,212 @@ in
bypassCache = true;
reconstructLock = true;
};
+ mathjax-node-cli = nodeEnv.buildNodePackage {
+ name = "mathjax-node-cli";
+ packageName = "mathjax-node-cli";
+ version = "1.0.1";
+ src = fetchurl {
+ url = "https://registry.npmjs.org/mathjax-node-cli/-/mathjax-node-cli-1.0.1.tgz";
+ sha512 = "p1OB9zalQZkKYumfx+8mSX59MysF2Ox2H88gHSUQpdjpuMISwIPfw0MQmsvcS00hntSX05uEDa3uzo+1SgSk5w==";
+ };
+ dependencies = [
+ sources."abab-2.0.6"
+ sources."acorn-5.7.4"
+ (sources."acorn-globals-4.3.4" // {
+ dependencies = [
+ sources."acorn-6.4.2"
+ ];
+ })
+ sources."acorn-walk-6.2.0"
+ sources."ajv-6.12.6"
+ sources."ansi-regex-3.0.1"
+ sources."ansi-styles-4.3.0"
+ sources."array-equal-1.0.0"
+ sources."asn1-0.2.6"
+ sources."assert-plus-1.0.0"
+ sources."async-limiter-1.0.1"
+ sources."asynckit-0.4.0"
+ sources."aws-sign2-0.7.0"
+ sources."aws4-1.12.0"
+ sources."bcrypt-pbkdf-1.0.2"
+ sources."browser-process-hrtime-1.0.0"
+ sources."camelcase-5.3.1"
+ sources."caseless-0.12.0"
+ sources."cliui-4.1.0"
+ sources."code-point-at-1.1.0"
+ sources."color-convert-2.0.1"
+ sources."color-name-1.1.4"
+ sources."combined-stream-1.0.8"
+ sources."commander-11.0.0"
+ sources."core-util-is-1.0.2"
+ sources."cross-spawn-6.0.5"
+ sources."cssom-0.3.8"
+ sources."cssstyle-1.4.0"
+ sources."dashdash-1.14.1"
+ (sources."data-urls-1.1.0" // {
+ dependencies = [
+ sources."whatwg-url-7.1.0"
+ ];
+ })
+ sources."decamelize-1.2.0"
+ sources."deep-is-0.1.4"
+ sources."delayed-stream-1.0.0"
+ sources."domexception-1.0.1"
+ sources."ecc-jsbn-0.1.2"
+ sources."emoji-regex-8.0.0"
+ sources."end-of-stream-1.4.4"
+ sources."escalade-3.1.1"
+ sources."escodegen-1.14.3"
+ sources."esprima-4.0.1"
+ sources."estraverse-4.3.0"
+ sources."esutils-2.0.3"
+ sources."execa-1.0.0"
+ sources."extend-3.0.2"
+ sources."extsprintf-1.3.0"
+ sources."fast-deep-equal-3.1.3"
+ sources."fast-json-stable-stringify-2.1.0"
+ sources."fast-levenshtein-2.0.6"
+ sources."find-up-3.0.0"
+ sources."forever-agent-0.6.1"
+ sources."form-data-2.3.3"
+ sources."get-caller-file-1.0.3"
+ sources."get-stream-4.1.0"
+ sources."getpass-0.1.7"
+ sources."har-schema-2.0.0"
+ sources."har-validator-5.1.5"
+ sources."html-encoding-sniffer-1.0.2"
+ sources."http-signature-1.2.0"
+ sources."iconv-lite-0.4.24"
+ sources."invert-kv-2.0.0"
+ sources."is-fullwidth-code-point-2.0.0"
+ sources."is-stream-1.1.0"
+ sources."is-typedarray-1.0.0"
+ sources."isexe-2.0.0"
+ sources."isstream-0.1.2"
+ sources."jsbn-0.1.1"
+ sources."jsdom-11.12.0"
+ sources."json-schema-0.4.0"
+ sources."json-schema-traverse-0.4.1"
+ sources."json-stringify-safe-5.0.1"
+ sources."jsprim-1.4.2"
+ sources."lcid-2.0.0"
+ sources."left-pad-1.3.0"
+ sources."levn-0.3.0"
+ sources."locate-path-3.0.0"
+ sources."lodash-4.17.21"
+ sources."lodash.sortby-4.7.0"
+ sources."map-age-cleaner-0.1.3"
+ sources."mathjax-2.7.9"
+ sources."mathjax-node-2.1.1"
+ (sources."mathjax-node-sre-3.0.3" // {
+ dependencies = [
+ sources."yargs-12.0.5"
+ ];
+ })
+ sources."mem-4.3.0"
+ sources."mime-db-1.52.0"
+ sources."mime-types-2.1.35"
+ sources."mimic-fn-2.1.0"
+ sources."nice-try-1.0.5"
+ sources."npm-run-path-2.0.2"
+ sources."number-is-nan-1.0.1"
+ sources."nwsapi-2.2.7"
+ sources."oauth-sign-0.9.0"
+ sources."once-1.4.0"
+ sources."optionator-0.8.3"
+ sources."os-locale-3.1.0"
+ sources."p-defer-1.0.0"
+ sources."p-finally-1.0.0"
+ sources."p-is-promise-2.1.0"
+ sources."p-limit-2.3.0"
+ sources."p-locate-3.0.0"
+ sources."p-try-2.2.0"
+ sources."parse5-4.0.0"
+ sources."path-exists-3.0.0"
+ sources."path-key-2.0.1"
+ sources."performance-now-2.1.0"
+ sources."pn-1.1.0"
+ sources."prelude-ls-1.1.2"
+ sources."psl-1.9.0"
+ sources."pump-3.0.0"
+ sources."punycode-2.3.0"
+ sources."qs-6.5.3"
+ sources."request-2.88.2"
+ sources."request-promise-core-1.1.4"
+ sources."request-promise-native-1.0.9"
+ sources."require-directory-2.1.1"
+ sources."require-main-filename-1.0.1"
+ sources."safe-buffer-5.2.1"
+ sources."safer-buffer-2.1.2"
+ sources."sax-1.3.0"
+ sources."semver-5.7.2"
+ sources."set-blocking-2.0.0"
+ sources."shebang-command-1.2.0"
+ sources."shebang-regex-1.0.0"
+ sources."signal-exit-3.0.7"
+ sources."source-map-0.6.1"
+ sources."speech-rule-engine-2.4.0"
+ sources."sshpk-1.17.0"
+ sources."stealthy-require-1.1.1"
+ sources."string-width-2.1.1"
+ sources."strip-ansi-4.0.0"
+ sources."strip-eof-1.0.0"
+ sources."symbol-tree-3.2.4"
+ sources."tough-cookie-2.5.0"
+ sources."tr46-1.0.1"
+ sources."tunnel-agent-0.6.0"
+ sources."tweetnacl-0.14.5"
+ sources."type-check-0.3.2"
+ sources."uri-js-4.4.1"
+ sources."uuid-3.4.0"
+ sources."verror-1.10.0"
+ sources."w3c-hr-time-1.0.2"
+ sources."webidl-conversions-4.0.2"
+ sources."whatwg-encoding-1.0.5"
+ sources."whatwg-mimetype-2.3.0"
+ sources."whatwg-url-6.5.0"
+ sources."which-1.3.1"
+ sources."which-module-2.0.1"
+ sources."wicked-good-xpath-1.3.0"
+ sources."word-wrap-1.2.5"
+ (sources."wrap-ansi-2.1.0" // {
+ dependencies = [
+ sources."ansi-regex-2.1.1"
+ sources."is-fullwidth-code-point-1.0.0"
+ sources."string-width-1.0.2"
+ sources."strip-ansi-3.0.1"
+ ];
+ })
+ sources."wrappy-1.0.2"
+ sources."ws-5.2.3"
+ sources."xml-name-validator-3.0.0"
+ sources."xmldom-sre-0.1.31"
+ sources."y18n-4.0.3"
+ (sources."yargs-17.7.2" // {
+ dependencies = [
+ sources."ansi-regex-5.0.1"
+ sources."cliui-8.0.1"
+ sources."get-caller-file-2.0.5"
+ sources."is-fullwidth-code-point-3.0.0"
+ sources."string-width-4.2.3"
+ sources."strip-ansi-6.0.1"
+ sources."wrap-ansi-7.0.0"
+ sources."y18n-5.0.8"
+ sources."yargs-parser-21.1.1"
+ ];
+ })
+ sources."yargs-parser-11.1.1"
+ ];
+ buildInputs = globalBuildInputs;
+ meta = {
+ description = "CLI tools for calling mathjax-node";
+ homepage = "https://github.com/mathjax/mathjax-node-cli#readme";
+ license = "Apache-2.0";
+ };
+ production = true;
+ bypassCache = true;
+ reconstructLock = true;
+ };
meat = nodeEnv.buildNodePackage {
name = "meat";
packageName = "meat";
diff --git a/pkgs/development/php-packages/grumphp/composer-json.patch b/pkgs/development/php-packages/grumphp/composer-json.patch
new file mode 100644
index 000000000000..7fd7441612cc
--- /dev/null
+++ b/pkgs/development/php-packages/grumphp/composer-json.patch
@@ -0,0 +1,27 @@
+From 2f53794374e0d32e1f322202c6668655792f745d Mon Sep 17 00:00:00 2001
+From: Pol Dellaiera
+Date: Sat, 21 Oct 2023 16:46:59 +0200
+Subject: [PATCH] composer.json
+
+---
+ composer.json | 5 +-
+ 1 file changed, 4 insertion(+), 1 deletion(-)
+
+diff --git i/composer.json w/composer.json
+index 6ac54420..69b75a51 100644
+--- i/composer.json
++++ w/composer.json
+@@ -96,7 +96,10 @@
+ "bin/grumphp"
+ ],
+ "config": {
+- "sort-packages": true
++ "sort-packages": true,
++ "platform": {
++ "php": "8.1"
++ }
+ },
+ "extra": {
+ "class": "GrumPHP\\Composer\\GrumPHPPlugin"
+--
+2.42.0
diff --git a/pkgs/development/php-packages/grumphp/composer-lock.patch b/pkgs/development/php-packages/grumphp/composer-lock.patch
new file mode 100644
index 000000000000..2fc801557c4f
--- /dev/null
+++ b/pkgs/development/php-packages/grumphp/composer-lock.patch
@@ -0,0 +1,24 @@
+From 2f53794374e0d32e1f322202c6668655792f745d Mon Sep 17 00:00:00 2001
+From: Pol Dellaiera
+Date: Sat, 21 Oct 2023 16:46:59 +0200
+Subject: [PATCH] composer.lock
+
+---
+ phar.composer.lock | 2 +-
+ 1 file changed, 1 insertion(+), 1 deletion(-)
+
+diff --git a/phar.composer.lock b/phar.composer.lock
+index 96b692c3..a8cb2a87 100644
+--- a/phar.composer.lock
++++ b/phar.composer.lock
+@@ -4,7 +4,7 @@
+ "Read more about it at https://getcomposer.org/doc/01-basic-usage.md#installing-dependencies",
+ "This file is @generated automatically"
+ ],
+- "content-hash": "8a069c630e6ddbc4475db9a992430539",
++ "content-hash": "0474062650b24a22c63007631cf35f1e",
+ "packages": [
+ {
+ "name": "amphp/amp",
+--
+2.42.0
diff --git a/pkgs/development/php-packages/grumphp/default.nix b/pkgs/development/php-packages/grumphp/default.nix
index c7c2d9fc323e..6367dd996bf2 100644
--- a/pkgs/development/php-packages/grumphp/default.nix
+++ b/pkgs/development/php-packages/grumphp/default.nix
@@ -1,32 +1,48 @@
-{ mkDerivation, fetchurl, makeWrapper, lib, php }:
+{ fetchFromGitHub, stdenvNoCC, lib, php }:
-mkDerivation (finalAttrs: {
+php.buildComposerProject (finalAttrs: {
pname = "grumphp";
- version = "1.15.0";
+ version = "2.1.0";
- src = fetchurl {
- url = "https://github.com/phpro/grumphp/releases/download/v${finalAttrs.version}/grumphp.phar";
- sha256 = "sha256-EqzJb7DYZb7PnebErLVI/EZLxj0m26cniZlsu1feif0=";
+ src = fetchFromGitHub {
+ owner = "phpro";
+ repo = "grumphp";
+ rev = "v${finalAttrs.version}";
+ hash = "sha256-RVgreCspdz+A6mdE2H4i8ajmdH8AZ9BOIw2OqLw7HfI=";
};
- dontUnpack = true;
+ patches = [
+ ./composer-json.patch
+ ];
- nativeBuildInputs = [ makeWrapper ];
+ composerLock = stdenvNoCC.mkDerivation (finalComposerLockAttrs: {
+ name = "grumphp-composer-lock";
- installPhase = ''
- runHook preInstall
- mkdir -p $out/bin
- install -D $src $out/libexec/grumphp/grumphp.phar
- makeWrapper ${php}/bin/php $out/bin/grumphp \
- --add-flags "$out/libexec/grumphp/grumphp.phar"
- runHook postInstall
- '';
+ src = fetchFromGitHub {
+ owner = "phpro";
+ repo = "grumphp-shim";
+ rev = "v${finalAttrs.version}";
+ hash = "sha256-JxgRd0p/o3ouZ4MPke8cHqvAPuepY8ax0wx4t8+2dME=";
+ };
- meta = with lib; {
+ patches = [
+ ./composer-lock.patch
+ ];
+
+ installPhase = ''
+ runHook preInstall
+ cp phar.composer.lock $out
+ runHook postInstall
+ '';
+ });
+
+ vendorHash = "sha256-yefamPAzIabDCzZ9ghKq9iPH7AoCdgCCQ8PKrUN9ifQ=";
+
+ meta = {
changelog = "https://github.com/phpro/grumphp/releases/tag/v${finalAttrs.version}";
description = "A PHP code-quality tool";
homepage = "https://github.com/phpro/grumphp";
- license = licenses.mit;
- maintainers = teams.php.members;
+ license = lib.licenses.mit;
+ maintainers = lib.teams.php.members;
};
})
diff --git a/pkgs/development/python-modules/aioairzone-cloud/default.nix b/pkgs/development/python-modules/aioairzone-cloud/default.nix
index bdc21d70892f..2108555b0d33 100644
--- a/pkgs/development/python-modules/aioairzone-cloud/default.nix
+++ b/pkgs/development/python-modules/aioairzone-cloud/default.nix
@@ -9,7 +9,7 @@
buildPythonPackage rec {
pname = "aioairzone-cloud";
- version = "0.2.4";
+ version = "0.2.7";
format = "pyproject";
disabled = pythonOlder "3.7";
@@ -18,7 +18,7 @@ buildPythonPackage rec {
owner = "Noltari";
repo = "aioairzone-cloud";
rev = "refs/tags/${version}";
- hash = "sha256-7sjiY20jDUHtEnqAMwEHsBboK9XCH5XjE0sHR82YvEA=";
+ hash = "sha256-v6cK4j16BhTqjdc5J9XQWGFCa1r9f0/dto9teVTNn0c=";
};
nativeBuildInputs = [
diff --git a/pkgs/development/python-modules/aioairzone/default.nix b/pkgs/development/python-modules/aioairzone/default.nix
index ac094571d087..39c12ac6e2c0 100644
--- a/pkgs/development/python-modules/aioairzone/default.nix
+++ b/pkgs/development/python-modules/aioairzone/default.nix
@@ -8,7 +8,7 @@
buildPythonPackage rec {
pname = "aioairzone";
- version = "0.6.8";
+ version = "0.6.9";
format = "pyproject";
disabled = pythonOlder "3.11";
@@ -17,7 +17,7 @@ buildPythonPackage rec {
owner = "Noltari";
repo = pname;
rev = "refs/tags/${version}";
- hash = "sha256-aCf0IO70t/QMmDmIwBKN3Um1HgHjHn1r6Dze/pWaQ5M=";
+ hash = "sha256-0nbH0pnTYRuSOkzG5Yn/fJmRKtXBMd6ti6Z+AW72j3Q=";
};
nativeBuildInputs = [
diff --git a/pkgs/development/python-modules/aioelectricitymaps/default.nix b/pkgs/development/python-modules/aioelectricitymaps/default.nix
new file mode 100644
index 000000000000..502363de13c3
--- /dev/null
+++ b/pkgs/development/python-modules/aioelectricitymaps/default.nix
@@ -0,0 +1,55 @@
+{ lib
+, aiohttp
+, aresponses
+, buildPythonPackage
+, dataclasses-json
+, fetchFromGitHub
+, poetry-core
+, pytest-asyncio
+, pytestCheckHook
+, pythonOlder
+, syrupy
+}:
+
+buildPythonPackage rec {
+ pname = "aioelectricitymaps";
+ version = "0.1.3";
+ pyproject = true;
+
+ disabled = pythonOlder "3.10";
+
+ src = fetchFromGitHub {
+ owner = "jpbede";
+ repo = "aioelectricitymaps";
+ rev = "refs/tags/v${version}";
+ hash = "sha256-2Ou3obpGRJ/iUPuaoBGlmDTJLx6+S8ivK9PbrbSvYyg=";
+ };
+
+ nativeBuildInputs = [
+ poetry-core
+ ];
+
+ propagatedBuildInputs = [
+ aiohttp
+ dataclasses-json
+ ];
+
+ nativeCheckInputs = [
+ aresponses
+ pytest-asyncio
+ pytestCheckHook
+ syrupy
+ ];
+
+ pythonImportsCheck = [
+ "aioelectricitymaps"
+ ];
+
+ meta = with lib; {
+ description = "Module for interacting with Electricity maps";
+ homepage = "https://github.com/jpbede/aioelectricitymaps";
+ changelog = "https://github.com/jpbede/aioelectricitymaps/releases/tag/v${version}";
+ license = licenses.mit;
+ maintainers = with maintainers; [ fab ];
+ };
+}
diff --git a/pkgs/development/python-modules/aioesphomeapi/default.nix b/pkgs/development/python-modules/aioesphomeapi/default.nix
index 79ef028fd36e..c77a4dfadda5 100644
--- a/pkgs/development/python-modules/aioesphomeapi/default.nix
+++ b/pkgs/development/python-modules/aioesphomeapi/default.nix
@@ -14,7 +14,7 @@
buildPythonPackage rec {
pname = "aioesphomeapi";
- version = "17.2.0";
+ version = "18.0.7";
format = "setuptools";
disabled = pythonOlder "3.9";
@@ -23,7 +23,7 @@ buildPythonPackage rec {
owner = "esphome";
repo = pname;
rev = "refs/tags/v${version}";
- hash = "sha256-+yPHIXJ0vHaFO2X3xN+7WIQUlCvoYlGi1N7W+H/ng/0=";
+ hash = "sha256-Jgu9NEFY74Z0mZ2Cz4uaHG0gfywa2nF/H8G1j9YAyrw=";
};
propagatedBuildInputs = [
diff --git a/pkgs/development/python-modules/async-upnp-client/default.nix b/pkgs/development/python-modules/async-upnp-client/default.nix
index 03b7e8664c46..c51c99d00f0b 100644
--- a/pkgs/development/python-modules/async-upnp-client/default.nix
+++ b/pkgs/development/python-modules/async-upnp-client/default.nix
@@ -15,7 +15,7 @@
buildPythonPackage rec {
pname = "async-upnp-client";
- version = "0.36.1";
+ version = "0.36.2";
format = "setuptools";
disabled = pythonOlder "3.8";
@@ -24,7 +24,7 @@ buildPythonPackage rec {
owner = "StevenLooman";
repo = "async_upnp_client";
rev = "refs/tags/${version}";
- hash = "sha256-NFSJlBRVgeuhK7IXjNz2g6SbSgveSjaJpSQrxSACG04=";
+ hash = "sha256-f3x5adxLHT/C5dXfdBH6stKv0y2nuhbpe8jkJex1DKU=";
};
propagatedBuildInputs = [
diff --git a/pkgs/development/python-modules/asyncwhois/default.nix b/pkgs/development/python-modules/asyncwhois/default.nix
index 25cb21e7e246..e462a0d0b49c 100644
--- a/pkgs/development/python-modules/asyncwhois/default.nix
+++ b/pkgs/development/python-modules/asyncwhois/default.nix
@@ -12,7 +12,7 @@
buildPythonPackage rec {
pname = "asyncwhois";
- version = "1.0.8";
+ version = "1.0.9";
format = "setuptools";
disabled = pythonOlder "3.7";
@@ -21,7 +21,7 @@ buildPythonPackage rec {
owner = "pogzyb";
repo = "asyncwhois";
rev = "refs/tags/v${version}";
- hash = "sha256-fYXxoS4bGTat5QT98ETmWk/VKXJmg9mtkUu02SZT4Eo=";
+ hash = "sha256-5T/h4YzODH7zFyQpG8qVZetTK7V+Ii9jc+MQFgMUA8w=";
};
propagatedBuildInputs = [
diff --git a/pkgs/development/python-modules/bimmer-connected/default.nix b/pkgs/development/python-modules/bimmer-connected/default.nix
index 40f7ad7cf8ab..470eaf376a77 100644
--- a/pkgs/development/python-modules/bimmer-connected/default.nix
+++ b/pkgs/development/python-modules/bimmer-connected/default.nix
@@ -17,7 +17,7 @@
buildPythonPackage rec {
pname = "bimmer-connected";
- version = "0.14.1";
+ version = "0.14.2";
format = "setuptools";
disabled = pythonOlder "3.6";
@@ -26,7 +26,7 @@ buildPythonPackage rec {
owner = "bimmerconnected";
repo = "bimmer_connected";
rev = "refs/tags/${version}";
- hash = "sha256-Fo30qDBqVxVuD/Ow0jsvN20Hx7Zhvie47CE+1ys1ewU=";
+ hash = "sha256-69H0hB+yVmyzJ5A2Cb7ZcaaoRzMt618U+TUHYQ03/cY=";
};
nativeBuildInputs = [
diff --git a/pkgs/development/python-modules/bleak/default.nix b/pkgs/development/python-modules/bleak/default.nix
index 61a069305d13..f53f614867ec 100644
--- a/pkgs/development/python-modules/bleak/default.nix
+++ b/pkgs/development/python-modules/bleak/default.nix
@@ -25,6 +25,12 @@ buildPythonPackage rec {
hash = "sha256-T0im8zKyNLbskAEDeUUFS/daJtvttlHlttjscqP8iSk=";
};
+ postPatch = ''
+ # bleak checks BlueZ's version with a call to `bluetoothctl --version`
+ substituteInPlace bleak/backends/bluezdbus/version.py \
+ --replace \"bluetoothctl\" \"${bluez}/bin/bluetoothctl\"
+ '';
+
nativeBuildInputs = [
poetry-core
];
@@ -40,12 +46,6 @@ buildPythonPackage rec {
pytestCheckHook
];
- postPatch = ''
- # bleak checks BlueZ's version with a call to `bluetoothctl --version`
- substituteInPlace bleak/backends/bluezdbus/__init__.py \
- --replace \"bluetoothctl\" \"${bluez}/bin/bluetoothctl\"
- '';
-
pythonImportsCheck = [
"bleak"
];
diff --git a/pkgs/development/python-modules/blinkstick/default.nix b/pkgs/development/python-modules/blinkstick/default.nix
index d3de7561bec2..bafd5254b968 100644
--- a/pkgs/development/python-modules/blinkstick/default.nix
+++ b/pkgs/development/python-modules/blinkstick/default.nix
@@ -1,35 +1,27 @@
-{ lib
-, buildPythonPackage
-, fetchPypi
-, pyusb
-}:
+{ lib, buildPythonPackage, fetchFromGitHub, pyusb }:
buildPythonPackage rec {
pname = "blinkstick";
- version = "1.2.0";
+ version = "unstable-2023-05-04";
+ format = "setuptools";
- src = fetchPypi {
- inherit pname version;
- sha256 = "0rdk3i81s6byw23za0bxvkh7sj5l16qxxgc2c53qjg3klc24wcm9";
+ src = fetchFromGitHub {
+ owner = "arvydas";
+ repo = "blinkstick-python";
+ rev = "8140b9fa18a9ff4f0e9df8e70c073f41cb8f1d35";
+ hash = "sha256-9bc7TD/Ilc952ywLauFd0+3Lh64lQlYuDC1KG9eWDgs=";
};
- # Upstream fix https://github.com/arvydas/blinkstick-python/pull/54
- # https://github.com/arvydas/blinkstick-python/pull/54/commits/b9bee2cd72f799f1210e5d9e13207f93bbc2d244.patch
- # has line ending issues after 1.2.0
- postPatch = ''
- substituteInPlace setup.py --replace "pyusb==1.0.0" "pyusb>=1.0.0"
- '';
-
propagatedBuildInputs = [ pyusb ];
# Project has no tests
doCheck = false;
pythonImportsCheck = [ "blinkstick" ];
- meta = with lib; {
+ meta = {
description = "Python package to control BlinkStick USB devices";
homepage = "https://github.com/arvydas/blinkstick-python";
- license = licenses.bsd3;
- maintainers = with maintainers; [ np ];
+ license = lib.licenses.bsd3;
+ maintainers = with lib.maintainers; [ np perstark ];
};
}
diff --git a/pkgs/development/python-modules/cantools/default.nix b/pkgs/development/python-modules/cantools/default.nix
new file mode 100644
index 000000000000..3cb260dd8d1b
--- /dev/null
+++ b/pkgs/development/python-modules/cantools/default.nix
@@ -0,0 +1,58 @@
+{ lib
+, buildPythonPackage
+, fetchPypi
+, setuptools-scm
+, argparse-addons
+, bitstruct
+, can
+, crccheck
+, diskcache
+, matplotlib
+, parameterized
+, pytestCheckHook
+, pythonOlder
+, textparser
+}:
+
+buildPythonPackage rec {
+ pname = "cantools";
+ version = "38.0.2";
+ format = "setuptools";
+
+ disabled = pythonOlder "3.7";
+
+ src = fetchPypi {
+ inherit pname version;
+ hash = "sha256-k7/m9L1lLzaXY+qRYrAnpi9CSoQA8kI9QRN5GM5oxo4=";
+ };
+
+ nativeBuildInputs = [
+ setuptools-scm
+ ];
+
+ propagatedBuildInputs = [
+ argparse-addons
+ bitstruct
+ can
+ crccheck
+ diskcache
+ matplotlib
+ textparser
+ ];
+
+ nativeCheckInputs = [
+ parameterized
+ pytestCheckHook
+ ];
+
+ pythonImportsCheck = [
+ "cantools"
+ ];
+
+ meta = with lib; {
+ homepage = "https://github.com/cantools/cantools";
+ description = "CAN bus tools.";
+ license = licenses.mit;
+ maintainers = with maintainers; [ gray-heron ];
+ };
+}
diff --git a/pkgs/development/python-modules/dbus-fast/default.nix b/pkgs/development/python-modules/dbus-fast/default.nix
index b5d2ce8eef71..4394271f7ebd 100644
--- a/pkgs/development/python-modules/dbus-fast/default.nix
+++ b/pkgs/development/python-modules/dbus-fast/default.nix
@@ -13,7 +13,7 @@
buildPythonPackage rec {
pname = "dbus-fast";
- version = "2.11.1";
+ version = "2.12.0";
format = "pyproject";
disabled = pythonOlder "3.7";
@@ -22,7 +22,7 @@ buildPythonPackage rec {
owner = "Bluetooth-Devices";
repo = pname;
rev = "refs/tags/v${version}";
- hash = "sha256-oYBk+Rko5qK1k2TJdDNiN0rWdx7sdy6UpxMlDynKZ9Y=";
+ hash = "sha256-ZeDQn+/b6WBCodZ7Ow5IlC9XlWieAifCMJtM1yse5P8=";
};
# The project can build both an optimized cython version and an unoptimized
diff --git a/pkgs/development/python-modules/duckdb/default.nix b/pkgs/development/python-modules/duckdb/default.nix
index e9aac74d835e..5ff995684992 100644
--- a/pkgs/development/python-modules/duckdb/default.nix
+++ b/pkgs/development/python-modules/duckdb/default.nix
@@ -13,17 +13,19 @@
}:
buildPythonPackage rec {
- inherit (duckdb) pname version src patches;
+ inherit (duckdb) pname version src;
format = "setuptools";
- postPatch = ''
+ # 1. let nix control build cores
+ # 2. default to extension autoload & autoinstall disabled
+ # 3. unconstrain setuptools_scm version
+ patches = (duckdb.patches or []) ++ [ ./setup.patch ];
+
+ postPatch = (duckdb.postPatch or "") + ''
# we can't use sourceRoot otherwise patches don't apply, because the patches apply to the C++ library
cd tools/pythonpkg
- # 1. let nix control build cores
- # 2. unconstrain setuptools_scm version
- substituteInPlace setup.py \
- --replace "multiprocessing.cpu_count()" "$NIX_BUILD_CORES"
+ substituteInPlace setup.py --subst-var NIX_BUILD_CORES
# avoid dependency on mypy
rm tests/stubs/test_stubs.py
@@ -54,6 +56,8 @@ buildPythonPackage rec {
disabledTests = [
# tries to make http request
"test_install_non_existent_extension"
+ # test is racy and interrupt can be delivered before or after target point
+ "test_connection_interrupt"
];
preCheck = ''
diff --git a/pkgs/development/python-modules/duckdb/setup.patch b/pkgs/development/python-modules/duckdb/setup.patch
new file mode 100644
index 000000000000..8c8f790a66a1
--- /dev/null
+++ b/pkgs/development/python-modules/duckdb/setup.patch
@@ -0,0 +1,30 @@
+diff --git a/tools/pythonpkg/setup.py b/tools/pythonpkg/setup.py
+index 30f1e1ccdd..6784169fcb 100644
+--- a/tools/pythonpkg/setup.py
++++ b/tools/pythonpkg/setup.py
+@@ -96,7 +96,7 @@ def parallel_cpp_compile(
+ return
+ self._compile(obj, src, ext, cc_args, extra_postargs, pp_opts)
+
+- list(multiprocessing.pool.ThreadPool(multiprocessing.cpu_count()).imap(_single_compile, objects))
++ list(multiprocessing.pool.ThreadPool(@NIX_BUILD_CORES@).imap(_single_compile, objects))
+ return objects
+
+
+@@ -163,7 +163,6 @@ if 'BUILD_HTTPFS' in os.environ:
+ for ext in extensions:
+ toolchain_args.extend(['-DDUCKDB_EXTENSION_{}_LINKED'.format(ext.upper())])
+
+-toolchain_args.extend(['-DDUCKDB_EXTENSION_AUTOLOAD_DEFAULT=1', '-DDUCKDB_EXTENSION_AUTOINSTALL_DEFAULT=1'])
+
+
+ class get_pybind_include(object):
+@@ -348,7 +347,7 @@ setup(
+ packages=packages,
+ include_package_data=True,
+ python_requires='>=3.7.0',
+- setup_requires=setup_requires + ["setuptools_scm<7.0.0", 'pybind11>=2.6.0'],
++ setup_requires=setup_requires + ["setuptools_scm", 'pybind11>=2.6.0'],
+ use_scm_version=setuptools_scm_conf,
+ tests_require=['google-cloud-storage', 'mypy', 'pytest'],
+ classifiers=[
diff --git a/pkgs/development/python-modules/elgato/default.nix b/pkgs/development/python-modules/elgato/default.nix
index 92b4cad66b5c..3aeab819b76a 100644
--- a/pkgs/development/python-modules/elgato/default.nix
+++ b/pkgs/development/python-modules/elgato/default.nix
@@ -13,18 +13,25 @@
buildPythonPackage rec {
pname = "elgato";
- version = "4.0.1";
+ version = "5.0.0";
format = "pyproject";
- disabled = pythonOlder "3.9";
+ disabled = pythonOlder "3.11";
src = fetchFromGitHub {
owner = "frenck";
repo = "python-elgato";
rev = "refs/tags/v${version}";
- hash = "sha256-kyFnc/lMxgYy8s/gAP5vpEPV8a+dphOummr6G7deGQ4=";
+ hash = "sha256-TI5wu2FYVUMvgDkbktcwPLnTSD8XUSy8qwOCdrsiopk=";
};
+ postPatch = ''
+ # Upstream doesn't set a version for the pyproject.toml
+ substituteInPlace pyproject.toml \
+ --replace "0.0.0" "${version}" \
+ --replace "--cov" ""
+ '';
+
nativeBuildInputs = [
poetry-core
];
@@ -41,13 +48,6 @@ buildPythonPackage rec {
pytestCheckHook
];
- postPatch = ''
- # Upstream doesn't set a version for the pyproject.toml
- substituteInPlace pyproject.toml \
- --replace "0.0.0" "${version}" \
- --replace "--cov" ""
- '';
-
pythonImportsCheck = [
"elgato"
];
@@ -55,6 +55,7 @@ buildPythonPackage rec {
meta = with lib; {
description = "Python client for Elgato Key Lights";
homepage = "https://github.com/frenck/python-elgato";
+ changelog = "https://github.com/frenck/python-elgato/releases/tag/v${version}";
license = with licenses; [ mit ];
maintainers = with maintainers; [ fab ];
};
diff --git a/pkgs/development/python-modules/formbox/default.nix b/pkgs/development/python-modules/formbox/default.nix
index 098d13e87c98..418cd3d958cd 100644
--- a/pkgs/development/python-modules/formbox/default.nix
+++ b/pkgs/development/python-modules/formbox/default.nix
@@ -1,26 +1,24 @@
-{ lib, buildPythonPackage, pythonOlder, fetchFromSourcehut, flit-core, bleach, markdown }:
+{ lib, buildPythonPackage, pythonOlder, fetchzip, flit-core, mistune, nh3 }:
buildPythonPackage rec {
pname = "formbox";
- version = "0.4.1";
+ version = "0.4.3";
format = "pyproject";
disabled = pythonOlder "3.6";
- src = fetchFromSourcehut {
- owner = "~cnx";
- repo = pname;
- rev = version;
- hash = "sha256-zOvXmSeBiwc0Z5mRMwMsHLU3A/iP7rpjXm0T0I2gUTk=";
+ src = fetchzip {
+ url = "https://trong.loang.net/~cnx/formbox/snapshot/formbox-${version}.tar.gz";
+ hash = "sha256-sRu0otyeYpxot/Fyiz3wyQJsJvl8nsgIVitzT8frxLE=";
};
nativeBuildInputs = [ flit-core ];
- propagatedBuildInputs = [ bleach markdown ];
+ propagatedBuildInputs = [ mistune nh3 ];
doCheck = false; # there's no test
pythonImportsCheck = [ "formbox" ];
meta = with lib; {
description = "A script to format mbox as HTML/XML";
- homepage = "https://sr.ht/~cnx/formbox";
+ homepage = "https://trong.loang.net/~cnx/formbox";
license = licenses.agpl3Plus;
maintainers = [ maintainers.McSinyx ];
};
diff --git a/pkgs/development/python-modules/fypp/default.nix b/pkgs/development/python-modules/fypp/default.nix
index 9504a5839e73..a75e141361a8 100644
--- a/pkgs/development/python-modules/fypp/default.nix
+++ b/pkgs/development/python-modules/fypp/default.nix
@@ -2,13 +2,13 @@
buildPythonApplication rec {
pname = "fypp";
- version = "3.1";
+ version = "3.2";
src = fetchFromGitHub {
owner = "aradi";
repo = pname;
rev = version;
- hash = "sha256-iog5Gdcd1F230Nl4JDrKoyYr8JualVgNZQzHLzd4xe8=";
+ hash = "sha256-MgGVlOqOIrIVoDfBMVpFLT26mhYndxans2hfo/+jdoA=";
};
meta = with lib; {
diff --git a/pkgs/development/python-modules/guppy3/default.nix b/pkgs/development/python-modules/guppy3/default.nix
index c47fb6a80425..65d7c2622a8e 100644
--- a/pkgs/development/python-modules/guppy3/default.nix
+++ b/pkgs/development/python-modules/guppy3/default.nix
@@ -7,14 +7,14 @@
buildPythonPackage rec {
pname = "guppy3";
- version = "3.1.3";
+ version = "3.1.4";
disabled = pythonOlder "3.6";
src = fetchFromGitHub {
owner = "zhuyifei1999";
repo = pname;
rev = "v${version}";
- hash = "sha256-i3WqXlNnNhBVw9rdnxnzQISFkZHBpc/gqG+rxOWPiyc=";
+ hash = "sha256-RMWIP4tVSCCEQpr0kZvsN1HwL6rBcLuubfBl175eSNg=";
};
propagatedBuildInputs = [ tkinter ];
diff --git a/pkgs/development/python-modules/peaqevcore/default.nix b/pkgs/development/python-modules/peaqevcore/default.nix
index 38397535c01f..33e65661f92e 100644
--- a/pkgs/development/python-modules/peaqevcore/default.nix
+++ b/pkgs/development/python-modules/peaqevcore/default.nix
@@ -6,14 +6,14 @@
buildPythonPackage rec {
pname = "peaqevcore";
- version = "19.5.4";
+ version = "19.5.5";
format = "setuptools";
disabled = pythonOlder "3.7";
src = fetchPypi {
inherit pname version;
- hash = "sha256-AkVUYUZobQsnSfMfciiSbPwo0HCnlO3NLoUA1+wqBt4=";
+ hash = "sha256-AgJT/VfNHcSuJhypBwqJkgXuvYDBlZ7eQp4nGva4z6U=";
};
postPatch = ''
diff --git a/pkgs/development/python-modules/plugwise/default.nix b/pkgs/development/python-modules/plugwise/default.nix
index 8876eea828af..22e0a6282762 100644
--- a/pkgs/development/python-modules/plugwise/default.nix
+++ b/pkgs/development/python-modules/plugwise/default.nix
@@ -20,7 +20,7 @@
buildPythonPackage rec {
pname = "plugwise";
- version = "0.33.1";
+ version = "0.33.2";
format = "setuptools";
disabled = pythonOlder "3.7";
@@ -29,7 +29,7 @@ buildPythonPackage rec {
owner = pname;
repo = "python-plugwise";
rev = "refs/tags/v${version}";
- hash = "sha256-uJBUim5FlS+Jw3rGEKuorksVIgI5tVRAI7tESeYnGUc=";
+ hash = "sha256-WTgv0bEkhLMoRCw6Xh5SlYLxnlQCv603lKTajjCETT4=";
};
propagatedBuildInputs = [
diff --git a/pkgs/development/python-modules/pvo/default.nix b/pkgs/development/python-modules/pvo/default.nix
index 6f3f698fe2c7..6963d3700013 100644
--- a/pkgs/development/python-modules/pvo/default.nix
+++ b/pkgs/development/python-modules/pvo/default.nix
@@ -13,18 +13,25 @@
buildPythonPackage rec {
pname = "pvo";
- version = "1.0.0";
+ version = "2.0.0";
format = "pyproject";
- disabled = pythonOlder "3.10";
+ disabled = pythonOlder "3.11";
src = fetchFromGitHub {
owner = "frenck";
repo = "python-pvoutput";
rev = "refs/tags/v${version}";
- hash = "sha256-6oVACUnK8WVlEx047CUXmSXQ0+M3xnSvyMHw5Wttk7M=";
+ hash = "sha256-SvsrvGwIAlj/8hdk90+rxigVrx6n3YInvF/4eux2H04=";
};
+ postPatch = ''
+ # Upstream doesn't set a version for the pyproject.toml
+ substituteInPlace pyproject.toml \
+ --replace "0.0.0" "${version}" \
+ --replace "--cov" ""
+ '';
+
nativeBuildInputs = [
poetry-core
];
@@ -41,13 +48,6 @@ buildPythonPackage rec {
pytestCheckHook
];
- postPatch = ''
- # Upstream doesn't set a version for the pyproject.toml
- substituteInPlace pyproject.toml \
- --replace "0.0.0" "${version}" \
- --replace "--cov" ""
- '';
-
pythonImportsCheck = [
"pvo"
];
diff --git a/pkgs/development/python-modules/py-libzfs/default.nix b/pkgs/development/python-modules/py-libzfs/default.nix
index 1eacc39b8ab0..d148e539d3ff 100644
--- a/pkgs/development/python-modules/py-libzfs/default.nix
+++ b/pkgs/development/python-modules/py-libzfs/default.nix
@@ -8,13 +8,13 @@
buildPythonPackage rec {
pname = "py-libzfs";
- version = "22.02.4";
+ version = "22.12.4.2";
src = fetchFromGitHub {
owner = "truenas";
repo = pname;
rev = "TS-${version}";
- hash = "sha256-BJG+cw07Qu4aL99pVKNd7JAgr+w/6Uv2eI46EB615/I=";
+ hash = "sha256-vBLbjP1gQEQNsTLc2W6uRzCFHQXZp+jGiwE0Pe8VTuw=";
};
nativeBuildInputs = [ cython ];
diff --git a/pkgs/development/python-modules/pyduotecno/default.nix b/pkgs/development/python-modules/pyduotecno/default.nix
index e61e725a80a1..17fd2d78885c 100644
--- a/pkgs/development/python-modules/pyduotecno/default.nix
+++ b/pkgs/development/python-modules/pyduotecno/default.nix
@@ -8,7 +8,7 @@
buildPythonPackage rec {
pname = "pyduotecno";
- version = "2023.10.0";
+ version = "2023.10.1";
format = "pyproject";
disabled = pythonOlder "3.9";
@@ -17,7 +17,7 @@ buildPythonPackage rec {
owner = "Cereal2nd";
repo = "pyDuotecno";
rev = "refs/tags/${version}";
- hash = "sha256-GxCqWgw4OdhJUMsGzCZnl6KYH7HQpGyV7zXMxbShHlg=";
+ hash = "sha256-fDooQb1i9rgzDZBzZ+lYb0WUYC8JNPEYk5DJ9wtS2Dg=";
};
nativeBuildInputs = [
diff --git a/pkgs/development/python-modules/pyenphase/default.nix b/pkgs/development/python-modules/pyenphase/default.nix
index 360db9124175..d18160d897d3 100644
--- a/pkgs/development/python-modules/pyenphase/default.nix
+++ b/pkgs/development/python-modules/pyenphase/default.nix
@@ -18,7 +18,7 @@
buildPythonPackage rec {
pname = "pyenphase";
- version = "1.12.0";
+ version = "1.13.1";
format = "pyproject";
disabled = pythonOlder "3.11";
@@ -27,7 +27,7 @@ buildPythonPackage rec {
owner = "pyenphase";
repo = "pyenphase";
rev = "refs/tags/v${version}";
- hash = "sha256-gqbRz0JAp8hjZpFUzlFzqq86UKgD0TLWSp1Z9rdrk3s=";
+ hash = "sha256-8wGGx7ERYm+lKvLW/NUcJeBTqEXPM0jJNOOlkj/UzYk=";
};
postPatch = ''
diff --git a/pkgs/development/python-modules/pyliblo/default.nix b/pkgs/development/python-modules/pyliblo/default.nix
index 52f59cc3fc8d..e56b1dfa3683 100644
--- a/pkgs/development/python-modules/pyliblo/default.nix
+++ b/pkgs/development/python-modules/pyliblo/default.nix
@@ -10,19 +10,26 @@
buildPythonPackage rec {
pname = "pyliblo";
version = "0.10.0";
- disabled = isPyPy || pythonAtLeast "3.11";
+ disabled = isPyPy;
src = fetchurl {
url = "http://das.nasophon.de/download/${pname}-${version}.tar.gz";
sha256 = "13vry6xhxm7adnbyj28w1kpwrh0kf7nw83cz1yq74wl21faz2rzw";
};
+ patches = [
+ (fetchurl {
+ url = "https://git.alpinelinux.org/aports/plain/community/py3-pyliblo/py3.11.patch?id=a7e1eca5533657ddd7e37c43e67e8126e3447258";
+ hash = "sha256-4yCWNQaE/9FHGTVuvNEimBNuViWZ9aSJMcpTOP0fnM0=";
+ })
+ ];
+
buildInputs = [ liblo cython ];
meta = with lib; {
homepage = "https://das.nasophon.de/pyliblo/";
description = "Python wrapper for the liblo OSC library";
- license = licenses.lgpl21;
+ license = licenses.lgpl21Only;
};
}
diff --git a/pkgs/development/python-modules/pyscf/default.nix b/pkgs/development/python-modules/pyscf/default.nix
index 29f795560d41..5089e19c2264 100644
--- a/pkgs/development/python-modules/pyscf/default.nix
+++ b/pkgs/development/python-modules/pyscf/default.nix
@@ -16,13 +16,13 @@
buildPythonPackage rec {
pname = "pyscf";
- version = "2.3.0";
+ version = "2.4.0";
src = fetchFromGitHub {
owner = "pyscf";
repo = pname;
rev = "v${version}";
- hash = "sha256-x693NB0oc9X7SuDZlV3VKOmgnIgKA39O9yswDM0outk=";
+ hash = "sha256-+dZsXiLqqyRWr1eOEVSHZ1KMM760hrDaT07ylZUcGmo=";
};
# setup.py calls Cmake and passes the arguments in CMAKE_CONFIGURE_ARGS to cmake.
diff --git a/pkgs/development/python-modules/pymyq/default.nix b/pkgs/development/python-modules/python-myq/default.nix
similarity index 97%
rename from pkgs/development/python-modules/pymyq/default.nix
rename to pkgs/development/python-modules/python-myq/default.nix
index 91c691f843a3..f596828e6f9f 100644
--- a/pkgs/development/python-modules/pymyq/default.nix
+++ b/pkgs/development/python-modules/python-myq/default.nix
@@ -9,7 +9,7 @@
}:
buildPythonPackage rec {
- pname = "pymyq";
+ pname = "python-myq";
version = "3.1.13";
pyproject = true;
diff --git a/pkgs/development/python-modules/ratelimiter/default.nix b/pkgs/development/python-modules/ratelimiter/default.nix
deleted file mode 100644
index 6c01a9e548c9..000000000000
--- a/pkgs/development/python-modules/ratelimiter/default.nix
+++ /dev/null
@@ -1,43 +0,0 @@
-{ lib
-, buildPythonPackage
-, fetchPypi
-, pytest-asyncio
-, pytestCheckHook
-}:
-
-buildPythonPackage rec {
- pname = "ratelimiter";
- version = "1.2.0.post0";
- format = "setuptools";
-
- src = fetchPypi {
- inherit pname version;
- hash = "sha256-XDldyr273i5ReO8/ibVoowZkVKbdwiO3ZHPawi+JtPc=";
- };
-
- nativeCheckInputs = [
- pytest-asyncio
- pytestCheckHook
- ];
-
- pythonImportsCheck = [
- "ratelimiter"
- ];
-
- preCheck = ''
- # Uses out-dated options
- rm tests/conftest.py
- '';
-
- disabledTests = [
- # TypeError: object Lock can't be used in 'await' expression
- "test_alock"
- ];
-
- meta = with lib; {
- description = "Simple python rate limiting object";
- homepage = "https://github.com/RazerM/ratelimiter";
- license = licenses.asl20;
- maintainers = with maintainers; [ helkafen ];
- };
-}
diff --git a/pkgs/development/python-modules/readmdict/default.nix b/pkgs/development/python-modules/readmdict/default.nix
new file mode 100644
index 000000000000..b7d61f8c8f57
--- /dev/null
+++ b/pkgs/development/python-modules/readmdict/default.nix
@@ -0,0 +1,50 @@
+{ lib
+, buildPythonPackage
+, pythonOlder
+, fetchFromGitHub
+
+, poetry-core
+, python-lzo
+, tkinter
+
+, pytestCheckHook
+}:
+
+buildPythonPackage rec {
+ pname = "readmdict";
+ version = "0.1.1";
+ pyproject = true;
+
+ disabled = pythonOlder "3.6";
+
+ src = fetchFromGitHub {
+ owner = "ffreemt";
+ repo = "readmdict";
+ rev = "v${version}";
+ hash = "sha256-1/f+o2bVscT3EA8XQyS2hWjhimLRzfIBM6u2O7UqwcA=";
+ };
+
+ nativeBuildInputs = [
+ poetry-core
+ ];
+
+ propagatedBuildInputs = [
+ python-lzo
+ tkinter
+ ];
+
+ nativeCheckInputs = [
+ pytestCheckHook
+ ];
+
+ pythonImportsCheck = [
+ "readmdict"
+ ];
+
+ meta = with lib; {
+ description = "Read mdx/mdd files (repacking of readmdict from mdict-analysis)";
+ homepage = "https://github.com/ffreemt/readmdict";
+ license = licenses.mit;
+ maintainers = with maintainers; [ paveloom ];
+ };
+}
diff --git a/pkgs/development/python-modules/sensor-state-data/default.nix b/pkgs/development/python-modules/sensor-state-data/default.nix
index 7316256cd8aa..7802340cedef 100644
--- a/pkgs/development/python-modules/sensor-state-data/default.nix
+++ b/pkgs/development/python-modules/sensor-state-data/default.nix
@@ -10,7 +10,7 @@
buildPythonPackage rec {
pname = "sensor-state-data";
- version = "2.17.1";
+ version = "2.18.0";
format = "pyproject";
disabled = pythonOlder "3.9";
@@ -19,7 +19,7 @@ buildPythonPackage rec {
owner = "Bluetooth-Devices";
repo = pname;
rev = "refs/tags/v${version}";
- hash = "sha256-zfgkTBdE8UWwk+G3bLBThVjgU+m2QoPf1fzORyznEgs=";
+ hash = "sha256-wYYSS4lABCbIhmUU3z3Wh0+4zwpEzXl8Kk9gi6LBrbQ=";
};
nativeBuildInputs = [
diff --git a/pkgs/development/python-modules/textparser/default.nix b/pkgs/development/python-modules/textparser/default.nix
new file mode 100644
index 000000000000..86c436ac21f9
--- /dev/null
+++ b/pkgs/development/python-modules/textparser/default.nix
@@ -0,0 +1,39 @@
+{ lib
+, buildPythonPackage
+, fetchPypi
+, setuptools-scm
+, pytestCheckHook
+, pythonOlder
+}:
+
+buildPythonPackage rec {
+ pname = "textparser";
+ version = "0.24.0";
+ format = "setuptools";
+
+ disabled = pythonOlder "3.7";
+
+ src = fetchPypi {
+ inherit pname version;
+ hash = "sha256-VvcI51qp0AKtt22CO6bvFm1+zsHj5MpMHKED+BdWgzU=";
+ };
+
+ nativeBuildInputs = [
+ setuptools-scm
+ ];
+
+ nativeCheckInputs = [
+ pytestCheckHook
+ ];
+
+ pythonImportsCheck = [
+ "textparser"
+ ];
+
+ meta = with lib; {
+ homepage = "https://github.com/eerimoq/textparser";
+ description = "A text parser";
+ license = licenses.mit;
+ maintainers = with maintainers; [ gray-heron ];
+ };
+}
diff --git a/pkgs/development/python-modules/toonapi/default.nix b/pkgs/development/python-modules/toonapi/default.nix
index 8df8fa89a2ca..ac51cae1c805 100644
--- a/pkgs/development/python-modules/toonapi/default.nix
+++ b/pkgs/development/python-modules/toonapi/default.nix
@@ -3,18 +3,22 @@
, backoff
, buildPythonPackage
, fetchFromGitHub
+, pythonOlder
, yarl
}:
buildPythonPackage rec {
pname = "toonapi";
- version = "0.2.1";
+ version = "0.3.0";
+ format = "setuptools";
+
+ disabled = pythonOlder "3.8";
src = fetchFromGitHub {
owner = "frenck";
repo = "python-toonapi";
- rev = "v${version}";
- sha256 = "10jh6p0ww51cb9f8amd9jq3lmvby6n2k08qwcr2n8ijbbgyp0ibf";
+ rev = "refs/tags/v${version}";
+ hash = "sha256-RaN9ppqJbTik1/vNX0/YLoBawrqjyQWU6+FLTspIxug=";
};
propagatedBuildInputs = [
@@ -25,11 +29,15 @@ buildPythonPackage rec {
# Project has no tests
doCheck = false;
- pythonImportsCheck = [ "toonapi" ];
+
+ pythonImportsCheck = [
+ "toonapi"
+ ];
meta = with lib; {
description = "Python client for the Quby ToonAPI";
homepage = "https://github.com/frenck/python-toonapi";
+ changelog = "https://github.com/frenck/python-toonapi/releases/tag/v${version}";
license = with licenses; [ mit ];
maintainers = with maintainers; [ fab ];
};
diff --git a/pkgs/development/python-modules/torch/default.nix b/pkgs/development/python-modules/torch/default.nix
index 9efb0facaff3..765a8d9468bc 100644
--- a/pkgs/development/python-modules/torch/default.nix
+++ b/pkgs/development/python-modules/torch/default.nix
@@ -95,8 +95,7 @@ let
paths = with rocmPackages; [
rocm-core clr rccl miopen miopengemm rocrand rocblas
- rocsparse hipsparse rocthrust rocprim hipcub
- roctracer # Unfree at the moment due to hsa-amd-aqlprofile hard dependency in rocprofiler
+ rocsparse hipsparse rocthrust rocprim hipcub roctracer
rocfft rocsolver hipfft hipsolver hipblas
rocminfo rocm-thunk rocm-comgr rocm-device-libs
rocm-runtime clr.icd hipify
diff --git a/pkgs/development/python-modules/trezor/default.nix b/pkgs/development/python-modules/trezor/default.nix
index 109f48d1f71b..23af30faefba 100644
--- a/pkgs/development/python-modules/trezor/default.nix
+++ b/pkgs/development/python-modules/trezor/default.nix
@@ -24,13 +24,13 @@
buildPythonPackage rec {
pname = "trezor";
- version = "0.13.7";
+ version = "0.13.8";
disabled = !isPy3k;
src = fetchPypi {
inherit pname version;
- hash = "sha256-dodeWIYBfclPUbu0Efkn8QO9nj7L8HVNXkSjU4mBSeA=";
+ hash = "sha256-Y01O3fNWAyV8MhYY2FSMajWyc4Rle2XjsL261jWlfP8=";
};
nativeBuildInputs = [ installShellFiles ];
diff --git a/pkgs/development/python-modules/twentemilieu/default.nix b/pkgs/development/python-modules/twentemilieu/default.nix
index aa91f01686c7..e52f70753f32 100644
--- a/pkgs/development/python-modules/twentemilieu/default.nix
+++ b/pkgs/development/python-modules/twentemilieu/default.nix
@@ -12,16 +12,16 @@
buildPythonPackage rec {
pname = "twentemilieu";
- version = "1.0.0";
+ version = "2.0.0";
format = "pyproject";
- disabled = pythonOlder "3.10";
+ disabled = pythonOlder "3.11";
src = fetchFromGitHub {
owner = "frenck";
repo = "python-twentemilieu";
- rev = "v${version}";
- hash = "sha256-MTAVa5gP5e8TIE/i1DjfmwKm1zDVC/WEcYKxZSV/+Ug=";
+ rev = "refs/tags/v${version}";
+ hash = "sha256-r0LZS8TXux1mzzXBTSu+x5sxUZOCzW7poKG3dQ2A6No=";
};
postPatch = ''
@@ -45,7 +45,9 @@ buildPythonPackage rec {
pytestCheckHook
];
- pythonImportsCheck = [ "twentemilieu" ];
+ pythonImportsCheck = [
+ "twentemilieu"
+ ];
meta = with lib; {
description = "Python client for Twente Milieu";
diff --git a/pkgs/development/python-modules/velbus-aio/default.nix b/pkgs/development/python-modules/velbus-aio/default.nix
index dda198ff95cc..03c44ef031c0 100644
--- a/pkgs/development/python-modules/velbus-aio/default.nix
+++ b/pkgs/development/python-modules/velbus-aio/default.nix
@@ -10,7 +10,7 @@
buildPythonPackage rec {
pname = "velbus-aio";
- version = "2023.10.0";
+ version = "2023.10.1";
format = "setuptools";
disabled = pythonOlder "3.7";
@@ -19,7 +19,7 @@ buildPythonPackage rec {
owner = "Cereal2nd";
repo = pname;
rev = version;
- hash = "sha256-xVELkmucrw1QazSR2XN6ldmzdTya/rWsQd1mRsLTcbU=";
+ hash = "sha256-v2B+tDqvQTm+K+cvTRM8LnfaFp5CTsI8/B5clBDNE08=";
fetchSubmodules = true;
};
diff --git a/pkgs/development/python-modules/wallbox/default.nix b/pkgs/development/python-modules/wallbox/default.nix
index 4fe26418ef83..a53344a76fd1 100644
--- a/pkgs/development/python-modules/wallbox/default.nix
+++ b/pkgs/development/python-modules/wallbox/default.nix
@@ -9,14 +9,14 @@
buildPythonPackage rec {
pname = "wallbox";
- version = "0.4.14";
+ version = "0.5.1";
format = "setuptools";
disabled = pythonOlder "3.7";
src = fetchPypi {
inherit pname version;
- hash = "sha256-HKlq5DPG3HD9i9LLTJdlzEFim+2hBdSfKl43BojhEf8=";
+ hash = "sha256-EDEB7/CkrfYSNcSh55Itrj6rThsNKeuj8lHLAY+Qml4=";
};
propagatedBuildInputs = [
diff --git a/pkgs/development/rocm-modules/5/clang-ocl/default.nix b/pkgs/development/rocm-modules/5/clang-ocl/default.nix
index 96fc4945747f..7af83bd2e132 100644
--- a/pkgs/development/rocm-modules/5/clang-ocl/default.nix
+++ b/pkgs/development/rocm-modules/5/clang-ocl/default.nix
@@ -9,7 +9,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "clang-ocl";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "RadeonOpenCompute";
diff --git a/pkgs/development/rocm-modules/5/clr/default.nix b/pkgs/development/rocm-modules/5/clr/default.nix
index 8a5d695e2b4c..f12ef2bfc8b5 100644
--- a/pkgs/development/rocm-modules/5/clr/default.nix
+++ b/pkgs/development/rocm-modules/5/clr/default.nix
@@ -35,7 +35,7 @@ let
];
in stdenv.mkDerivation (finalAttrs: {
pname = "clr";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
@@ -46,7 +46,7 @@ in stdenv.mkDerivation (finalAttrs: {
owner = "ROCm-Developer-Tools";
repo = "clr";
rev = "rocm-${finalAttrs.version}";
- hash = "sha256-C+rFW/7kf35rz0sQTI2+iY5RhZZQY07fc5a+e6cB5OQ=";
+ hash = "sha256-1gZJhvBbUFdKH9p/7SRfzEV/fM+gIN2Qvlxf2VbmAIw=";
};
nativeBuildInputs = [
@@ -144,6 +144,8 @@ in stdenv.mkDerivation (finalAttrs: {
name = finalAttrs.pname;
owner = finalAttrs.src.owner;
repo = finalAttrs.src.repo;
+ page = "tags?per_page=1";
+ filter = ".[0].name | split(\"-\") | .[1]";
};
impureTests = {
diff --git a/pkgs/development/rocm-modules/5/composable_kernel/default.nix b/pkgs/development/rocm-modules/5/composable_kernel/default.nix
index 2372b27ebe52..75039fc7d417 100644
--- a/pkgs/development/rocm-modules/5/composable_kernel/default.nix
+++ b/pkgs/development/rocm-modules/5/composable_kernel/default.nix
@@ -15,7 +15,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "composable_kernel";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
diff --git a/pkgs/development/rocm-modules/5/default.nix b/pkgs/development/rocm-modules/5/default.nix
index 6e263998dbe6..3229d7b077a0 100644
--- a/pkgs/development/rocm-modules/5/default.nix
+++ b/pkgs/development/rocm-modules/5/default.nix
@@ -111,8 +111,7 @@ in rec {
# Needs GCC
roctracer = callPackage ./roctracer {
- inherit rocmUpdateScript rocm-device-libs rocm-runtime rocprofiler clr;
- inherit (llvm) clang;
+ inherit rocmUpdateScript rocm-device-libs rocm-runtime clr;
};
# Needs GCC
diff --git a/pkgs/development/rocm-modules/5/half/default.nix b/pkgs/development/rocm-modules/5/half/default.nix
index 08c645848fa2..1ddd06b01449 100644
--- a/pkgs/development/rocm-modules/5/half/default.nix
+++ b/pkgs/development/rocm-modules/5/half/default.nix
@@ -8,7 +8,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "half";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "ROCmSoftwarePlatform";
diff --git a/pkgs/development/rocm-modules/5/hip-common/default.nix b/pkgs/development/rocm-modules/5/hip-common/default.nix
index 9f5f37511ef0..6e2f950c0193 100644
--- a/pkgs/development/rocm-modules/5/hip-common/default.nix
+++ b/pkgs/development/rocm-modules/5/hip-common/default.nix
@@ -6,7 +6,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "hip-common";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "ROCm-Developer-Tools";
diff --git a/pkgs/development/rocm-modules/5/hipblas/default.nix b/pkgs/development/rocm-modules/5/hipblas/default.nix
index b2206c737b00..c604dda46593 100644
--- a/pkgs/development/rocm-modules/5/hipblas/default.nix
+++ b/pkgs/development/rocm-modules/5/hipblas/default.nix
@@ -18,7 +18,7 @@
# Can also use cuBLAS
stdenv.mkDerivation (finalAttrs: {
pname = "hipblas";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
diff --git a/pkgs/development/rocm-modules/5/hipcc/default.nix b/pkgs/development/rocm-modules/5/hipcc/default.nix
index e6610e8909f7..20c428bbf809 100644
--- a/pkgs/development/rocm-modules/5/hipcc/default.nix
+++ b/pkgs/development/rocm-modules/5/hipcc/default.nix
@@ -8,7 +8,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "hipcc";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "ROCm-Developer-Tools";
diff --git a/pkgs/development/rocm-modules/5/hipcub/default.nix b/pkgs/development/rocm-modules/5/hipcub/default.nix
index 447c2c4174af..943a14c379a1 100644
--- a/pkgs/development/rocm-modules/5/hipcub/default.nix
+++ b/pkgs/development/rocm-modules/5/hipcub/default.nix
@@ -16,7 +16,7 @@
# CUB can also be used as a backend instead of rocPRIM.
stdenv.mkDerivation (finalAttrs: {
pname = "hipcub";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
diff --git a/pkgs/development/rocm-modules/5/hipfft/default.nix b/pkgs/development/rocm-modules/5/hipfft/default.nix
index 153a7c8c18cc..b0c5928a192d 100644
--- a/pkgs/development/rocm-modules/5/hipfft/default.nix
+++ b/pkgs/development/rocm-modules/5/hipfft/default.nix
@@ -21,7 +21,7 @@
# Can also use cuFFT
stdenv.mkDerivation (finalAttrs: {
pname = "hipfft";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
diff --git a/pkgs/development/rocm-modules/5/hipfort/default.nix b/pkgs/development/rocm-modules/5/hipfort/default.nix
index 4bb2a270271b..4b6c7c56af41 100644
--- a/pkgs/development/rocm-modules/5/hipfort/default.nix
+++ b/pkgs/development/rocm-modules/5/hipfort/default.nix
@@ -9,7 +9,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "hipfort";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "ROCmSoftwarePlatform";
diff --git a/pkgs/development/rocm-modules/5/hipify/default.nix b/pkgs/development/rocm-modules/5/hipify/default.nix
index 893056496c9c..e553c0e385a5 100644
--- a/pkgs/development/rocm-modules/5/hipify/default.nix
+++ b/pkgs/development/rocm-modules/5/hipify/default.nix
@@ -9,7 +9,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "hipify";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "ROCm-Developer-Tools";
diff --git a/pkgs/development/rocm-modules/5/hipsolver/default.nix b/pkgs/development/rocm-modules/5/hipsolver/default.nix
index 34592a5bbd96..9c5c1cad2207 100644
--- a/pkgs/development/rocm-modules/5/hipsolver/default.nix
+++ b/pkgs/development/rocm-modules/5/hipsolver/default.nix
@@ -18,7 +18,7 @@
# Can also use cuSOLVER
stdenv.mkDerivation (finalAttrs: {
pname = "hipsolver";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
@@ -34,7 +34,7 @@ stdenv.mkDerivation (finalAttrs: {
owner = "ROCmSoftwarePlatform";
repo = "hipSOLVER";
rev = "rocm-${finalAttrs.version}";
- hash = "sha256-I9Xjkilo+baeM1CRXjLAbj/vrg8r5/E2yEImhHGSyf8=";
+ hash = "sha256-5b6kPj9yvXvP7f7AyHDTYRoM/EhQZvwkVCfDflFJugc=";
};
nativeBuildInputs = [
diff --git a/pkgs/development/rocm-modules/5/hipsparse/default.nix b/pkgs/development/rocm-modules/5/hipsparse/default.nix
index 79b78f3661d8..0e77079348b3 100644
--- a/pkgs/development/rocm-modules/5/hipsparse/default.nix
+++ b/pkgs/development/rocm-modules/5/hipsparse/default.nix
@@ -18,7 +18,7 @@
# This can also use cuSPARSE as a backend instead of rocSPARSE
stdenv.mkDerivation (finalAttrs: {
pname = "hipsparse";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
diff --git a/pkgs/development/rocm-modules/5/llvm/base.nix b/pkgs/development/rocm-modules/5/llvm/base.nix
index 655192d892bb..82de9e6f3665 100644
--- a/pkgs/development/rocm-modules/5/llvm/base.nix
+++ b/pkgs/development/rocm-modules/5/llvm/base.nix
@@ -53,7 +53,7 @@ let
llvmTargetsToBuild' = [ "AMDGPU" ] ++ builtins.map inferNativeTarget llvmTargetsToBuild;
in stdenv.mkDerivation (finalAttrs: {
pname = "rocm-llvm-${targetName}";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
@@ -70,7 +70,7 @@ in stdenv.mkDerivation (finalAttrs: {
owner = "RadeonOpenCompute";
repo = "llvm-project";
rev = "rocm-${finalAttrs.version}";
- hash = "sha256-oJIXALwxo130jl8b6yCFw+a2kMBlny5/0ubiqF6MOWY=";
+ hash = "sha256-0+lJnDiMntxCYbZBCSWvHOcKXexFfEzRfb49QbfOmK8=";
};
nativeBuildInputs = [
diff --git a/pkgs/development/rocm-modules/5/migraphx/default.nix b/pkgs/development/rocm-modules/5/migraphx/default.nix
index 5842cd1695d5..dc84e526823f 100644
--- a/pkgs/development/rocm-modules/5/migraphx/default.nix
+++ b/pkgs/development/rocm-modules/5/migraphx/default.nix
@@ -49,7 +49,7 @@ let
};
in stdenv.mkDerivation (finalAttrs: {
pname = "migraphx";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
@@ -63,7 +63,7 @@ in stdenv.mkDerivation (finalAttrs: {
owner = "ROCmSoftwarePlatform";
repo = "AMDMIGraphX";
rev = "rocm-${finalAttrs.version}";
- hash = "sha256-7yL7Zn5I8GUPIAgB7tVLZI7OEHLv0E4FcLVx9xMfsNY=";
+ hash = "sha256-lg3pxHBpwqxBvdOQgE44YKLuumhkVF6b3Xx4+cw7jNQ=";
};
nativeBuildInputs = [
diff --git a/pkgs/development/rocm-modules/5/miopen/default.nix b/pkgs/development/rocm-modules/5/miopen/default.nix
index d22518aa51c6..a9a1cd5abe01 100644
--- a/pkgs/development/rocm-modules/5/miopen/default.nix
+++ b/pkgs/development/rocm-modules/5/miopen/default.nix
@@ -35,7 +35,7 @@
}:
let
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "ROCmSoftwarePlatform";
diff --git a/pkgs/development/rocm-modules/5/mivisionx/default.nix b/pkgs/development/rocm-modules/5/mivisionx/default.nix
index d6e198eb4c77..7eac2a4ca497 100644
--- a/pkgs/development/rocm-modules/5/mivisionx/default.nix
+++ b/pkgs/development/rocm-modules/5/mivisionx/default.nix
@@ -38,13 +38,13 @@ stdenv.mkDerivation (finalAttrs: {
else "cpu"
);
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "GPUOpen-ProfessionalCompute-Libraries";
repo = "MIVisionX";
rev = "rocm-${finalAttrs.version}";
- hash = "sha256-Z7UIqJWuSD+/FoZ1VIbITp4R/bwaqFCQqsL8CRW73Ek=";
+ hash = "sha256-jmOgwESNALQt7ctmUY9JHgKq47tCwsW1ybynkX9236U=";
};
nativeBuildInputs = [
diff --git a/pkgs/development/rocm-modules/5/rccl/default.nix b/pkgs/development/rocm-modules/5/rccl/default.nix
index d4045252bae4..3f011d3fdfac 100644
--- a/pkgs/development/rocm-modules/5/rccl/default.nix
+++ b/pkgs/development/rocm-modules/5/rccl/default.nix
@@ -16,7 +16,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rccl";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
@@ -28,7 +28,7 @@ stdenv.mkDerivation (finalAttrs: {
owner = "ROCmSoftwarePlatform";
repo = "rccl";
rev = "rocm-${finalAttrs.version}";
- hash = "sha256-Abrwmsjnkx9JVTrARP/BM965g+R10lY+XPwthy/SG0k=";
+ hash = "sha256-nFkou/kjGBmImorlPOZNTlCrxbfAYpDhgRveyoAufu8=";
};
nativeBuildInputs = [
diff --git a/pkgs/development/rocm-modules/5/rdc/default.nix b/pkgs/development/rocm-modules/5/rdc/default.nix
index 134b946c5f7a..abdd121bce3c 100644
--- a/pkgs/development/rocm-modules/5/rdc/default.nix
+++ b/pkgs/development/rocm-modules/5/rdc/default.nix
@@ -41,7 +41,7 @@ let
};
in stdenv.mkDerivation (finalAttrs: {
pname = "rdc";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
diff --git a/pkgs/development/rocm-modules/5/rocalution/default.nix b/pkgs/development/rocm-modules/5/rocalution/default.nix
index 80fd655557df..2a0e149bb3e9 100644
--- a/pkgs/development/rocm-modules/5/rocalution/default.nix
+++ b/pkgs/development/rocm-modules/5/rocalution/default.nix
@@ -21,7 +21,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocalution";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
diff --git a/pkgs/development/rocm-modules/5/rocblas/default.nix b/pkgs/development/rocm-modules/5/rocblas/default.nix
index 17732fd51681..ca6a9e6e723a 100644
--- a/pkgs/development/rocm-modules/5/rocblas/default.nix
+++ b/pkgs/development/rocm-modules/5/rocblas/default.nix
@@ -73,7 +73,7 @@ let
fallbacks = rocblas.overrideAttrs { pname = "rocblas-tensile-fallbacks"; };
in stdenv.mkDerivation (finalAttrs: {
pname = "rocblas";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
diff --git a/pkgs/development/rocm-modules/5/rocdbgapi/default.nix b/pkgs/development/rocm-modules/5/rocdbgapi/default.nix
index 41c1178f1089..aef89d2330d1 100644
--- a/pkgs/development/rocm-modules/5/rocdbgapi/default.nix
+++ b/pkgs/development/rocm-modules/5/rocdbgapi/default.nix
@@ -38,7 +38,7 @@ let
};
in stdenv.mkDerivation (finalAttrs: {
pname = "rocdbgapi";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
diff --git a/pkgs/development/rocm-modules/5/rocfft/default.nix b/pkgs/development/rocm-modules/5/rocfft/default.nix
index ac50318622ce..309a7f2fe224 100644
--- a/pkgs/development/rocm-modules/5/rocfft/default.nix
+++ b/pkgs/development/rocm-modules/5/rocfft/default.nix
@@ -19,7 +19,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocfft";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "ROCmSoftwarePlatform";
diff --git a/pkgs/development/rocm-modules/5/rocgdb/default.nix b/pkgs/development/rocm-modules/5/rocgdb/default.nix
index a2f4435ee7bc..facec0cf16d3 100644
--- a/pkgs/development/rocm-modules/5/rocgdb/default.nix
+++ b/pkgs/development/rocm-modules/5/rocgdb/default.nix
@@ -15,7 +15,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocgdb";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "ROCm-Developer-Tools";
diff --git a/pkgs/development/rocm-modules/5/rocm-cmake/default.nix b/pkgs/development/rocm-modules/5/rocm-cmake/default.nix
index 04ae947d3a4a..d88912154f8b 100644
--- a/pkgs/development/rocm-modules/5/rocm-cmake/default.nix
+++ b/pkgs/development/rocm-modules/5/rocm-cmake/default.nix
@@ -7,7 +7,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocm-cmake";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "RadeonOpenCompute";
@@ -22,8 +22,6 @@ stdenv.mkDerivation (finalAttrs: {
name = finalAttrs.pname;
owner = finalAttrs.src.owner;
repo = finalAttrs.src.repo;
- page = "releases?per_page=2";
- filter = ".[1].tag_name | split(\"-\") | .[1]";
};
meta = with lib; {
diff --git a/pkgs/development/rocm-modules/5/rocm-comgr/default.nix b/pkgs/development/rocm-modules/5/rocm-comgr/default.nix
index c3c4c5fab3cd..8411c4d53cb3 100644
--- a/pkgs/development/rocm-modules/5/rocm-comgr/default.nix
+++ b/pkgs/development/rocm-modules/5/rocm-comgr/default.nix
@@ -15,7 +15,7 @@ let
else throw "Unsupported ROCm LLVM platform";
in stdenv.mkDerivation (finalAttrs: {
pname = "rocm-comgr";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "RadeonOpenCompute";
diff --git a/pkgs/development/rocm-modules/5/rocm-device-libs/default.nix b/pkgs/development/rocm-modules/5/rocm-device-libs/default.nix
index 594e21031284..844f38a9a4b2 100644
--- a/pkgs/development/rocm-modules/5/rocm-device-libs/default.nix
+++ b/pkgs/development/rocm-modules/5/rocm-device-libs/default.nix
@@ -14,13 +14,13 @@ let
else throw "Unsupported ROCm LLVM platform";
in stdenv.mkDerivation (finalAttrs: {
pname = "rocm-device-libs";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "RadeonOpenCompute";
repo = "ROCm-Device-Libs";
rev = "rocm-${finalAttrs.version}";
- hash = "sha256-f6/LAhJ2mBDO1/JloHvl7MJyDo3WutbXd4IDknA9nzM=";
+ hash = "sha256-ARxs/yqyVoIUWliJkINzitumF+64/5u3fbB0tHB5hPU=";
};
patches = [ ./cmake.patch ];
diff --git a/pkgs/development/rocm-modules/5/rocm-docs-core/default.nix b/pkgs/development/rocm-modules/5/rocm-docs-core/default.nix
index 65d21daa5b50..220e89fe71d2 100644
--- a/pkgs/development/rocm-modules/5/rocm-docs-core/default.nix
+++ b/pkgs/development/rocm-modules/5/rocm-docs-core/default.nix
@@ -22,14 +22,14 @@
buildPythonPackage rec {
pname = "rocm-docs-core";
- version = "0.25.0";
+ version = "0.26.0";
format = "pyproject";
src = fetchFromGitHub {
owner = "RadeonOpenCompute";
repo = "rocm-docs-core";
rev = "v${version}";
- hash = "sha256-kOsoIK0vaPT60hGr960s5vc0eloSr5CECtd8Dy24YuM=";
+ hash = "sha256-Mr6/Ne6P+TapoCqN7xkKMNse3fTaIAvvLmMl0kVg7Vs=";
};
buildInputs = [ setuptools ];
diff --git a/pkgs/development/rocm-modules/5/rocm-runtime/default.nix b/pkgs/development/rocm-modules/5/rocm-runtime/default.nix
index fd9182c8254d..79174c7032f0 100644
--- a/pkgs/development/rocm-modules/5/rocm-runtime/default.nix
+++ b/pkgs/development/rocm-modules/5/rocm-runtime/default.nix
@@ -16,7 +16,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocm-runtime";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "RadeonOpenCompute";
diff --git a/pkgs/development/rocm-modules/5/rocm-smi/default.nix b/pkgs/development/rocm-modules/5/rocm-smi/default.nix
index 2e1692539e23..66c1c765c13f 100644
--- a/pkgs/development/rocm-modules/5/rocm-smi/default.nix
+++ b/pkgs/development/rocm-modules/5/rocm-smi/default.nix
@@ -8,13 +8,13 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocm-smi";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "RadeonOpenCompute";
repo = "rocm_smi_lib";
rev = "rocm-${finalAttrs.version}";
- hash = "sha256-swCRO4PBMBJ6fO2bLq/xxFZIYw2IgiFB490wsU8Wm2o=";
+ hash = "sha256-NZR4jBgKVfpkRNQFPmav1yCZF872LkcrPBNNcBVTLDU=";
};
patches = [ ./cmake.patch ];
diff --git a/pkgs/development/rocm-modules/5/rocm-thunk/default.nix b/pkgs/development/rocm-modules/5/rocm-thunk/default.nix
index 73368dbb0e7f..98fbc56517f9 100644
--- a/pkgs/development/rocm-modules/5/rocm-thunk/default.nix
+++ b/pkgs/development/rocm-modules/5/rocm-thunk/default.nix
@@ -10,7 +10,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocm-thunk";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "RadeonOpenCompute";
diff --git a/pkgs/development/rocm-modules/5/rocminfo/default.nix b/pkgs/development/rocm-modules/5/rocminfo/default.nix
index c9ff79e380ff..c80dbc4aeacf 100644
--- a/pkgs/development/rocm-modules/5/rocminfo/default.nix
+++ b/pkgs/development/rocm-modules/5/rocminfo/default.nix
@@ -18,7 +18,7 @@
}:
stdenv.mkDerivation (finalAttrs: {
- version = "5.7.0";
+ version = "5.7.1";
pname = "rocminfo";
src = fetchFromGitHub {
diff --git a/pkgs/development/rocm-modules/5/rocmlir/default.nix b/pkgs/development/rocm-modules/5/rocmlir/default.nix
index 9b24112dce8a..74fe00e781cc 100644
--- a/pkgs/development/rocm-modules/5/rocmlir/default.nix
+++ b/pkgs/development/rocm-modules/5/rocmlir/default.nix
@@ -32,7 +32,7 @@ let
else throw "Unsupported ROCm LLVM platform";
in stdenv.mkDerivation (finalAttrs: {
pname = "rocmlir${suffix}";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
diff --git a/pkgs/development/rocm-modules/5/rocprim/default.nix b/pkgs/development/rocm-modules/5/rocprim/default.nix
index 1dd2555c6915..10d1f187ba73 100644
--- a/pkgs/development/rocm-modules/5/rocprim/default.nix
+++ b/pkgs/development/rocm-modules/5/rocprim/default.nix
@@ -14,7 +14,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocprim";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
diff --git a/pkgs/development/rocm-modules/5/rocprofiler/default.nix b/pkgs/development/rocm-modules/5/rocprofiler/default.nix
index ec24a3f41e59..c77014b50cfd 100644
--- a/pkgs/development/rocm-modules/5/rocprofiler/default.nix
+++ b/pkgs/development/rocm-modules/5/rocprofiler/default.nix
@@ -33,13 +33,13 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocprofiler";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "ROCm-Developer-Tools";
repo = "rocprofiler";
rev = "rocm-${finalAttrs.version}";
- hash = "sha256-ue/2uiLbhOv/5XY4cIJuZ8DUMRhniYgxolq9xMwO1FY=";
+ hash = "sha256-1s/7C9y+73ADLF/17Vepw0pZNVtYnKoP24GdwKc9X2Y=";
};
nativeBuildInputs = [
diff --git a/pkgs/development/rocm-modules/5/rocr-debug-agent/default.nix b/pkgs/development/rocm-modules/5/rocr-debug-agent/default.nix
index dfc8580b3e14..6dd0ec45b3b6 100644
--- a/pkgs/development/rocm-modules/5/rocr-debug-agent/default.nix
+++ b/pkgs/development/rocm-modules/5/rocr-debug-agent/default.nix
@@ -11,7 +11,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocr-debug-agent";
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "ROCm-Developer-Tools";
diff --git a/pkgs/development/rocm-modules/5/rocrand/default.nix b/pkgs/development/rocm-modules/5/rocrand/default.nix
index 954a299e317e..d61b95394cab 100644
--- a/pkgs/development/rocm-modules/5/rocrand/default.nix
+++ b/pkgs/development/rocm-modules/5/rocrand/default.nix
@@ -14,7 +14,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocrand";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
@@ -28,7 +28,7 @@ stdenv.mkDerivation (finalAttrs: {
owner = "ROCmSoftwarePlatform";
repo = "rocRAND";
rev = "rocm-${finalAttrs.version}";
- hash = "sha256-cFH38fLD8tk6V9JERcqHokuwKemdDgHCZ75bZNEqmdY=";
+ hash = "sha256-VrpiHlZZQH+IOoaEDuDOfRgnMiqm1bpRIuNyrPz2SGY=";
fetchSubmodules = true; # For inline hipRAND
};
diff --git a/pkgs/development/rocm-modules/5/rocsolver/default.nix b/pkgs/development/rocm-modules/5/rocsolver/default.nix
index 6490870ea48a..ade9c69e534e 100644
--- a/pkgs/development/rocm-modules/5/rocsolver/default.nix
+++ b/pkgs/development/rocm-modules/5/rocsolver/default.nix
@@ -18,7 +18,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocsolver";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
diff --git a/pkgs/development/rocm-modules/5/rocsparse/default.nix b/pkgs/development/rocm-modules/5/rocsparse/default.nix
index 945e03c0bc8b..e19334df1514 100644
--- a/pkgs/development/rocm-modules/5/rocsparse/default.nix
+++ b/pkgs/development/rocm-modules/5/rocsparse/default.nix
@@ -19,7 +19,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocsparse";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
diff --git a/pkgs/development/rocm-modules/5/rocthrust/default.nix b/pkgs/development/rocm-modules/5/rocthrust/default.nix
index b80b161f5799..4fe2e0828a16 100644
--- a/pkgs/development/rocm-modules/5/rocthrust/default.nix
+++ b/pkgs/development/rocm-modules/5/rocthrust/default.nix
@@ -14,7 +14,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocthrust";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
@@ -28,7 +28,7 @@ stdenv.mkDerivation (finalAttrs: {
owner = "ROCmSoftwarePlatform";
repo = "rocThrust";
rev = "rocm-${finalAttrs.version}";
- hash = "sha256-i0XCtJth8caVQT5oUgsxWXNzcePa02Gb7AQsthYTOv8=";
+ hash = "sha256-+bcHcA87IToTcII7N/hm81C/JiokJKj0M1yAph/x9Qc=";
};
nativeBuildInputs = [
diff --git a/pkgs/development/rocm-modules/5/roctracer/default.nix b/pkgs/development/rocm-modules/5/roctracer/default.nix
index 92e557426b10..7be3ea0f7505 100644
--- a/pkgs/development/rocm-modules/5/roctracer/default.nix
+++ b/pkgs/development/rocm-modules/5/roctracer/default.nix
@@ -3,14 +3,13 @@
, fetchFromGitHub
, rocmUpdateScript
, cmake
-, clang
, clr
, rocm-device-libs
-, rocprofiler
, libxml2
, doxygen
, graphviz
, gcc-unwrapped
+, libbacktrace
, rocm-runtime
, python3Packages
, buildDocs ? false # Nothing seems to be generated, so not making the output
@@ -19,7 +18,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "roctracer";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
@@ -38,7 +37,6 @@ stdenv.mkDerivation (finalAttrs: {
nativeBuildInputs = [
cmake
- clang
clr
] ++ lib.optionals buildDocs [
doxygen
@@ -46,8 +44,8 @@ stdenv.mkDerivation (finalAttrs: {
];
buildInputs = [
- rocprofiler
libxml2
+ libbacktrace
python3Packages.python
python3Packages.cppheaderparser
];
diff --git a/pkgs/development/rocm-modules/5/rocwmma/default.nix b/pkgs/development/rocm-modules/5/rocwmma/default.nix
index 71d0e3fbe793..e982e036c477 100644
--- a/pkgs/development/rocm-modules/5/rocwmma/default.nix
+++ b/pkgs/development/rocm-modules/5/rocwmma/default.nix
@@ -18,7 +18,7 @@
stdenv.mkDerivation (finalAttrs: {
pname = "rocwmma";
- version = "5.7.0";
+ version = "5.7.1";
outputs = [
"out"
@@ -34,7 +34,7 @@ stdenv.mkDerivation (finalAttrs: {
owner = "ROCmSoftwarePlatform";
repo = "rocWMMA";
rev = "rocm-${finalAttrs.version}";
- hash = "sha256-/EuBBSjhlMwJfsqYvRb9oCNC0hNkEa1JH1KUDLMSs08=";
+ hash = "sha256-0otJxgVYLwvVYIWT/hjrrpuSj5jslP1dbJRt6GUOrDs=";
};
patches = lib.optionals (buildTests || buildBenchmarks) [
diff --git a/pkgs/development/rocm-modules/5/rpp/default.nix b/pkgs/development/rocm-modules/5/rpp/default.nix
index eee10f2ab7c8..a9456587ff3b 100644
--- a/pkgs/development/rocm-modules/5/rpp/default.nix
+++ b/pkgs/development/rocm-modules/5/rpp/default.nix
@@ -23,7 +23,7 @@ stdenv.mkDerivation (finalAttrs: {
else "cpu"
);
- version = "5.7.0";
+ version = "5.7.1";
src = fetchFromGitHub {
owner = "GPUOpen-ProfessionalCompute-Libraries";
diff --git a/pkgs/development/rocm-modules/5/tensile/default.nix b/pkgs/development/rocm-modules/5/tensile/default.nix
index 86dbaa95e192..fa111c056c5c 100644
--- a/pkgs/development/rocm-modules/5/tensile/default.nix
+++ b/pkgs/development/rocm-modules/5/tensile/default.nix
@@ -15,7 +15,7 @@
buildPythonPackage rec {
pname = "tensile";
- version = "5.7.0";
+ version = "5.7.1";
format = "pyproject";
src = fetchFromGitHub {
diff --git a/pkgs/development/rocm-modules/5/update.nix b/pkgs/development/rocm-modules/5/update.nix
index 1cc7e354d240..e20697675c11 100644
--- a/pkgs/development/rocm-modules/5/update.nix
+++ b/pkgs/development/rocm-modules/5/update.nix
@@ -5,8 +5,8 @@
{ name ? ""
, owner ? ""
, repo ? ""
-, page ? "releases?per_page=1"
-, filter ? ".[0].tag_name | split(\"-\") | .[1]"
+, page ? "releases/latest"
+, filter ? ".tag_name | split(\"-\") | .[1]"
}:
let
diff --git a/pkgs/development/tools/analysis/checkov/default.nix b/pkgs/development/tools/analysis/checkov/default.nix
index f9655b201746..34bb4303724b 100644
--- a/pkgs/development/tools/analysis/checkov/default.nix
+++ b/pkgs/development/tools/analysis/checkov/default.nix
@@ -22,14 +22,14 @@ with py.pkgs;
buildPythonApplication rec {
pname = "checkov";
- version = "2.5.14";
+ version = "2.5.15";
format = "setuptools";
src = fetchFromGitHub {
owner = "bridgecrewio";
repo = pname;
rev = "refs/tags/${version}";
- hash = "sha256-4F8cGcQJy8cbCE0wxM6B4qGjuc+SjeL7DMr6RdSkXBM=";
+ hash = "sha256-PVx66Ipvf+rISkuu9dw2ecFXXmuzITg2PogqRktFh5M=";
};
patches = [
diff --git a/pkgs/development/tools/analysis/rizin/default.nix b/pkgs/development/tools/analysis/rizin/default.nix
index e6b20bd5e159..d4bd1e84b112 100644
--- a/pkgs/development/tools/analysis/rizin/default.nix
+++ b/pkgs/development/tools/analysis/rizin/default.nix
@@ -25,11 +25,11 @@
let rizin = stdenv.mkDerivation rec {
pname = "rizin";
- version = "0.6.2";
+ version = "0.6.3";
src = fetchurl {
url = "https://github.com/rizinorg/rizin/releases/download/v${version}/rizin-src-v${version}.tar.xz";
- hash = "sha256-4poAo+IgBL3RAUbShrHM4OBhltQarkcpqvydeDIf+Gs=";
+ hash = "sha256-lfZMarnm2qnp+lY0OY649s206/LoFNouTLlp0x9FCcI=";
};
mesonFlags = [
diff --git a/pkgs/development/tools/clj-kondo/default.nix b/pkgs/development/tools/clj-kondo/default.nix
index 20f905a50ec9..dc78761cc256 100644
--- a/pkgs/development/tools/clj-kondo/default.nix
+++ b/pkgs/development/tools/clj-kondo/default.nix
@@ -2,11 +2,11 @@
buildGraalvmNativeImage rec {
pname = "clj-kondo";
- version = "2023.09.07";
+ version = "2023.10.20";
src = fetchurl {
url = "https://github.com/clj-kondo/${pname}/releases/download/v${version}/${pname}-${version}-standalone.jar";
- sha256 = "sha256-F7ePdITYKkGB6nsR3EFJ7zLDCUoT0g3i+AAjXzBd624=";
+ sha256 = "sha256-f9u/pk3CEEmiLgnS2biaUHpsMHjVEwZL2jyB/1PiZUY=";
};
extraNativeImageBuildArgs = [
diff --git a/pkgs/development/tools/database/timescaledb-tune/default.nix b/pkgs/development/tools/database/timescaledb-tune/default.nix
index 1fa12861d921..0236a5f51f3d 100644
--- a/pkgs/development/tools/database/timescaledb-tune/default.nix
+++ b/pkgs/development/tools/database/timescaledb-tune/default.nix
@@ -2,13 +2,13 @@
buildGoModule rec {
pname = "timescaledb-tune";
- version = "0.14.3";
+ version = "0.14.4";
src = fetchFromGitHub {
owner = "timescale";
repo = pname;
rev = "v${version}";
- sha256 = "sha256-MQi8A7eWOShP/VhxuX4Uhz1ueLtKvOi1x4E7aFXEsQo=";
+ sha256 = "sha256-lCbxGW6+/r5AnsSXvrE7jYL1ZywcTlb4RK3MurL1JWg=";
};
vendorHash = "sha256-yXWeINubvfZ2S+3gVFsrzeVO3XXIiZ14qfK+9Bj3SV4=";
diff --git a/pkgs/development/tools/electron/binary/generic.nix b/pkgs/development/tools/electron/binary/generic.nix
index cbd908098965..6e1493528e2b 100644
--- a/pkgs/development/tools/electron/binary/generic.nix
+++ b/pkgs/development/tools/electron/binary/generic.nix
@@ -40,7 +40,7 @@ let
++ optionals (versionAtLeast version "11.0.0") [ "aarch64-darwin" ]
++ optionals (versionOlder version "19.0.0") [ "i686-linux" ];
sourceProvenance = with sourceTypes; [ binaryNativeCode ];
- knownVulnerabilities = optional (versionOlder version "22.0.0" || versions.major version == "23") "Electron version ${version} is EOL";
+ knownVulnerabilities = optional (versionOlder version "25.0.0") "Electron version ${version} is EOL";
};
fetcher = vers: tag: hash: fetchurl {
diff --git a/pkgs/development/tools/electron/info.json b/pkgs/development/tools/electron/info.json
index 92c4ce68c63c..a3b470f78d7b 100644
--- a/pkgs/development/tools/electron/info.json
+++ b/pkgs/development/tools/electron/info.json
@@ -884,7 +884,7 @@
"version": "2023-09-12",
"url": "https://gn.googlesource.com/gn",
"rev": "991530ce394efb58fcd848195469022fa17ae126",
- "sha256": "1zpbaspb2mncbsabps8n1iwzc67nhr79ndc9dnqxx1w1qfvaldg2"
+ "hash": "sha256-4jWqtsOBh96xbYk1m06G9hj2eQwW6buUXsxWsa5W6/4="
}
}
},
@@ -1776,7 +1776,7 @@
"version": "2023-08-10",
"url": "https://gn.googlesource.com/gn",
"rev": "cc56a0f98bb34accd5323316e0292575ff17a5d4",
- "sha256": "1ly7z48v147bfdb1kqkbc98myxpgqq3g6vgr8bjx1ikrk17l82ab"
+ "hash": "sha256-SwlET5h5xtDlQvlt8wbG73ZfUWJr4hlWc+uQsBH5x9M="
}
}
},
@@ -2620,7 +2620,7 @@
"version": "2023-06-09",
"url": "https://gn.googlesource.com/gn",
"rev": "4bd1a77e67958fb7f6739bd4542641646f264e5d",
- "sha256": "14h9jqspb86sl5lhh6q0kk2rwa9zcak63f8drp7kb3r4dx08vzsw"
+ "hash": "sha256-XP+NQG8kjzXPzQ25YaZiPymexZwAGwhpodqgdTWWCZI="
}
}
},
@@ -3440,7 +3440,7 @@
"version": "2023-04-19",
"url": "https://gn.googlesource.com/gn",
"rev": "5a004f9427a050c6c393c07ddb85cba8ff3849fa",
- "sha256": "01xrh9m9m6x8lz0vxwdw2mrhrvnw93zpg09hwdhqakj06agf4jjk"
+ "hash": "sha256-U0rinjJAToVh4zCBd/9I3O4McxW88b7Bp6ibmmqCuQc="
}
}
},
diff --git a/pkgs/development/tools/electron/update.py b/pkgs/development/tools/electron/update.py
index 1ea11bd5bba9..128b1dc05067 100755
--- a/pkgs/development/tools/electron/update.py
+++ b/pkgs/development/tools/electron/update.py
@@ -188,7 +188,7 @@ def get_gn_source(repo):
"version": datetime.fromisoformat(gn["date"]).date().isoformat(),
"url": gn["url"],
"rev": gn["rev"],
- "sha256": gn["sha256"]
+ "hash": gn["hash"]
}
}
diff --git a/pkgs/development/tools/flyway/default.nix b/pkgs/development/tools/flyway/default.nix
index d9cffc192506..cd42388f0f82 100644
--- a/pkgs/development/tools/flyway/default.nix
+++ b/pkgs/development/tools/flyway/default.nix
@@ -32,6 +32,7 @@ stdenv.mkDerivation (finalAttrs: {
This package is only the Community Edition of the Flyway command-line tool.
'';
+ mainProgram = "flyway";
downloadPage = "https://github.com/flyway/flyway";
homepage = "https://flywaydb.org/";
changelog = "https://documentation.red-gate.com/fd/release-notes-for-flyway-engine-179732572.html";
diff --git a/pkgs/development/tools/golangci-lint/default.nix b/pkgs/development/tools/golangci-lint/default.nix
index 5bfb0996e660..62aaf9973c8b 100644
--- a/pkgs/development/tools/golangci-lint/default.nix
+++ b/pkgs/development/tools/golangci-lint/default.nix
@@ -2,16 +2,16 @@
buildGoModule rec {
pname = "golangci-lint";
- version = "1.54.2";
+ version = "1.55.0";
src = fetchFromGitHub {
owner = "golangci";
repo = "golangci-lint";
rev = "v${version}";
- hash = "sha256-7nbgiUrp7S7sXt7uFXX8NHYbIRLZZQcg+18IdwAZBfE=";
+ hash = "sha256-77bhXeABkV6WZCzoGnRS447pEVcJyj4AF+wihJe62fc=";
};
- vendorHash = "sha256-IyH5lG2a4zjsg/MUonCUiAgMl4xx8zSflRyzNgk8MR0=";
+ vendorHash = "sha256-3aHLilu+AZ6376bn9eS8kmSfo6fXikOFJKDRCYu+4a0=";
subPackages = [ "cmd/golangci-lint" ];
diff --git a/pkgs/development/tools/java/dex2jar/default.nix b/pkgs/development/tools/java/dex2jar/default.nix
index 97fa2298b051..e0ce19dc8d2f 100644
--- a/pkgs/development/tools/java/dex2jar/default.nix
+++ b/pkgs/development/tools/java/dex2jar/default.nix
@@ -8,11 +8,11 @@
stdenvNoCC.mkDerivation (finalAttrs: {
pname = "dex2jar";
- version = "2.1";
+ version = "2.4";
src = fetchurl {
- url = "https://github.com/pxb1988/dex2jar/releases/download/v${finalAttrs.version}/dex2jar-${finalAttrs.version}.zip";
- hash = "sha256-epvfhD1D3k0elOwue29VglAXsMSn7jn/gmYOJJOkbwg=";
+ url = "https://github.com/pxb1988/dex2jar/releases/download/v${finalAttrs.version}/dex-tools-v${finalAttrs.version}.zip";
+ hash = "sha256-7nxF6zwdJHSmFF2NRH5lGnNqItlmS209O+WlqBfdojo=";
};
nativeBuildInputs = [ makeWrapper unzip ];
diff --git a/pkgs/development/tools/misc/dart-sass/default.nix b/pkgs/development/tools/misc/dart-sass/default.nix
index a137f5b21ba6..6737e791f952 100644
--- a/pkgs/development/tools/misc/dart-sass/default.nix
+++ b/pkgs/development/tools/misc/dart-sass/default.nix
@@ -29,6 +29,7 @@ buildDartApplication rec {
};
pubspecLockFile = ./pubspec.lock;
+ depsListFile = ./deps.json;
vendorHash = "sha256-PQvY+qFXovSXH5wuc60wCrt5RiooKcaGKYzbjKSvqso=";
nativeBuildInputs = [
diff --git a/pkgs/development/tools/misc/dart-sass/deps.json b/pkgs/development/tools/misc/dart-sass/deps.json
new file mode 100644
index 000000000000..75548f50d900
--- /dev/null
+++ b/pkgs/development/tools/misc/dart-sass/deps.json
@@ -0,0 +1,930 @@
+[
+ {
+ "name": "sass",
+ "version": "1.69.0",
+ "kind": "root",
+ "source": "root",
+ "dependencies": [
+ "args",
+ "async",
+ "charcode",
+ "cli_pkg",
+ "cli_repl",
+ "collection",
+ "http",
+ "js",
+ "meta",
+ "native_synchronization",
+ "node_interop",
+ "package_config",
+ "path",
+ "pool",
+ "protobuf",
+ "pub_semver",
+ "source_maps",
+ "source_span",
+ "stack_trace",
+ "stream_channel",
+ "stream_transform",
+ "string_scanner",
+ "term_glyph",
+ "typed_data",
+ "watcher",
+ "analyzer",
+ "archive",
+ "crypto",
+ "dart_style",
+ "dartdoc",
+ "grinder",
+ "node_preamble",
+ "lints",
+ "protoc_plugin",
+ "pub_api_client",
+ "pubspec_parse",
+ "test",
+ "test_descriptor",
+ "test_process",
+ "yaml",
+ "cli_util"
+ ]
+ },
+ {
+ "name": "cli_util",
+ "version": "0.4.0",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "meta",
+ "path"
+ ]
+ },
+ {
+ "name": "path",
+ "version": "1.8.3",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "meta",
+ "version": "1.10.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "yaml",
+ "version": "3.1.2",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "source_span",
+ "string_scanner"
+ ]
+ },
+ {
+ "name": "string_scanner",
+ "version": "1.2.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "source_span"
+ ]
+ },
+ {
+ "name": "source_span",
+ "version": "1.10.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "path",
+ "term_glyph"
+ ]
+ },
+ {
+ "name": "term_glyph",
+ "version": "1.2.1",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "collection",
+ "version": "1.18.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "test_process",
+ "version": "2.1.0",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "meta",
+ "path",
+ "test"
+ ]
+ },
+ {
+ "name": "test",
+ "version": "1.24.6",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "analyzer",
+ "async",
+ "boolean_selector",
+ "collection",
+ "coverage",
+ "http_multi_server",
+ "io",
+ "js",
+ "matcher",
+ "node_preamble",
+ "package_config",
+ "path",
+ "pool",
+ "shelf",
+ "shelf_packages_handler",
+ "shelf_static",
+ "shelf_web_socket",
+ "source_span",
+ "stack_trace",
+ "stream_channel",
+ "test_api",
+ "test_core",
+ "typed_data",
+ "web_socket_channel",
+ "webkit_inspection_protocol",
+ "yaml"
+ ]
+ },
+ {
+ "name": "webkit_inspection_protocol",
+ "version": "1.2.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "logging"
+ ]
+ },
+ {
+ "name": "logging",
+ "version": "1.2.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "web_socket_channel",
+ "version": "2.4.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "crypto",
+ "stream_channel"
+ ]
+ },
+ {
+ "name": "stream_channel",
+ "version": "2.1.2",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "async"
+ ]
+ },
+ {
+ "name": "async",
+ "version": "2.11.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "meta"
+ ]
+ },
+ {
+ "name": "crypto",
+ "version": "3.0.3",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "typed_data"
+ ]
+ },
+ {
+ "name": "typed_data",
+ "version": "1.3.2",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "collection"
+ ]
+ },
+ {
+ "name": "test_core",
+ "version": "0.5.6",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "analyzer",
+ "args",
+ "async",
+ "boolean_selector",
+ "collection",
+ "coverage",
+ "frontend_server_client",
+ "glob",
+ "io",
+ "meta",
+ "package_config",
+ "path",
+ "pool",
+ "source_map_stack_trace",
+ "source_maps",
+ "source_span",
+ "stack_trace",
+ "stream_channel",
+ "test_api",
+ "vm_service",
+ "yaml"
+ ]
+ },
+ {
+ "name": "vm_service",
+ "version": "11.10.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "test_api",
+ "version": "0.6.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "boolean_selector",
+ "collection",
+ "meta",
+ "source_span",
+ "stack_trace",
+ "stream_channel",
+ "string_scanner",
+ "term_glyph"
+ ]
+ },
+ {
+ "name": "stack_trace",
+ "version": "1.11.1",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "path"
+ ]
+ },
+ {
+ "name": "boolean_selector",
+ "version": "2.1.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "source_span",
+ "string_scanner"
+ ]
+ },
+ {
+ "name": "source_maps",
+ "version": "0.10.12",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "source_span"
+ ]
+ },
+ {
+ "name": "source_map_stack_trace",
+ "version": "2.1.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "path",
+ "source_maps",
+ "stack_trace"
+ ]
+ },
+ {
+ "name": "pool",
+ "version": "1.5.1",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "stack_trace"
+ ]
+ },
+ {
+ "name": "package_config",
+ "version": "2.1.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "path"
+ ]
+ },
+ {
+ "name": "io",
+ "version": "1.0.4",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "meta",
+ "path",
+ "string_scanner"
+ ]
+ },
+ {
+ "name": "glob",
+ "version": "2.1.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "collection",
+ "file",
+ "path",
+ "string_scanner"
+ ]
+ },
+ {
+ "name": "file",
+ "version": "7.0.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "meta",
+ "path"
+ ]
+ },
+ {
+ "name": "frontend_server_client",
+ "version": "3.2.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "path"
+ ]
+ },
+ {
+ "name": "coverage",
+ "version": "1.6.3",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "args",
+ "logging",
+ "package_config",
+ "path",
+ "source_maps",
+ "stack_trace",
+ "vm_service"
+ ]
+ },
+ {
+ "name": "args",
+ "version": "2.4.2",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "analyzer",
+ "version": "5.13.0",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "_fe_analyzer_shared",
+ "collection",
+ "convert",
+ "crypto",
+ "glob",
+ "meta",
+ "package_config",
+ "path",
+ "pub_semver",
+ "source_span",
+ "watcher",
+ "yaml"
+ ]
+ },
+ {
+ "name": "watcher",
+ "version": "1.1.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "path"
+ ]
+ },
+ {
+ "name": "pub_semver",
+ "version": "2.1.4",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "meta"
+ ]
+ },
+ {
+ "name": "convert",
+ "version": "3.1.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "typed_data"
+ ]
+ },
+ {
+ "name": "_fe_analyzer_shared",
+ "version": "61.0.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "meta"
+ ]
+ },
+ {
+ "name": "shelf_web_socket",
+ "version": "1.0.4",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "shelf",
+ "stream_channel",
+ "web_socket_channel"
+ ]
+ },
+ {
+ "name": "shelf",
+ "version": "1.4.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "collection",
+ "http_parser",
+ "path",
+ "stack_trace",
+ "stream_channel"
+ ]
+ },
+ {
+ "name": "http_parser",
+ "version": "4.0.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "source_span",
+ "string_scanner",
+ "typed_data"
+ ]
+ },
+ {
+ "name": "shelf_static",
+ "version": "1.1.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "convert",
+ "http_parser",
+ "mime",
+ "path",
+ "shelf"
+ ]
+ },
+ {
+ "name": "mime",
+ "version": "1.0.4",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "shelf_packages_handler",
+ "version": "3.0.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "path",
+ "shelf",
+ "shelf_static"
+ ]
+ },
+ {
+ "name": "node_preamble",
+ "version": "2.0.2",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "matcher",
+ "version": "0.12.16",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "meta",
+ "stack_trace",
+ "term_glyph",
+ "test_api"
+ ]
+ },
+ {
+ "name": "js",
+ "version": "0.6.7",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "meta"
+ ]
+ },
+ {
+ "name": "http_multi_server",
+ "version": "3.2.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async"
+ ]
+ },
+ {
+ "name": "test_descriptor",
+ "version": "2.0.1",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "collection",
+ "matcher",
+ "meta",
+ "path",
+ "term_glyph",
+ "test"
+ ]
+ },
+ {
+ "name": "pubspec_parse",
+ "version": "1.2.3",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "checked_yaml",
+ "collection",
+ "json_annotation",
+ "pub_semver",
+ "yaml"
+ ]
+ },
+ {
+ "name": "json_annotation",
+ "version": "4.8.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "meta"
+ ]
+ },
+ {
+ "name": "checked_yaml",
+ "version": "2.0.3",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "json_annotation",
+ "source_span",
+ "yaml"
+ ]
+ },
+ {
+ "name": "pub_api_client",
+ "version": "2.6.0",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "http",
+ "oauth2",
+ "path",
+ "pubspec"
+ ]
+ },
+ {
+ "name": "pubspec",
+ "version": "2.3.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "path",
+ "pub_semver",
+ "yaml",
+ "uri"
+ ]
+ },
+ {
+ "name": "uri",
+ "version": "1.0.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "matcher",
+ "quiver"
+ ]
+ },
+ {
+ "name": "quiver",
+ "version": "3.2.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "matcher"
+ ]
+ },
+ {
+ "name": "oauth2",
+ "version": "2.0.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "crypto",
+ "http",
+ "http_parser"
+ ]
+ },
+ {
+ "name": "http",
+ "version": "1.1.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "http_parser",
+ "meta"
+ ]
+ },
+ {
+ "name": "protoc_plugin",
+ "version": "21.1.1",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "fixnum",
+ "path",
+ "protobuf"
+ ]
+ },
+ {
+ "name": "protobuf",
+ "version": "3.1.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "fixnum",
+ "meta"
+ ]
+ },
+ {
+ "name": "fixnum",
+ "version": "1.1.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "lints",
+ "version": "2.1.1",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "grinder",
+ "version": "0.9.4",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "cli_util",
+ "glob",
+ "meta",
+ "path",
+ "collection"
+ ]
+ },
+ {
+ "name": "dartdoc",
+ "version": "6.3.0",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "analyzer",
+ "args",
+ "cli_util",
+ "collection",
+ "crypto",
+ "glob",
+ "html",
+ "logging",
+ "markdown",
+ "meta",
+ "package_config",
+ "path",
+ "pub_semver",
+ "source_span",
+ "yaml"
+ ]
+ },
+ {
+ "name": "markdown",
+ "version": "7.1.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "args",
+ "meta"
+ ]
+ },
+ {
+ "name": "html",
+ "version": "0.15.4",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "csslib",
+ "source_span"
+ ]
+ },
+ {
+ "name": "csslib",
+ "version": "1.0.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "source_span"
+ ]
+ },
+ {
+ "name": "dart_style",
+ "version": "2.3.2",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "analyzer",
+ "args",
+ "path",
+ "pub_semver",
+ "source_span"
+ ]
+ },
+ {
+ "name": "archive",
+ "version": "3.3.9",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "crypto",
+ "path",
+ "pointycastle"
+ ]
+ },
+ {
+ "name": "pointycastle",
+ "version": "3.7.3",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "convert",
+ "js"
+ ]
+ },
+ {
+ "name": "stream_transform",
+ "version": "2.1.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "node_interop",
+ "version": "2.1.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "js"
+ ]
+ },
+ {
+ "name": "native_synchronization",
+ "version": "0.2.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "ffi"
+ ]
+ },
+ {
+ "name": "ffi",
+ "version": "2.1.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "cli_repl",
+ "version": "0.2.3",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "js"
+ ]
+ },
+ {
+ "name": "cli_pkg",
+ "version": "2.5.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "archive",
+ "async",
+ "charcode",
+ "cli_util",
+ "collection",
+ "crypto",
+ "glob",
+ "grinder",
+ "http",
+ "js",
+ "meta",
+ "node_interop",
+ "node_preamble",
+ "package_config",
+ "path",
+ "pool",
+ "pub_semver",
+ "pubspec_parse",
+ "retry",
+ "string_scanner",
+ "test",
+ "test_process",
+ "xml",
+ "yaml"
+ ]
+ },
+ {
+ "name": "xml",
+ "version": "6.4.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "meta",
+ "petitparser"
+ ]
+ },
+ {
+ "name": "petitparser",
+ "version": "6.0.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "meta"
+ ]
+ },
+ {
+ "name": "retry",
+ "version": "3.1.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "charcode",
+ "version": "1.3.1",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": []
+ }
+]
diff --git a/pkgs/development/tools/misc/texlab/default.nix b/pkgs/development/tools/misc/texlab/default.nix
index e33a288286ee..9bc36338ff2e 100644
--- a/pkgs/development/tools/misc/texlab/default.nix
+++ b/pkgs/development/tools/misc/texlab/default.nix
@@ -15,16 +15,16 @@ let
in
rustPlatform.buildRustPackage rec {
pname = "texlab";
- version = "5.10.0";
+ version = "5.10.1";
src = fetchFromGitHub {
owner = "latex-lsp";
repo = "texlab";
rev = "refs/tags/v${version}";
- hash = "sha256-MTWaGgDIDo3CaRHyHWqliKsPdbU/TZPsyfF7SoHTnhk=";
+ hash = "sha256-ACdiFkV138jDIrRe+baYo+r9vCO4cyRyO2ck7OKakFY=";
};
- cargoHash = "sha256-8Vrp4d5luf91pKpUC4wWn4otsanqopCHwCjcnfTzyLk=";
+ cargoHash = "sha256-bEeQOOucXd4HNTR6SmidAfDkZ1tT7ORmUxrNx+3FNRw=";
outputs = [ "out" ] ++ lib.optional (!isCross) "man";
@@ -41,7 +41,7 @@ rustPlatform.buildRustPackage rec {
# generate the man page
postInstall = lib.optionalString (!isCross) ''
# TexLab builds man page separately in CI:
- # https://github.com/latex-lsp/texlab/blob/v5.9.2/.github/workflows/publish.yml#L117-L121
+ # https://github.com/latex-lsp/texlab/blob/v5.10.1/.github/workflows/publish.yml#L117-L121
help2man --no-info "$out/bin/texlab" > texlab.1
installManPage texlab.1
'';
diff --git a/pkgs/development/tools/protoc-gen-dart/default.nix b/pkgs/development/tools/protoc-gen-dart/default.nix
index 29892b954fc7..fa11e1b60e80 100644
--- a/pkgs/development/tools/protoc-gen-dart/default.nix
+++ b/pkgs/development/tools/protoc-gen-dart/default.nix
@@ -16,6 +16,7 @@ buildDartApplication rec {
sourceRoot = "${src.name}/protoc_plugin";
pubspecLockFile = ./pubspec.lock;
+ depsListFile = ./deps.json;
vendorHash = "sha256-yNgQLCLDCbA07v9tIwPRks/xPAzLVykNtIk+8C0twYM=";
meta = with lib; {
diff --git a/pkgs/development/tools/protoc-gen-dart/deps.json b/pkgs/development/tools/protoc-gen-dart/deps.json
new file mode 100644
index 000000000000..c00a66e0d849
--- /dev/null
+++ b/pkgs/development/tools/protoc-gen-dart/deps.json
@@ -0,0 +1,549 @@
+[
+ {
+ "name": "protoc_plugin",
+ "version": "21.1.0",
+ "kind": "root",
+ "source": "root",
+ "dependencies": [
+ "fixnum",
+ "path",
+ "protobuf",
+ "collection",
+ "dart_flutter_team_lints",
+ "matcher",
+ "test"
+ ]
+ },
+ {
+ "name": "test",
+ "version": "1.24.6",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "analyzer",
+ "async",
+ "boolean_selector",
+ "collection",
+ "coverage",
+ "http_multi_server",
+ "io",
+ "js",
+ "matcher",
+ "node_preamble",
+ "package_config",
+ "path",
+ "pool",
+ "shelf",
+ "shelf_packages_handler",
+ "shelf_static",
+ "shelf_web_socket",
+ "source_span",
+ "stack_trace",
+ "stream_channel",
+ "test_api",
+ "test_core",
+ "typed_data",
+ "web_socket_channel",
+ "webkit_inspection_protocol",
+ "yaml"
+ ]
+ },
+ {
+ "name": "yaml",
+ "version": "3.1.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "source_span",
+ "string_scanner"
+ ]
+ },
+ {
+ "name": "string_scanner",
+ "version": "1.2.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "source_span"
+ ]
+ },
+ {
+ "name": "source_span",
+ "version": "1.10.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "path",
+ "term_glyph"
+ ]
+ },
+ {
+ "name": "term_glyph",
+ "version": "1.2.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "path",
+ "version": "1.8.3",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "collection",
+ "version": "1.18.0",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "webkit_inspection_protocol",
+ "version": "1.2.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "logging"
+ ]
+ },
+ {
+ "name": "logging",
+ "version": "1.2.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "web_socket_channel",
+ "version": "2.4.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "crypto",
+ "stream_channel"
+ ]
+ },
+ {
+ "name": "stream_channel",
+ "version": "2.1.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async"
+ ]
+ },
+ {
+ "name": "async",
+ "version": "2.11.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "meta"
+ ]
+ },
+ {
+ "name": "meta",
+ "version": "1.9.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "crypto",
+ "version": "3.0.3",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "typed_data"
+ ]
+ },
+ {
+ "name": "typed_data",
+ "version": "1.3.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection"
+ ]
+ },
+ {
+ "name": "test_core",
+ "version": "0.5.6",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "analyzer",
+ "args",
+ "async",
+ "boolean_selector",
+ "collection",
+ "coverage",
+ "frontend_server_client",
+ "glob",
+ "io",
+ "meta",
+ "package_config",
+ "path",
+ "pool",
+ "source_map_stack_trace",
+ "source_maps",
+ "source_span",
+ "stack_trace",
+ "stream_channel",
+ "test_api",
+ "vm_service",
+ "yaml"
+ ]
+ },
+ {
+ "name": "vm_service",
+ "version": "11.10.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "test_api",
+ "version": "0.6.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "boolean_selector",
+ "collection",
+ "meta",
+ "source_span",
+ "stack_trace",
+ "stream_channel",
+ "string_scanner",
+ "term_glyph"
+ ]
+ },
+ {
+ "name": "stack_trace",
+ "version": "1.11.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "path"
+ ]
+ },
+ {
+ "name": "boolean_selector",
+ "version": "2.1.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "source_span",
+ "string_scanner"
+ ]
+ },
+ {
+ "name": "source_maps",
+ "version": "0.10.12",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "source_span"
+ ]
+ },
+ {
+ "name": "source_map_stack_trace",
+ "version": "2.1.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "path",
+ "source_maps",
+ "stack_trace"
+ ]
+ },
+ {
+ "name": "pool",
+ "version": "1.5.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "stack_trace"
+ ]
+ },
+ {
+ "name": "package_config",
+ "version": "2.1.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "path"
+ ]
+ },
+ {
+ "name": "io",
+ "version": "1.0.4",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "meta",
+ "path",
+ "string_scanner"
+ ]
+ },
+ {
+ "name": "glob",
+ "version": "2.1.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "collection",
+ "file",
+ "path",
+ "string_scanner"
+ ]
+ },
+ {
+ "name": "file",
+ "version": "7.0.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "meta",
+ "path"
+ ]
+ },
+ {
+ "name": "frontend_server_client",
+ "version": "3.2.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "path"
+ ]
+ },
+ {
+ "name": "coverage",
+ "version": "1.6.3",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "args",
+ "logging",
+ "package_config",
+ "path",
+ "source_maps",
+ "stack_trace",
+ "vm_service"
+ ]
+ },
+ {
+ "name": "args",
+ "version": "2.4.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "analyzer",
+ "version": "6.2.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "_fe_analyzer_shared",
+ "collection",
+ "convert",
+ "crypto",
+ "glob",
+ "meta",
+ "package_config",
+ "path",
+ "pub_semver",
+ "source_span",
+ "watcher",
+ "yaml"
+ ]
+ },
+ {
+ "name": "watcher",
+ "version": "1.1.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "path"
+ ]
+ },
+ {
+ "name": "pub_semver",
+ "version": "2.1.4",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "meta"
+ ]
+ },
+ {
+ "name": "convert",
+ "version": "3.1.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "typed_data"
+ ]
+ },
+ {
+ "name": "_fe_analyzer_shared",
+ "version": "64.0.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "meta"
+ ]
+ },
+ {
+ "name": "shelf_web_socket",
+ "version": "1.0.4",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "shelf",
+ "stream_channel",
+ "web_socket_channel"
+ ]
+ },
+ {
+ "name": "shelf",
+ "version": "1.4.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "collection",
+ "http_parser",
+ "path",
+ "stack_trace",
+ "stream_channel"
+ ]
+ },
+ {
+ "name": "http_parser",
+ "version": "4.0.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "source_span",
+ "string_scanner",
+ "typed_data"
+ ]
+ },
+ {
+ "name": "shelf_static",
+ "version": "1.1.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "convert",
+ "http_parser",
+ "mime",
+ "path",
+ "shelf"
+ ]
+ },
+ {
+ "name": "mime",
+ "version": "1.0.4",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "shelf_packages_handler",
+ "version": "3.0.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "path",
+ "shelf",
+ "shelf_static"
+ ]
+ },
+ {
+ "name": "node_preamble",
+ "version": "2.0.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "matcher",
+ "version": "0.12.16",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "meta",
+ "stack_trace",
+ "term_glyph",
+ "test_api"
+ ]
+ },
+ {
+ "name": "js",
+ "version": "0.6.7",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "meta"
+ ]
+ },
+ {
+ "name": "http_multi_server",
+ "version": "3.2.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async"
+ ]
+ },
+ {
+ "name": "dart_flutter_team_lints",
+ "version": "1.0.0",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": [
+ "lints"
+ ]
+ },
+ {
+ "name": "lints",
+ "version": "2.1.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "protobuf",
+ "version": "3.1.0",
+ "kind": "direct",
+ "source": "path",
+ "dependencies": [
+ "collection",
+ "fixnum",
+ "meta"
+ ]
+ },
+ {
+ "name": "fixnum",
+ "version": "1.1.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": []
+ }
+]
diff --git a/pkgs/development/tools/rust/cargo-codspeed/default.nix b/pkgs/development/tools/rust/cargo-codspeed/default.nix
index f2a9376e2fa3..d27f17bfac2f 100644
--- a/pkgs/development/tools/rust/cargo-codspeed/default.nix
+++ b/pkgs/development/tools/rust/cargo-codspeed/default.nix
@@ -12,16 +12,16 @@
rustPlatform.buildRustPackage rec {
pname = "cargo-codspeed";
- version = "2.2.0";
+ version = "2.3.0";
src = fetchFromGitHub {
owner = "CodSpeedHQ";
repo = "codspeed-rust";
rev = "v${version}";
- hash = "sha256-AGbo38weLBPxkaXgJpi+FXGuhPh7nyZcJOhw6BCDYOc=";
+ hash = "sha256-oI6IfKvX+Zn3tYPXQVxHRQymVz4bBvXfg3mcrjClbY4=";
};
- cargoHash = "sha256-NR+Z5oMaReEOZrLk7d/pB1F37k8tE7FXh4HdVnh+YFc=";
+ cargoHash = "sha256-ZZhYmyWoqZ8SbRpXCA5XsKCdeqAKAcE1NdNlrHhBiYI=";
nativeBuildInputs = [
curl
diff --git a/pkgs/development/tools/selenium/chromedriver/default.nix b/pkgs/development/tools/selenium/chromedriver/default.nix
index f17208fbfbdd..55ce40832f9e 100644
--- a/pkgs/development/tools/selenium/chromedriver/default.nix
+++ b/pkgs/development/tools/selenium/chromedriver/default.nix
@@ -10,17 +10,17 @@ let
allSpecs = {
x86_64-linux = {
system = "linux64";
- sha256 = upstream-info.sha256_linux;
+ hash = upstream-info.hash_linux;
};
x86_64-darwin = {
system = "mac-x64";
- sha256 = upstream-info.sha256_darwin;
+ hash = upstream-info.hash_darwin;
};
aarch64-darwin = {
system = "mac-arm64";
- sha256 = upstream-info.sha256_darwin_aarch64;
+ hash = upstream-info.hash_darwin_aarch64;
};
};
@@ -42,7 +42,7 @@ in stdenv.mkDerivation rec {
src = fetchurl {
url = "https://edgedl.me.gvt1.com/edgedl/chrome/chrome-for-testing/${version}/${spec.system}/chromedriver-${spec.system}.zip";
- sha256 = spec.sha256;
+ hash = spec.hash;
};
nativeBuildInputs = [ unzip makeWrapper ];
diff --git a/pkgs/development/web/minify/default.nix b/pkgs/development/web/minify/default.nix
index 1c832bb456db..86ef8a4759f2 100644
--- a/pkgs/development/web/minify/default.nix
+++ b/pkgs/development/web/minify/default.nix
@@ -9,16 +9,16 @@
buildGoModule rec {
pname = "minify";
- version = "2.12.9";
+ version = "2.19.10";
src = fetchFromGitHub {
owner = "tdewolff";
repo = pname;
rev = "v${version}";
- hash = "sha256-+NBYn+gEsoclROnq2msNB4knviGn/XA9vNAuB0JZNek=";
+ hash = "sha256-/OfNHhWbRZI7nRhBnjXfxL4Gf011ydlwEMDadCptFJY=";
};
- vendorHash = "sha256-/Pw7fHVXWsovxfyzkWfb6UiRDBmiua82667N4Scl5+A=";
+ vendorHash = "sha256-ZtQbhhdt9mGRbTpgm6O4wnSPoKF9bAEswppmK+Urqhs=";
nativeBuildInputs = [ installShellFiles ];
diff --git a/pkgs/games/openra/build-engine.nix b/pkgs/games/openra/build-engine.nix
index 664a4c0735b3..10e8b4939215 100644
--- a/pkgs/games/openra/build-engine.nix
+++ b/pkgs/games/openra/build-engine.nix
@@ -36,7 +36,7 @@ buildDotnetModule rec {
dontDotnetFixup = true;
preBuild = ''
- make VERSION=${version} version
+ make VERSION=${engine.build}-${version} version
'';
postInstall = ''
diff --git a/pkgs/games/starsector/default.nix b/pkgs/games/starsector/default.nix
index 3951f36f83bf..e1bc4a8dbbcf 100644
--- a/pkgs/games/starsector/default.nix
+++ b/pkgs/games/starsector/default.nix
@@ -13,11 +13,11 @@
stdenv.mkDerivation rec {
pname = "starsector";
- version = "0.96a-RC8";
+ version = "0.96a-RC10";
src = fetchzip {
- url = "https://s3.amazonaws.com/fractalsoftworks/starsector/starsector_linux-${version}.zip";
- sha256 = "sha256-RDXqFqiWpBG3kasofzbOl7Zp0a9LiMpJKsHcFaJtm2Y=";
+ url = "https://f005.backblazeb2.com/file/fractalsoftworks/release/starsector_linux-${version}.zip";
+ sha256 = "sha256-RBSnms+QlKgTOhm3t2hDfv7OcMrQCk1rfkz9GaM74WM=";
};
nativeBuildInputs = [ copyDesktopItems makeWrapper ];
@@ -82,7 +82,7 @@ stdenv.mkDerivation rec {
#!/usr/bin/env nix-shell
#!nix-shell -i bash -p curl gnugrep common-updater-scripts
set -eou pipefail;
- version=$(curl -s https://fractalsoftworks.com/preorder/ | grep -oP "https://s3.amazonaws.com/fractalsoftworks/starsector/starsector_linux-\K.*?(?=\.zip)" | head -1)
+ version=$(curl -s https://fractalsoftworks.com/preorder/ | grep -oP "https://f005.backblazeb2.com/file/fractalsoftworks/release/starsector_linux-\K.*?(?=\.zip)" | head -1)
update-source-version ${pname} "$version" --file=./pkgs/games/starsector/default.nix
'';
}
diff --git a/pkgs/games/steam/fhsenv.nix b/pkgs/games/steam/fhsenv.nix
index a6734b640638..78c669614c07 100644
--- a/pkgs/games/steam/fhsenv.nix
+++ b/pkgs/games/steam/fhsenv.nix
@@ -3,6 +3,7 @@
, extraPkgs ? pkgs: [ ] # extra packages to add to targetPkgs
, extraLibraries ? pkgs: [ ] # extra packages to add to multiPkgs
, extraProfile ? "" # string to append to profile
+, extraBwrapArgs ? [ ] # extra arguments to pass to bubblewrap
, extraArgs ? "" # arguments to always pass to steam
, extraEnv ? { } # Environment variables to pass to Steam
, withGameSpecificLibraries ? true # include game specific libraries
@@ -277,6 +278,8 @@ in buildFHSEnv rec {
exec steam ${extraArgs} "$@"
'';
+ inherit extraBwrapArgs;
+
meta =
if steam != null
then
@@ -287,21 +290,11 @@ in buildFHSEnv rec {
description = "Steam dependencies (dummy package, do not use)";
};
- # allows for some gui applications to share IPC
- # this fixes certain issues where they don't render correctly
- unshareIpc = false;
-
- # Some applications such as Natron need access to MIT-SHM or other
- # shared memory mechanisms. Unsharing the pid namespace
- # breaks the ability for application to reference shared memory.
- unsharePid = false;
-
passthru.run = buildFHSEnv {
name = "steam-run";
targetPkgs = commonTargetPkgs;
- inherit multiArch multiPkgs profile extraInstallCommands;
- inherit unshareIpc unsharePid;
+ inherit multiArch multiPkgs profile extraInstallCommands extraBwrapArgs;
runScript = writeShellScript "steam-run" ''
run="$1"
diff --git a/pkgs/games/unciv/default.nix b/pkgs/games/unciv/default.nix
index f4b350ad38e7..70971fb1ad37 100644
--- a/pkgs/games/unciv/default.nix
+++ b/pkgs/games/unciv/default.nix
@@ -25,11 +25,11 @@ let
in
stdenv.mkDerivation rec {
pname = "unciv";
- version = "4.8.9-patch2";
+ version = "4.8.13";
src = fetchurl {
url = "https://github.com/yairm210/Unciv/releases/download/${version}/Unciv.jar";
- hash = "sha256-ek2FDzo7EbgZGbQyZ6mBmVoPRKkJu0JFewbVvsGzZMA=";
+ hash = "sha256-16TpsKNLcm6lbi4exYxDZWfmRsvfAhT1ktP36zC9Psg=";
};
dontUnpack = true;
diff --git a/pkgs/os-specific/linux/kernel/zen-kernels.nix b/pkgs/os-specific/linux/kernel/zen-kernels.nix
index 716a45820ca5..f978cb429df5 100644
--- a/pkgs/os-specific/linux/kernel/zen-kernels.nix
+++ b/pkgs/os-specific/linux/kernel/zen-kernels.nix
@@ -4,16 +4,16 @@ let
# comments with variant added for update script
# ./update-zen.py zen
zenVariant = {
- version = "6.5.7"; #zen
- suffix = "zen2"; #zen
- sha256 = "0qy3xn7kr16crm7iw1zhm3kpgxpmn66xc4g1yalvghwn6si0n81l"; #zen
+ version = "6.5.8"; #zen
+ suffix = "zen1"; #zen
+ sha256 = "0pg5q5alsxrbbf8hzbcgmwsyirs86715qijdzaldyw9sf74h4z1l"; #zen
isLqx = false;
};
# ./update-zen.py lqx
lqxVariant = {
- version = "6.5.7"; #lqx
+ version = "6.5.8"; #lqx
suffix = "lqx1"; #lqx
- sha256 = "1c4093xhfnzx6h8frqcigdlikgy1n0vv34ajs0237v3w7psw99d7"; #lqx
+ sha256 = "1f10p7mriwjrgmdfz10vs48xiipdk9ljj884fsj63r5n1g7pz4bf"; #lqx
isLqx = true;
};
zenKernelsFor = { version, suffix, sha256, isLqx }: buildLinux (args // {
diff --git a/pkgs/os-specific/linux/zfs/generic.nix b/pkgs/os-specific/linux/zfs/generic.nix
index 81ff2214bcad..7bb4a1b7496e 100644
--- a/pkgs/os-specific/linux/zfs/generic.nix
+++ b/pkgs/os-specific/linux/zfs/generic.nix
@@ -76,25 +76,14 @@ stdenv'.mkDerivation {
substituteInPlace ./config/user-systemd.m4 --replace "/usr/lib/modules-load.d" "$out/etc/modules-load.d"
substituteInPlace ./config/zfs-build.m4 --replace "\$sysconfdir/init.d" "$out/etc/init.d" \
--replace "/etc/default" "$out/etc/default"
- # TODO: drop when upgrading to 2.2.0
- ${if isUnstable then ''
- substituteInPlace ./contrib/initramfs/Makefile.am \
- --replace "/usr/share/initramfs-tools" "$out/usr/share/initramfs-tools"
- substituteInPlace ./udev/vdev_id \
- --replace "PATH=/bin:/sbin:/usr/bin:/usr/sbin" \
- "PATH=${makeBinPath [ coreutils gawk gnused gnugrep systemd ]}"
- substituteInPlace ./config/zfs-build.m4 \
- --replace "bashcompletiondir=/etc/bash_completion.d" \
- "bashcompletiondir=$out/share/bash-completion/completions"
- '' else ''
- substituteInPlace ./etc/zfs/Makefile.am --replace "\$(sysconfdir)/zfs" "$out/etc/zfs"
-
- find ./contrib/initramfs -name Makefile.am -exec sed -i -e 's|/usr/share/initramfs-tools|'$out'/share/initramfs-tools|g' {} \;
-
- substituteInPlace ./cmd/vdev_id/vdev_id \
- --replace "PATH=/bin:/sbin:/usr/bin:/usr/sbin" \
- "PATH=${makeBinPath [ coreutils gawk gnused gnugrep systemd ]}"
- ''}
+ substituteInPlace ./contrib/initramfs/Makefile.am \
+ --replace "/usr/share/initramfs-tools" "$out/usr/share/initramfs-tools"
+ substituteInPlace ./udev/vdev_id \
+ --replace "PATH=/bin:/sbin:/usr/bin:/usr/sbin" \
+ "PATH=${makeBinPath [ coreutils gawk gnused gnugrep systemd ]}"
+ substituteInPlace ./config/zfs-build.m4 \
+ --replace "bashcompletiondir=/etc/bash_completion.d" \
+ "bashcompletiondir=$out/share/bash-completion/completions"
'';
nativeBuildInputs = [ autoreconfHook269 nukeReferences ]
diff --git a/pkgs/os-specific/linux/zfs/stable.nix b/pkgs/os-specific/linux/zfs/stable.nix
index 1a77396300eb..3e53ba902cbd 100644
--- a/pkgs/os-specific/linux/zfs/stable.nix
+++ b/pkgs/os-specific/linux/zfs/stable.nix
@@ -16,20 +16,13 @@ callPackage ./generic.nix args {
if stdenv'.isx86_64 || removeLinuxDRM
then kernel.kernelOlder "6.6"
else kernel.kernelOlder "6.2";
+
latestCompatibleLinuxPackages = if stdenv'.isx86_64 || removeLinuxDRM
then linuxKernel.packages.linux_6_5
else linuxKernel.packages.linux_6_1;
- extraPatches = [
- # applied in version 2.2.x
- (fetchpatch {
- name = "musl.patch";
- url = "https://github.com/openzfs/zfs/commit/1f19826c9ac85835cbde61a7439d9d1fefe43a4a.patch";
- sha256 = "XEaK227ubfOwlB2s851UvZ6xp/QOtYUWYsKTkEHzmo0=";
- })
- ];
# this package should point to the latest release.
- version = "2.1.13";
+ version = "2.2.0";
- sha256 = "tqUCn/Hf/eEmyWRQthWQdmTJK2sDspnHiiEfn9rz2Kc=";
+ sha256 = "sha256-s1sdXSrLu6uSOmjprbUa4cFsE2Vj7JX5i75e4vRnlvg=";
}
diff --git a/pkgs/os-specific/linux/zfs/unstable.nix b/pkgs/os-specific/linux/zfs/unstable.nix
index 23882322c093..9c7e14c31bf3 100644
--- a/pkgs/os-specific/linux/zfs/unstable.nix
+++ b/pkgs/os-specific/linux/zfs/unstable.nix
@@ -23,9 +23,10 @@ callPackage ./generic.nix args {
# IMPORTANT: Always use a tagged release candidate or commits from the
# zfs--staging branch, because this is tested by the OpenZFS
# maintainers.
- version = "2.2.0-rc5";
+ version = "2.2.1-unstable-2023-10-21";
+ rev = "95785196f26e92d82cf4445654ba84e4a9671c57";
- sha256 = "sha256-97dTmSneAuhDR7LrJxG7/xPpI1hGv5mDDuq8HRTZKx0=";
+ sha256 = "sha256-s1sdXSrLu6uSOmjprbUa4cFsE2Vj7JX5i75e4vRnlvg=";
isUnstable = true;
}
diff --git a/pkgs/servers/home-assistant/component-packages.nix b/pkgs/servers/home-assistant/component-packages.nix
index 128f20777fe2..7f9efafdfe9a 100644
--- a/pkgs/servers/home-assistant/component-packages.nix
+++ b/pkgs/servers/home-assistant/component-packages.nix
@@ -2,7 +2,7 @@
# Do not edit!
{
- version = "2023.10.3";
+ version = "2023.10.4";
components = {
"3_day_blinds" = ps: with ps; [
];
@@ -2771,7 +2771,8 @@
sqlalchemy
];
"myq" = ps: with ps; [
- ]; # missing inputs: python-myq
+ python-myq
+ ];
"mysensors" = ps: with ps; [
aiohttp-cors
janus
@@ -5405,6 +5406,7 @@
"mullvad"
"mutesync"
"my"
+ "myq"
"mysensors"
"mystrom"
"mythicbeastsdns"
diff --git a/pkgs/servers/home-assistant/default.nix b/pkgs/servers/home-assistant/default.nix
index 9bc35bd882c9..593099d264af 100644
--- a/pkgs/servers/home-assistant/default.nix
+++ b/pkgs/servers/home-assistant/default.nix
@@ -296,7 +296,7 @@ let
extraBuildInputs = extraPackages python.pkgs;
# Don't forget to run parse-requirements.py after updating
- hassVersion = "2023.10.3";
+ hassVersion = "2023.10.4";
in python.pkgs.buildPythonApplication rec {
pname = "homeassistant";
@@ -312,7 +312,7 @@ in python.pkgs.buildPythonApplication rec {
# Primary source is the pypi sdist, because it contains translations
src = fetchPypi {
inherit pname version;
- hash = "sha256-7Eg6Ik8eiPPUTXyRedQLixaCnHDg9Dmikmhcq55+458=";
+ hash = "sha256-HG8Uyk52Bj9CpQ+dn+dbsXVBKakXDlRktG4KSkVVVmE=";
};
# Secondary source is git for tests
@@ -320,7 +320,7 @@ in python.pkgs.buildPythonApplication rec {
owner = "home-assistant";
repo = "core";
rev = "refs/tags/${version}";
- hash = "sha256-4J1BBC6PvfbN4fKD+zUpW19sMvoKALilitNJlwB0ZTk=";
+ hash = "sha256-m3MjJHFq9S0dogFijIlpryqGQoHpLqkqgkWLuIxLHa8=";
};
nativeBuildInputs = with python.pkgs; [
diff --git a/pkgs/servers/home-assistant/stubs.nix b/pkgs/servers/home-assistant/stubs.nix
index adc7089741e9..a0146829bf2c 100644
--- a/pkgs/servers/home-assistant/stubs.nix
+++ b/pkgs/servers/home-assistant/stubs.nix
@@ -8,7 +8,7 @@
buildPythonPackage rec {
pname = "homeassistant-stubs";
- version = "2023.10.1";
+ version = "2023.10.4";
format = "pyproject";
disabled = python.version != home-assistant.python.version;
@@ -17,7 +17,7 @@ buildPythonPackage rec {
owner = "KapJI";
repo = "homeassistant-stubs";
rev = "refs/tags/${version}";
- hash = "sha256-4TPjYBTyrJtnYVZ+F/Bxf6m0lZn6fQR3ai0+CDTqwVc=";
+ hash = "sha256-iehGVXom5Wjw7A0PC4wfzed+w1h1/g9SKIuCuVRtIAs=";
};
nativeBuildInputs = [
diff --git a/pkgs/servers/http/nginx/generic.nix b/pkgs/servers/http/nginx/generic.nix
index 1f175c03d8a8..8f90adab101b 100644
--- a/pkgs/servers/http/nginx/generic.nix
+++ b/pkgs/servers/http/nginx/generic.nix
@@ -186,7 +186,7 @@ stdenv.mkDerivation {
passthru = {
inherit modules;
tests = {
- inherit (nixosTests) nginx nginx-auth nginx-etag nginx-globalredirect nginx-http3 nginx-proxyprotocol nginx-pubhtml nginx-sandbox nginx-sso nginx-status-page;
+ inherit (nixosTests) nginx nginx-auth nginx-etag nginx-globalredirect nginx-http3 nginx-proxyprotocol nginx-pubhtml nginx-sandbox nginx-sso nginx-status-page nginx-unix-socket;
variants = lib.recurseIntoAttrs nixosTests.nginx-variants;
acme-integration = nixosTests.acme;
} // passthru.tests;
diff --git a/pkgs/servers/http/nginx/modules.nix b/pkgs/servers/http/nginx/modules.nix
index 13c8bd7e7c75..2ffb65a3a9f1 100644
--- a/pkgs/servers/http/nginx/modules.nix
+++ b/pkgs/servers/http/nginx/modules.nix
@@ -1022,8 +1022,8 @@ let self = {
name = "zstd";
owner = "tokers";
repo = "zstd-nginx-module";
- rev = "25d88c262be47462cf90015ee7ebf6317b6848f9";
- sha256 = "sha256-YRluKekhx1tb6e5IL1FPK05jPtzfQPaHI47cdada928=";
+ rev = "0.1.0";
+ hash = "sha256-8SBU9hJnKtNrwbpioy+Z/mfiVuqAx+U1t64m5tfEy6o=";
};
inputs = [ zstd ];
diff --git a/pkgs/servers/http/tomcat/tomcat-native.nix b/pkgs/servers/http/tomcat/tomcat-native.nix
index 5f9ea8a1665d..bd05943ac71f 100644
--- a/pkgs/servers/http/tomcat/tomcat-native.nix
+++ b/pkgs/servers/http/tomcat/tomcat-native.nix
@@ -2,11 +2,11 @@
stdenv.mkDerivation rec {
pname = "tomcat-native";
- version = "2.0.5";
+ version = "2.0.6";
src = fetchurl {
url = "mirror://apache/tomcat/tomcat-connectors/native/${version}/source/${pname}-${version}-src.tar.gz";
- hash = "sha256-lY0fEhZRwQxhVW133J0NQfO1OYiiGVRC3krG9MuHg4g=";
+ hash = "sha256-vmF8V26SO2B50LdSBtcG2ifdBDzr9Qv7leOpwKodGjU=";
};
sourceRoot = "${pname}-${version}-src/native";
diff --git a/pkgs/servers/samba/4.x.nix b/pkgs/servers/samba/4.x.nix
index ed8744ef3c62..4665402361d5 100644
--- a/pkgs/servers/samba/4.x.nix
+++ b/pkgs/servers/samba/4.x.nix
@@ -51,11 +51,11 @@ with lib;
stdenv.mkDerivation rec {
pname = "samba";
- version = "4.18.6";
+ version = "4.19.1";
src = fetchurl {
url = "mirror://samba/pub/samba/stable/${pname}-${version}.tar.gz";
- hash = "sha256-KEyKmUzpich81oCMOQ/LnQDDayGg3BqKdUdLZ8nnFec=";
+ hash = "sha256-zjt/DRi/kapf1kbouzhaOzU3W3A8blEjsCuFoavIGHk=";
};
outputs = [ "out" "dev" "man" ];
diff --git a/pkgs/servers/soft-serve/default.nix b/pkgs/servers/soft-serve/default.nix
index 5072869c39b6..2cfd41f7caf8 100644
--- a/pkgs/servers/soft-serve/default.nix
+++ b/pkgs/servers/soft-serve/default.nix
@@ -1,4 +1,4 @@
-{ lib, buildGoModule, fetchFromGitHub, makeWrapper, git }:
+{ lib, buildGoModule, fetchFromGitHub, makeWrapper, nixosTests, git, bash }:
buildGoModule rec {
pname = "soft-serve";
@@ -20,10 +20,14 @@ buildGoModule rec {
nativeBuildInputs = [ makeWrapper ];
postInstall = ''
+ # Soft-serve generates git-hooks at run-time.
+ # The scripts require git and bash inside the path.
wrapProgram $out/bin/soft \
- --prefix PATH : "${lib.makeBinPath [ git ]}"
+ --prefix PATH : "${lib.makeBinPath [ git bash ]}"
'';
+ passthru.tests = nixosTests.soft-serve;
+
meta = with lib; {
description = "A tasty, self-hosted Git server for the command line";
homepage = "https://github.com/charmbracelet/soft-serve";
diff --git a/pkgs/servers/sql/pgbouncer/default.nix b/pkgs/servers/sql/pgbouncer/default.nix
index 7f6cfa0f898a..dd47de907576 100644
--- a/pkgs/servers/sql/pgbouncer/default.nix
+++ b/pkgs/servers/sql/pgbouncer/default.nix
@@ -19,6 +19,7 @@ stdenv.mkDerivation rec {
meta = with lib; {
homepage = "https://www.pgbouncer.org/";
+ mainProgram = "pgbouncer";
description = "Lightweight connection pooler for PostgreSQL";
changelog = "https://github.com/pgbouncer/pgbouncer/releases/tag/pgbouncer_${replaceStrings ["."] ["_"] version}";
license = licenses.isc;
diff --git a/pkgs/servers/teleport/11/default.nix b/pkgs/servers/teleport/11/default.nix
index 59d788872b88..3a935b630e72 100644
--- a/pkgs/servers/teleport/11/default.nix
+++ b/pkgs/servers/teleport/11/default.nix
@@ -1,7 +1,7 @@
{ callPackage, ... }@args:
callPackage ../generic.nix ({
- version = "11.3.25";
- hash = "sha256-KIbRn90BUJp8Uc8GMHuIMMSn5tJQbxzE0ntngx1ELaE=";
+ version = "11.3.27";
+ hash = "sha256-A3EeFQsDOaggfb5S+eyRCe/vm054MabfRrcHPxhO0So=";
vendorHash = "sha256-hjMv/H4dlinlv3ku7i1km2/b+6uCdbznHtVOMIjDlUc=";
yarnHash = "sha256-hip0WQVZpx2qfVDmEy4nk4UFYEjX1Xhj8HsIIQ8PF1Y=";
cargoLock = {
diff --git a/pkgs/servers/teleport/12/Cargo.lock b/pkgs/servers/teleport/12/Cargo.lock
index 895145e3927f..c150d003f3ac 100644
--- a/pkgs/servers/teleport/12/Cargo.lock
+++ b/pkgs/servers/teleport/12/Cargo.lock
@@ -1734,9 +1734,9 @@ dependencies = [
[[package]]
name = "webpki"
-version = "0.22.0"
+version = "0.22.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
-checksum = "f095d78192e208183081cc07bc5515ef55216397af48b873e5edcd72637fa1bd"
+checksum = "07ecc0cd7cac091bf682ec5efa18b1cff79d617b84181f38b3951dbe135f607f"
dependencies = [
"ring",
"untrusted 0.7.1",
diff --git a/pkgs/servers/teleport/12/default.nix b/pkgs/servers/teleport/12/default.nix
index e53fdcce494a..ee166f5d4721 100644
--- a/pkgs/servers/teleport/12/default.nix
+++ b/pkgs/servers/teleport/12/default.nix
@@ -1,9 +1,9 @@
{ callPackage, ... }@args:
callPackage ../generic.nix ({
- version = "12.4.20";
- hash = "sha256-Qz+JOS4YPj2865Fkj7eVJMdilHMOGbTD179bQ5wHY7A=";
- vendorHash = "sha256-cS8ylLujgp9Is+D2JjoK4yGgWRCVRyRw3NPQAAuE2vY=";
- yarnHash = "sha256-tOdT7X8jM+tl1GZ7lBN2aW8KRiVW/zWK9fZIU7CSHVE=";
+ version = "12.4.22";
+ hash = "sha256-UEiS+GiderYTU34GHsQr4G8XrasV5ewmPcdrec4v5B4=";
+ vendorHash = "sha256-etutgK/5u+e86kx7ha3x+di9np7Tcr7hpGUMKZxJNT4=";
+ yarnHash = "sha256-MBTElkMH5rb33l+AYWH+zguSLQf+ntXpOkHZpjLAx/Q=";
cargoLock = {
lockFile = ./Cargo.lock;
outputHashes = {
diff --git a/pkgs/servers/teleport/13/Cargo.lock b/pkgs/servers/teleport/13/Cargo.lock
index b82c0b0e435f..d22467c3e7dc 100644
--- a/pkgs/servers/teleport/13/Cargo.lock
+++ b/pkgs/servers/teleport/13/Cargo.lock
@@ -1786,9 +1786,9 @@ dependencies = [
[[package]]
name = "webpki"
-version = "0.22.0"
+version = "0.22.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
-checksum = "f095d78192e208183081cc07bc5515ef55216397af48b873e5edcd72637fa1bd"
+checksum = "07ecc0cd7cac091bf682ec5efa18b1cff79d617b84181f38b3951dbe135f607f"
dependencies = [
"ring",
"untrusted 0.7.1",
diff --git a/pkgs/servers/teleport/13/default.nix b/pkgs/servers/teleport/13/default.nix
index 58d682f52ac2..65cbed70d9cc 100644
--- a/pkgs/servers/teleport/13/default.nix
+++ b/pkgs/servers/teleport/13/default.nix
@@ -1,9 +1,9 @@
{ callPackage, ... }@args:
callPackage ../generic.nix ({
- version = "13.4.1";
- hash = "sha256-wgSaek4eq5Jx9SZFenvdRSU1wEtfJHzTz9GdczzUU2w=";
- vendorHash = "sha256-DesT18nV/SxOsKCC+Nt0hgtH7CRtRL0B5FQhE1J148I=";
- yarnHash = "sha256-iyMcP9L6dwBhN8JL9eSVEzsXI2EOjfyxjF9Dm4Gs04s=";
+ version = "13.4.3";
+ hash = "sha256-x8G94jKycK3nYwqDA5RPc63GHIk9y4pHfSwSBqGBINk=";
+ vendorHash = "sha256-Pb3eO9zqLgTD7otM7yGRWicQjvpIXg7xKV8Oc4yh8PA=";
+ yarnHash = "sha256-GnoiLqzqGV0UZm5zePCDBUUX63NTIIo1dcxtiWQDPqc=";
cargoLock = {
lockFile = ./Cargo.lock;
outputHashes = {
diff --git a/pkgs/servers/teleport/14/Cargo.lock b/pkgs/servers/teleport/14/Cargo.lock
index 8b18ac74ae70..c9b50a388b0b 100644
--- a/pkgs/servers/teleport/14/Cargo.lock
+++ b/pkgs/servers/teleport/14/Cargo.lock
@@ -1789,9 +1789,9 @@ dependencies = [
[[package]]
name = "webpki"
-version = "0.22.0"
+version = "0.22.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
-checksum = "f095d78192e208183081cc07bc5515ef55216397af48b873e5edcd72637fa1bd"
+checksum = "07ecc0cd7cac091bf682ec5efa18b1cff79d617b84181f38b3951dbe135f607f"
dependencies = [
"ring",
"untrusted 0.7.1",
diff --git a/pkgs/servers/teleport/14/default.nix b/pkgs/servers/teleport/14/default.nix
index 15a594ef13e6..71036da070ef 100644
--- a/pkgs/servers/teleport/14/default.nix
+++ b/pkgs/servers/teleport/14/default.nix
@@ -1,9 +1,9 @@
{ callPackage, ... }@args:
callPackage ../generic.nix ({
- version = "14.0.1";
- hash = "sha256-esQwk2PFnk3/REzLr3ExtzEcUs2q4Tn/2KpfFWAx5uU=";
- vendorHash = "sha256-lzwrkW0dHxCHBSJjzNhXgq3Av8Zj8xEn3kfTRtT/q04=";
- yarnHash = "sha256-Y2dVxRyKPLD2xjwr0QqrKHf/4gnMCErmDzievu5zTGg=";
+ version = "14.0.3";
+ hash = "sha256-X+vekYmuTE7n22SH/z2GWO3wnBsIef1GEjR7WOJpjc8=";
+ vendorHash = "sha256-+R6f2HrlN/RLec83YutccDFJW6gq6HXbxoJVtxMgdp8=";
+ yarnHash = "sha256-udM4DNaTGiMkqfkllJjmT+Nk6PNbGUzT34ixQOhmScw=";
cargoLock = {
lockFile = ./Cargo.lock;
outputHashes = {
diff --git a/pkgs/shells/nushell/default.nix b/pkgs/shells/nushell/default.nix
index 34b8f9504f8b..acd7494fd3cc 100644
--- a/pkgs/shells/nushell/default.nix
+++ b/pkgs/shells/nushell/default.nix
@@ -22,7 +22,7 @@
}:
let
- version = "0.85.0";
+ version = "0.86.0";
in
rustPlatform.buildRustPackage {
@@ -33,10 +33,10 @@ rustPlatform.buildRustPackage {
owner = "nushell";
repo = "nushell";
rev = version;
- hash = "sha256-/c3JTgIT+T41D0S7irQ0jq2MDzmx3os4pYpVr10cL3E=";
+ hash = "sha256-jUZKqsu0/RO4mc+hzjis1mNrohj1JzM17Z8e2Ggxlfs=";
};
- cargoHash = "sha256-lBipwX72j0Af3PCat18s9NIjJiKZFZTcU9Utwt+eQzI=";
+ cargoHash = "sha256-WDGhuc2ZGDwfh7X/oRTZLzmKPj1jSnQFL4sy7KYt5Js=";
nativeBuildInputs = [ pkg-config ]
++ lib.optionals (withDefaultFeatures && stdenv.isLinux) [ python3 ]
diff --git a/pkgs/stdenv/linux/default.nix b/pkgs/stdenv/linux/default.nix
index 5c03312cc75f..35cdb6311df3 100644
--- a/pkgs/stdenv/linux/default.nix
+++ b/pkgs/stdenv/linux/default.nix
@@ -68,7 +68,7 @@
mipsel-linux = import ./bootstrap-files/mipsel-unknown-linux-gnu.nix;
mips64el-linux = import
(if localSystem.isMips64n32
- then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix.nix
+ then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix
else ./bootstrap-files/mips64el-unknown-linux-gnuabi64.nix);
powerpc64le-linux = import ./bootstrap-files/powerpc64le-unknown-linux-gnu.nix;
riscv64-linux = import ./bootstrap-files/riscv64-unknown-linux-gnu.nix;
diff --git a/pkgs/tools/admin/syft/default.nix b/pkgs/tools/admin/syft/default.nix
index 3f6567b09f0c..c596c709977c 100644
--- a/pkgs/tools/admin/syft/default.nix
+++ b/pkgs/tools/admin/syft/default.nix
@@ -2,13 +2,13 @@
buildGoModule rec {
pname = "syft";
- version = "0.92.0";
+ version = "0.93.0";
src = fetchFromGitHub {
owner = "anchore";
repo = pname;
rev = "v${version}";
- hash = "sha256-YmzizpcAfE4+Rfq5ydQnDQBo4R+pAyudfi+fqD9EZP0=";
+ hash = "sha256-e8d+CK7rRbyHeRHOjK3tGFIBHuosdV4AMetUQar54E4=";
# populate values that require us to use git. By doing this in postFetch we
# can delete .git afterwards and maintain better reproducibility of the src.
leaveDotGit = true;
@@ -22,7 +22,7 @@ buildGoModule rec {
};
# hash mismatch with darwin
proxyVendor = true;
- vendorHash = "sha256-siOZWhHqNokkYAPwuXQCs4T1yBiEWUTJzhfbH/Z2uBk=";
+ vendorHash = "sha256-BUCe2v80tHAqMBwa6xae3ZOTOok8msM6hFh6d9D4xZA=";
nativeBuildInputs = [ installShellFiles ];
diff --git a/pkgs/tools/filesystems/erofs-utils/default.nix b/pkgs/tools/filesystems/erofs-utils/default.nix
index d1daee70967f..e25df7288094 100644
--- a/pkgs/tools/filesystems/erofs-utils/default.nix
+++ b/pkgs/tools/filesystems/erofs-utils/default.nix
@@ -30,6 +30,7 @@ stdenv.mkDerivation rec {
] ++ lib.optional fuseSupport "--enable-fuse";
meta = with lib; {
+ homepage = "https://git.kernel.org/pub/scm/linux/kernel/git/xiang/erofs-utils.git/about/";
description = "Userspace utilities for linux-erofs file system";
license = with licenses; [ gpl2Plus ];
maintainers = with maintainers; [ ehmry nikstur ];
diff --git a/pkgs/tools/inputmethods/evsieve/default.nix b/pkgs/tools/inputmethods/evsieve/default.nix
new file mode 100644
index 000000000000..4497448cad12
--- /dev/null
+++ b/pkgs/tools/inputmethods/evsieve/default.nix
@@ -0,0 +1,31 @@
+{ lib
+, fetchFromGitHub
+, rustPlatform
+, libevdev
+}:
+
+rustPlatform.buildRustPackage rec {
+ pname = "evsieve";
+ version = "1.3.1";
+
+ src = fetchFromGitHub {
+ owner = "KarsMulder";
+ repo = "evsieve";
+ rev = "v${version}";
+ hash = "sha256-R/y3iyKGE4dzAyNnDwrMCr8JFshYJwNcgHQ8UbtuRj8=";
+ };
+
+ cargoHash = "sha256-jkm+mAHejCBZFalUbJNaIxtIl2kwnlPR2wsaYlcfSz8=";
+
+ buildInputs = [ libevdev ];
+
+ doCheck = false; # unit tests create uinput devices
+
+ meta = with lib; {
+ description = "A utility for mapping events from Linux event devices";
+ homepage = "https://github.com/KarsMulder/evsieve";
+ license = licenses.gpl2Plus;
+ maintainers = with maintainers; [ tsowell ];
+ platforms = platforms.linux;
+ };
+}
diff --git a/pkgs/tools/misc/ckb-next/default.nix b/pkgs/tools/misc/ckb-next/default.nix
index f9309ecf81dd..549cb543af19 100644
--- a/pkgs/tools/misc/ckb-next/default.nix
+++ b/pkgs/tools/misc/ckb-next/default.nix
@@ -1,17 +1,17 @@
-{ lib, mkDerivation, fetchFromGitHub, substituteAll, udev, stdenv
+{ lib, wrapQtAppsHook, fetchFromGitHub, substituteAll, udev, stdenv
, pkg-config, qtbase, cmake, zlib, kmod, libXdmcp, qttools, qtx11extras, libdbusmenu
-, withPulseaudio ? stdenv.isLinux, libpulseaudio
+, withPulseaudio ? stdenv.isLinux, libpulseaudio, quazip
}:
-mkDerivation rec {
- version = "0.5.0";
+stdenv.mkDerivation rec {
+ version = "0.6.0";
pname = "ckb-next";
src = fetchFromGitHub {
owner = "ckb-next";
repo = "ckb-next";
rev = "v${version}";
- sha256 = "sha256-yR1myagAqavAR/7lPdufcrJpPmXW7r4N4pxTMF6NbuE=";
+ hash = "sha256-G0cvET3wMIi4FlBmaTkdTyYtcdVGzK4X0C2HYZr43eg=";
};
buildInputs = [
@@ -22,9 +22,11 @@ mkDerivation rec {
qttools
qtx11extras
libdbusmenu
+ quazip
] ++ lib.optional withPulseaudio libpulseaudio;
nativeBuildInputs = [
+ wrapQtAppsHook
pkg-config
cmake
];
diff --git a/pkgs/tools/misc/codebraid/default.nix b/pkgs/tools/misc/codebraid/default.nix
index 0ecde80c238d..f4d8fa4940f0 100644
--- a/pkgs/tools/misc/codebraid/default.nix
+++ b/pkgs/tools/misc/codebraid/default.nix
@@ -2,15 +2,17 @@
python3Packages.buildPythonApplication rec {
pname = "codebraid";
- version = "0.5.0-unstable-2020-08-14";
+ version = "0.11.0";
+ format = "pyproject";
src = fetchFromGitHub {
owner = "gpoore";
repo = pname;
- rev = "526a223c4fc32c37d6c5c9133524dfa0e1811ca4";
- sha256 = "0qkqaj49k584qzgx9jlsf5vlv4lq7x403s1kig8v87i0kgh55p56";
+ rev = "v${version}";
+ hash = "sha256-E9vzGK9ZEVwF+UBpSkdM+hm6vINen/A+LgnnPpc77QQ=";
};
+ nativeBuildInputs = with python3Packages; [ setuptools ];
propagatedBuildInputs = with python3Packages; [ bespon ];
# unfortunately upstream doesn't contain tests
checkPhase = ''
diff --git a/pkgs/tools/misc/domine/default.nix b/pkgs/tools/misc/domine/default.nix
index cd62b9bd1a74..421b49a9d4a4 100644
--- a/pkgs/tools/misc/domine/default.nix
+++ b/pkgs/tools/misc/domine/default.nix
@@ -12,6 +12,6 @@ buildDartApplication rec {
};
pubspecLockFile = ./pubspec.lock;
-
+ depsListFile = ./deps.json;
vendorHash = "16z3paq1nxlnzs20qlljnwa2ff6xfhdqzcq8d8izkl7w1j4hyxgn";
}
diff --git a/pkgs/tools/misc/domine/deps.json b/pkgs/tools/misc/domine/deps.json
new file mode 100644
index 000000000000..baa466f5e2f2
--- /dev/null
+++ b/pkgs/tools/misc/domine/deps.json
@@ -0,0 +1,190 @@
+[
+ {
+ "name": "domine",
+ "version": "1.1.0+3",
+ "kind": "root",
+ "source": "root",
+ "dependencies": [
+ "args",
+ "dart_openai",
+ "dio",
+ "dio_smart_retry",
+ "tint",
+ "lints"
+ ]
+ },
+ {
+ "name": "lints",
+ "version": "2.1.1",
+ "kind": "dev",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "tint",
+ "version": "2.0.1",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "dio_smart_retry",
+ "version": "5.0.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "dio",
+ "http_parser",
+ "path"
+ ]
+ },
+ {
+ "name": "path",
+ "version": "1.8.3",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "http_parser",
+ "version": "4.0.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "source_span",
+ "string_scanner",
+ "typed_data"
+ ]
+ },
+ {
+ "name": "typed_data",
+ "version": "1.3.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection"
+ ]
+ },
+ {
+ "name": "collection",
+ "version": "1.17.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "string_scanner",
+ "version": "1.2.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "source_span"
+ ]
+ },
+ {
+ "name": "source_span",
+ "version": "1.10.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "path",
+ "term_glyph"
+ ]
+ },
+ {
+ "name": "term_glyph",
+ "version": "1.2.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "dio",
+ "version": "5.3.2",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "http_parser",
+ "meta",
+ "path"
+ ]
+ },
+ {
+ "name": "meta",
+ "version": "1.9.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": []
+ },
+ {
+ "name": "async",
+ "version": "2.11.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "collection",
+ "meta"
+ ]
+ },
+ {
+ "name": "dart_openai",
+ "version": "4.0.0",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": [
+ "http",
+ "meta",
+ "collection",
+ "fetch_client"
+ ]
+ },
+ {
+ "name": "fetch_client",
+ "version": "1.0.2",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "fetch_api",
+ "http"
+ ]
+ },
+ {
+ "name": "http",
+ "version": "1.1.0",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "async",
+ "http_parser",
+ "meta"
+ ]
+ },
+ {
+ "name": "fetch_api",
+ "version": "1.0.1",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "js"
+ ]
+ },
+ {
+ "name": "js",
+ "version": "0.6.7",
+ "kind": "transitive",
+ "source": "hosted",
+ "dependencies": [
+ "meta"
+ ]
+ },
+ {
+ "name": "args",
+ "version": "2.4.2",
+ "kind": "direct",
+ "source": "hosted",
+ "dependencies": []
+ }
+]
diff --git a/pkgs/tools/misc/fd/default.nix b/pkgs/tools/misc/fd/default.nix
index 23e00e00363c..84da1044f1a4 100644
--- a/pkgs/tools/misc/fd/default.nix
+++ b/pkgs/tools/misc/fd/default.nix
@@ -2,16 +2,16 @@
rustPlatform.buildRustPackage rec {
pname = "fd";
- version = "8.7.0";
+ version = "8.7.1";
src = fetchFromGitHub {
owner = "sharkdp";
repo = "fd";
rev = "v${version}";
- hash = "sha256-y7IrwMLQnvz1PeKt8BE9hbEBwQBiUXM4geYbiTjMymw=";
+ hash = "sha256-euQiMVPKE1/YG04VKMFUA27OtoGENNhqeE0iiF/X7uc=";
};
- cargoHash = "sha256-AstE8KGICgPhqRKlJecrE9iPUUWaOvca6ocWf85IzNo=";
+ cargoHash = "sha256-doeZTjFPXmxIPYX3IBtetePoNkIHnl6oPJFtXD1tgZY=";
nativeBuildInputs = [ installShellFiles ];
diff --git a/pkgs/tools/misc/lazydocker/default.nix b/pkgs/tools/misc/lazydocker/default.nix
index 1fdb0ef0d44b..353402658db9 100644
--- a/pkgs/tools/misc/lazydocker/default.nix
+++ b/pkgs/tools/misc/lazydocker/default.nix
@@ -2,13 +2,13 @@
buildGoModule rec {
pname = "lazydocker";
- version = "0.23.0";
+ version = "0.23.1";
src = fetchFromGitHub {
owner = "jesseduffield";
repo = "lazydocker";
rev = "v${version}";
- sha256 = "sha256-BxIv0HCdrR9U9mmJnBdQqiUf/vbK+XEnL8ALPkuap0M=";
+ sha256 = "sha256-nW3eaSisXLqoWZ+5YLLCfC1k4lTXWd5ZqY2xTM/I0PY=";
};
vendorHash = null;
diff --git a/pkgs/tools/misc/timer/default.nix b/pkgs/tools/misc/timer/default.nix
index 29e087c86581..962ad1a6dd69 100644
--- a/pkgs/tools/misc/timer/default.nix
+++ b/pkgs/tools/misc/timer/default.nix
@@ -2,16 +2,16 @@
buildGoModule rec {
pname = "timer";
- version = "1.3.0";
+ version = "1.4.1";
src = fetchFromGitHub {
owner = "caarlos0";
repo = "timer";
rev = "v${version}";
- hash = "sha256-9p/L3Hj3VqlNiyY3lfUAhCjwTl1iSTegWxaVEGB4qHM=";
+ hash = "sha256-8BVzijAXsJ8Q8BhDmhzFbEQ23fUEBdmbUsCPxfpXyBA=";
};
- vendorHash = "sha256-j7Xik0te6GdjfhXHT7DRf+MwM+aKjfgTGvroxnlD3MM=";
+ vendorHash = "sha256-1n5vZKlOWoB2SFdDdv+pPWLybzCIJG/wdBYqLMatjNA=";
ldflags = [ "-s" "-w" "-X main.version=${version}" ];
diff --git a/pkgs/tools/misc/topgrade/default.nix b/pkgs/tools/misc/topgrade/default.nix
index f900eafaacd1..757cb69cbb0b 100644
--- a/pkgs/tools/misc/topgrade/default.nix
+++ b/pkgs/tools/misc/topgrade/default.nix
@@ -10,16 +10,16 @@
rustPlatform.buildRustPackage rec {
pname = "topgrade";
- version = "12.0.2";
+ version = "13.0.0";
src = fetchFromGitHub {
owner = "topgrade-rs";
repo = "topgrade";
rev = "v${version}";
- hash = "sha256-PfrtTegJULzPAmKUk/6P9rD+ttPJOhaf2505og64C0Y=";
+ hash = "sha256-BuYwLD8HlmFjCpR8043GhrYK3XWffeqEaeEDqWhxZVI=";
};
- cargoHash = "sha256-S6jSI/KuHocYD2dhg3o1NSyA8Q04Xo215TWl8Y1C7g8=";
+ cargoHash = "sha256-+kSvA9AC0peXeFLVjenATRfnIS9qaOr/f1ozPbifiPI=";
nativeBuildInputs = [
installShellFiles
diff --git a/pkgs/tools/networking/ddclient/default.nix b/pkgs/tools/networking/ddclient/default.nix
index 6477c5b185c0..eafba0d4f527 100644
--- a/pkgs/tools/networking/ddclient/default.nix
+++ b/pkgs/tools/networking/ddclient/default.nix
@@ -5,7 +5,7 @@ let
in
perlPackages.buildPerlPackage rec {
pname = "ddclient";
- version = "3.11.0_1";
+ version = "3.11.0";
outputs = [ "out" ];
@@ -13,7 +13,7 @@ perlPackages.buildPerlPackage rec {
owner = "ddclient";
repo = "ddclient";
rev = "v${version}";
- sha256 = "sha256-pl1kbzY5nUIvx1QiDdL9TP4vKtQnnv3RWklE4gbxXCw=";
+ sha256 = "sha256-s/gdTvEY4QIVidqNnN7GYrpCsp4nZ0GEH8Jv+LkSr48=";
};
postPatch = ''
diff --git a/pkgs/tools/networking/globalping-cli/default.nix b/pkgs/tools/networking/globalping-cli/default.nix
index bc07f20a5b11..c88688bca71d 100644
--- a/pkgs/tools/networking/globalping-cli/default.nix
+++ b/pkgs/tools/networking/globalping-cli/default.nix
@@ -2,13 +2,13 @@
buildGoModule rec {
pname = "globalping-cli";
- version = "1.1.0";
+ version = "1.1.5";
src = fetchFromGitHub {
owner = "jsdelivr";
repo = pname;
rev = "v${version}";
- hash = "sha256-UY+SAmkE8h/K92Em5iikcMiNixkqnDVkhlrKVq1ZkVM=";
+ hash = "sha256-k89tqQpGvX0WiYqEwPj+tDViUKDjLR5MrkA0CQI/A+o=";
};
vendorHash = "sha256-fUB7WIEAPBot8A2f7WQ5wUDtCrOydZd4nd4qDuy1vzg=";
diff --git a/pkgs/tools/networking/hysteria/default.nix b/pkgs/tools/networking/hysteria/default.nix
index 9885066397b6..80b12b6d6d67 100644
--- a/pkgs/tools/networking/hysteria/default.nix
+++ b/pkgs/tools/networking/hysteria/default.nix
@@ -4,16 +4,16 @@
}:
buildGo121Module rec {
pname = "hysteria";
- version = "2.0.3";
+ version = "2.1.1";
src = fetchFromGitHub {
owner = "apernet";
repo = pname;
rev = "app/v${version}";
- hash = "sha256-0ekw92T9yWrKu5MxSssOCXlUFubiVLoH6ZLEMDFkcis=";
+ hash = "sha256-CvhDOtXyGxnTy8m7qN5lmQxOxwkExfW+1ZT3LrLjsmo=";
};
- vendorHash = "sha256-Hf+Jx/z+hJ6jqWLJHGK7umNgNzNKYgQtCdAosdrqvPg=";
+ vendorHash = "sha256-Io7EN+Cza7drMLB9JF4nRDxq+eVxW5sYj45WWvXtDsY=";
proxyVendor = true;
ldflags = [
diff --git a/pkgs/tools/networking/requestly/default.nix b/pkgs/tools/networking/requestly/default.nix
index 33d03140c398..3a4128c0806d 100644
--- a/pkgs/tools/networking/requestly/default.nix
+++ b/pkgs/tools/networking/requestly/default.nix
@@ -5,11 +5,11 @@
let
pname = "requestly";
- version = "1.5.6";
+ version = "1.5.12";
src = fetchurl {
url = "https://github.com/requestly/requestly-desktop-app/releases/download/v${version}/Requestly-${version}.AppImage";
- hash = "sha256-Yb90OGIIvExfNPoJPmuZSvtU5OQVuGqh4EmyKltE+is=";
+ hash = "sha256-HM3+j9E67J1bAklnDtSN5/rOK9Wn7N7h+qlPKR/E8Ns=";
};
appimageContents = appimageTools.extractType2 { inherit pname version src; };
diff --git a/pkgs/tools/networking/tgt/default.nix b/pkgs/tools/networking/tgt/default.nix
index e47478b9206b..4030e3d14ec1 100644
--- a/pkgs/tools/networking/tgt/default.nix
+++ b/pkgs/tools/networking/tgt/default.nix
@@ -4,13 +4,13 @@
stdenv.mkDerivation rec {
pname = "tgt";
- version = "1.0.87";
+ version = "1.0.88";
src = fetchFromGitHub {
owner = "fujita";
repo = pname;
rev = "v${version}";
- sha256 = "sha256-nDYNXQJqCtwlm4HTPTMuUbn6FA8JRYEqxbYUAev2R3o=";
+ sha256 = "sha256-tLc+viPufR6P5texDs9lU8wsOTzrjSK0Qz/r4/L8M5k=";
};
nativeBuildInputs = [ libxslt docbook_xsl makeWrapper ];
diff --git a/pkgs/tools/package-management/zkg/default.nix b/pkgs/tools/package-management/zkg/default.nix
deleted file mode 100644
index 9d6700469722..000000000000
--- a/pkgs/tools/package-management/zkg/default.nix
+++ /dev/null
@@ -1,42 +0,0 @@
-{ lib
-, python3
-, fetchFromGitHub
-, pkgs
-}:
-
-python3.pkgs.buildPythonApplication rec {
- pname = "zkg";
- version = "2.14.0";
- format = "setuptools";
-
- src = fetchFromGitHub {
- owner = "zeek";
- repo = "package-manager";
- rev = "refs/tags/v${version}";
- hash = "sha256-HdOzxSU3XWz1ZH96woDWrHzKbpJW3/IKkpc2tGfyi9o=";
- };
-
- propagatedBuildInputs = with python3.pkgs; [
- btest
- gitpython
- semantic-version
- sphinx
- sphinx-rtd-theme
- pkgs.bash
- ];
-
- # No tests available
- doCheck = false;
-
- pythonImportsCheck = [
- "zeekpkg"
- ];
-
- meta = with lib; {
- description = "Package manager for Zeek";
- homepage = "https://github.com/zeek/package-manager";
- changelog = "https://github.com/zeek/package-manager/blob/${version}/CHANGES";
- license = licenses.ncsa;
- maintainers = with maintainers; [ fab ];
- };
-}
diff --git a/pkgs/tools/security/nuclei/default.nix b/pkgs/tools/security/nuclei/default.nix
index 1f6dd8baeeb1..ae6e1d78f6fa 100644
--- a/pkgs/tools/security/nuclei/default.nix
+++ b/pkgs/tools/security/nuclei/default.nix
@@ -5,18 +5,17 @@
buildGoModule rec {
pname = "nuclei";
- version = "2.9.15";
+ version = "3.0.1";
src = fetchFromGitHub {
owner = "projectdiscovery";
repo = pname;
rev = "refs/tags/v${version}";
- hash = "sha256-/7013cf9nnDiKqcwFOYZUF1D+wkQKXPBcwz3YhpBUK0=";
+ hash = "sha256-5Z40wc8ihN2UR3DyMCaD0MOKpgbUQX0OJMyZw2gVNYM=";
};
- vendorHash = "sha256-b5CY66c2vfGaqlFENw2lnK47Cf2+buh/LtbJyPSAbOA=";
+ vendorHash = "sha256-CaeYAw7QU/KySFDSkUr4oHrG3wyPHxty3KCZ6zlPqIk=";
- modRoot = "./v2";
subPackages = [
"cmd/nuclei/"
];
diff --git a/pkgs/tools/security/pynitrokey/default.nix b/pkgs/tools/security/pynitrokey/default.nix
index 9c36ceb3c841..690d566c476d 100644
--- a/pkgs/tools/security/pynitrokey/default.nix
+++ b/pkgs/tools/security/pynitrokey/default.nix
@@ -10,12 +10,12 @@ with python3Packages;
buildPythonApplication rec {
pname = "pynitrokey";
- version = "0.4.39";
+ version = "0.4.40";
format = "pyproject";
src = fetchPypi {
inherit pname version;
- hash = "sha256-KXYHeWwV9Tw1ZpO/vASHjDnceeb+1K0yIUohb7EcRAI=";
+ hash = "sha256-Hu+8UooDzv4GhkWt0sCckQQyHjWn4V/zt2ADlVCoHmk=";
};
propagatedBuildInputs = [
diff --git a/pkgs/tools/security/rekor/default.nix b/pkgs/tools/security/rekor/default.nix
index 2820f473c11b..c27416e29d2e 100644
--- a/pkgs/tools/security/rekor/default.nix
+++ b/pkgs/tools/security/rekor/default.nix
@@ -4,13 +4,13 @@ let
generic = { pname, packageToBuild, description }:
buildGoModule rec {
inherit pname;
- version = "1.2.2";
+ version = "1.3.2";
src = fetchFromGitHub {
owner = "sigstore";
repo = "rekor";
rev = "v${version}";
- hash = "sha256-U7KxkPYVAy3/olXsEgPMX/kzg0KvYMovLO4LWw8guE4=";
+ hash = "sha256-QiK+ixVURf5Fsx9YPgzYCuCy1wYjxTUXGVr4FIn41Xc=";
# populate values that require us to use git. By doing this in postFetch we
# can delete .git afterwards and maintain better reproducibility of the src.
leaveDotGit = true;
@@ -23,7 +23,7 @@ let
'';
};
- vendorHash = "sha256-hZyoVlNrPKE6ub94jVEOLGvxWoXKxFYcsEZyRrZuNkQ=";
+ vendorHash = "sha256-0379IX5W51Z48CffK1F2ZCPGLUq0g8lZXIQqaupC5io=";
nativeBuildInputs = [ installShellFiles ];
diff --git a/pkgs/tools/security/sbctl/default.nix b/pkgs/tools/security/sbctl/default.nix
index 6471425a8581..0778406b40cb 100644
--- a/pkgs/tools/security/sbctl/default.nix
+++ b/pkgs/tools/security/sbctl/default.nix
@@ -8,16 +8,16 @@
buildGoModule rec {
pname = "sbctl";
- version = "0.11";
+ version = "0.12";
src = fetchFromGitHub {
owner = "Foxboron";
repo = pname;
rev = version;
- hash = "sha256-kApPb8X1JCP1XfyVFcoCDd+yrytTKSkNWRHKDA3mGaQ=";
+ hash = "sha256-1dA+a8GS4teaLmclatJNKt+OjhabLO4j/+p4Q95yG/s=";
};
- vendorHash = "sha256-WbPYTETTOzqWH+q6fzyDgm0wMScbLWlksLxkDjopF4E=";
+ vendorHash = "sha256-kVXzHTONPCE1UeAnUiULjubJeZFD0DAxIk+w8/Dqs6c=";
ldflags = [ "-s" "-w" "-X github.com/foxboron/sbctl.DatabasePath=${databasePath}" ];
diff --git a/pkgs/tools/security/sequoia-sqop/default.nix b/pkgs/tools/security/sequoia-sqop/default.nix
index f4cae90b546b..fdefbdea9e50 100644
--- a/pkgs/tools/security/sequoia-sqop/default.nix
+++ b/pkgs/tools/security/sequoia-sqop/default.nix
@@ -9,7 +9,7 @@
rustPlatform.buildRustPackage rec {
pname = "sequoia-sqop";
- version = "0.28.0";
+ version = "0.30.0";
src = fetchFromGitLab {
owner = "sequoia-pgp";
@@ -17,10 +17,10 @@ rustPlatform.buildRustPackage rec {
# generated etc
repo = "sequoia-sop";
rev = "v${version}";
- hash = "sha256-4A0eZMXzFtojRD5cXQQUVoS32sQ2lWtFll+q6yhnwG4=";
+ hash = "sha256-2fRlHkT2jhUp1dIqKe8r7ktSbgudCmzuiiyF0WcbYIE=";
};
- cargoHash = "sha256-gH5WM+PmciViD+eFVlp8tzdc0KdYy1WZLQi92UEWVG4=";
+ cargoHash = "sha256-/LLW0AHCgqi2pAOkhZXNGlmNF/+u0TmSstd/B6mDr6M=";
nativeBuildInputs = [
pkg-config
diff --git a/pkgs/tools/security/uncover/default.nix b/pkgs/tools/security/uncover/default.nix
index 1ea2f4144780..f0ee8aa23757 100644
--- a/pkgs/tools/security/uncover/default.nix
+++ b/pkgs/tools/security/uncover/default.nix
@@ -5,16 +5,16 @@
buildGoModule rec {
pname = "uncover";
- version = "1.0.6";
+ version = "1.0.7";
src = fetchFromGitHub {
owner = "projectdiscovery";
repo = pname;
rev = "refs/tags/v${version}";
- hash = "sha256-FJtd73z6Cc56+nBderYncjrac3xRydDeoiJqn8xW29U=";
+ hash = "sha256-CJA+rDLubghaQT+yb0zQY3y8hF0/5ISH9YFvIQHwH2Y=";
};
- vendorHash = "sha256-mpojOzGedkTthD+fHl9Uhul7tOCN1EGIin+7USoaNmE=";
+ vendorHash = "sha256-A7XPsl27Q5CaQXQUEvNB05B2M3mFGz/yZ4sOnOHxhw8=";
meta = with lib; {
description = "API wrapper to search for exposed hosts";
diff --git a/pkgs/tools/system/netdata/default.nix b/pkgs/tools/system/netdata/default.nix
index 5d9286a1c4d1..8ca73a4faf8c 100644
--- a/pkgs/tools/system/netdata/default.nix
+++ b/pkgs/tools/system/netdata/default.nix
@@ -2,13 +2,13 @@
, CoreFoundation, IOKit, libossp_uuid
, nixosTests
, netdata-go-plugins
-, bash, curl, jemalloc, libuv, zlib, libyaml
+, bash, curl, jemalloc, json_c, libuv, zlib, libyaml
, libcap, libuuid, lm_sensors, protobuf
, withCups ? false, cups
, withDBengine ? true, lz4
, withIpmi ? (!stdenv.isDarwin), freeipmi
, withNetfilter ? (!stdenv.isDarwin), libmnl, libnetfilter_acct
-, withCloud ? (!stdenv.isDarwin), json_c
+, withCloud ? false
, withCloudUi ? false
, withConnPubSub ? false, google-cloud-cpp, grpc
, withConnPrometheus ? false, snappy
@@ -42,14 +42,13 @@ stdenv.mkDerivation rec {
nativeBuildInputs = [ autoreconfHook pkg-config makeWrapper protobuf ];
# bash is only used to rewrite shebangs
- buildInputs = [ bash curl jemalloc libuv zlib libyaml ]
+ buildInputs = [ bash curl jemalloc json_c libuv zlib libyaml ]
++ lib.optionals stdenv.isDarwin [ CoreFoundation IOKit libossp_uuid ]
++ lib.optionals (!stdenv.isDarwin) [ libcap libuuid ]
++ lib.optionals withCups [ cups ]
++ lib.optionals withDBengine [ lz4 ]
++ lib.optionals withIpmi [ freeipmi ]
++ lib.optionals withNetfilter [ libmnl libnetfilter_acct ]
- ++ lib.optionals withCloud [ json_c ]
++ lib.optionals withConnPubSub [ google-cloud-cpp grpc ]
++ lib.optionals withConnPrometheus [ snappy ]
++ lib.optionals (withCloud || withConnPrometheus) [ protobuf ]
diff --git a/pkgs/tools/text/mdhtml/default.nix b/pkgs/tools/text/mdhtml/default.nix
new file mode 100644
index 000000000000..b5d12e7b3dcf
--- /dev/null
+++ b/pkgs/tools/text/mdhtml/default.nix
@@ -0,0 +1,28 @@
+{ lib
+, buildGoModule
+, fetchFromGitea
+}:
+
+buildGoModule rec {
+ pname = "mdhtml";
+ version = "0.2.2";
+
+ src = fetchFromGitea {
+ domain = "codeberg.org";
+ owner = "Tomkoid";
+ repo = pname;
+ rev = version;
+ hash = "sha256-893pqrrTftzKqPYZgukV/yx2gkukVZWDTgg7ufx1MsY=";
+ };
+
+ vendorHash = null;
+
+ meta = with lib; {
+ description = "Really simple CLI Markdown to HTML converter with styling support";
+ homepage = "https://codeberg.org/Tomkoid/mdhtml";
+ license = licenses.mit;
+ changelog = "https://codeberg.org/Tomkoid/mdhtml/releases";
+ maintainers = with maintainers; [ tomkoid ];
+ mainProgram = "mdhtml";
+ };
+}
diff --git a/pkgs/tools/text/nerdfix/default.nix b/pkgs/tools/text/nerdfix/default.nix
index 91a34796518d..8bb9113f013a 100644
--- a/pkgs/tools/text/nerdfix/default.nix
+++ b/pkgs/tools/text/nerdfix/default.nix
@@ -5,16 +5,16 @@
rustPlatform.buildRustPackage rec {
pname = "nerdfix";
- version = "0.3.1";
+ version = "0.4.0";
src = fetchFromGitHub {
owner = "loichyan";
repo = "nerdfix";
rev = "v${version}";
- hash = "sha256-cqTaup/MrtLcBIoY+1vQLLlU+Cmu3iODH4jmZImjGrg=";
+ hash = "sha256-V9f39/9k9kYjngYOSXJYblaKDABPCZbVWxD0p3ZWzlY=";
};
- cargoHash = "sha256-V/M70ARqOyN0f/uudWPHc4bGc3WXK3PpcM8r2MBEWAs=";
+ cargoHash = "sha256-PkUQZPLzvVJ7s1D9TkMmgIVQiR/E79BRCYmjZVcHIv8=";
meta = with lib; {
description = "Nerdfix helps you to find/fix obsolete nerd font icons in your project";
diff --git a/pkgs/top-level/aliases.nix b/pkgs/top-level/aliases.nix
index 4e52ec42d82e..c1d23ad8fba7 100644
--- a/pkgs/top-level/aliases.nix
+++ b/pkgs/top-level/aliases.nix
@@ -972,6 +972,7 @@ mapAliases ({
### Z ###
zinc = zincsearch; # Added 2023-05-28
+ zkg = throw "'zkg' has been replaced by 'zeek'";
zq = zed.overrideAttrs (old: { meta = old.meta // { mainProgram = "zq"; }; }); # Added 2023-02-06
### UNSORTED ###
diff --git a/pkgs/top-level/all-packages.nix b/pkgs/top-level/all-packages.nix
index d960113b2458..cc57816e46b3 100644
--- a/pkgs/top-level/all-packages.nix
+++ b/pkgs/top-level/all-packages.nix
@@ -3267,10 +3267,6 @@ with pkgs;
apitrace = libsForQt5.callPackage ../applications/graphics/apitrace { };
- argagg = callPackage ../development/libraries/argagg { };
-
- argtable = callPackage ../development/libraries/argtable { };
-
arguments = callPackage ../development/libraries/arguments { };
argus = callPackage ../tools/networking/argus { };
@@ -6977,6 +6973,8 @@ with pkgs;
evdevremapkeys = callPackage ../tools/inputmethods/evdevremapkeys { };
+ evsieve = callPackage ../tools/inputmethods/evsieve { };
+
eyedropper = callPackage ../applications/graphics/eyedropper { };
persistent-evdev = python3Packages.callPackage ../servers/persistent-evdev { };
@@ -10261,6 +10259,10 @@ with pkgs;
inherit (darwin.apple_sdk.frameworks) CoreFoundation IOKit;
protobuf = protobuf3_21;
};
+ netdataCloud = netdata.override {
+ withCloud = !stdenv.isDarwin;
+ withCloudUi = true;
+ };
# Exposed here so the bots can auto-upgrade it
netdata-go-plugins = callPackage ../tools/system/netdata/go.d.plugin.nix { };
@@ -12662,7 +12664,7 @@ with pkgs;
rewrk = callPackage ../tools/networking/rewrk { };
- inherit (callPackage ../tools/security/rekor { })
+ inherit (callPackage ../tools/security/rekor { buildGoModule = buildGo121Module; })
rekor-cli
rekor-server;
@@ -13830,6 +13832,7 @@ with pkgs;
tewisay = callPackage ../tools/misc/tewisay { };
texmacs = libsForQt5.callPackage ../applications/editors/texmacs {
+ stdenv = if stdenv.isDarwin then darwin.apple_sdk_11_0.stdenv else stdenv;
tex = texlive.combined.scheme-small;
extraFonts = true;
};
@@ -17699,9 +17702,7 @@ with pkgs;
groovy = callPackage ../development/interpreters/groovy { };
- inherit (callPackages ../applications/networking/cluster/hadoop {
- openssl = openssl_1_1;
- })
+ inherit (callPackages ../applications/networking/cluster/hadoop {})
hadoop_3_3
hadoop_3_2
hadoop2;
@@ -24747,6 +24748,8 @@ with pkgs;
readline82 = callPackage ../development/libraries/readline/8.2.nix { };
+ readmdict = with python3Packages; toPythonApplication readmdict;
+
readosm = callPackage ../development/libraries/readosm { };
recastnavigation = callPackage ../development/libraries/recastnavigation { };
@@ -29759,7 +29762,9 @@ with pkgs;
nuclear = callPackage ../applications/audio/nuclear { };
- nuclei = callPackage ../tools/security/nuclei { };
+ nuclei = callPackage ../tools/security/nuclei {
+ buildGoModule = buildGo121Module;
+ };
nullmailer = callPackage ../servers/mail/nullmailer {
stdenv = gccStdenv;
@@ -34462,7 +34467,7 @@ with pkgs;
wrapOBS = callPackage ../applications/video/obs-studio/wrapper.nix { };
obsidian = callPackage ../applications/misc/obsidian {
- electron = electron_24;
+ electron = electron_25;
};
octoprint = callPackage ../applications/misc/octoprint { };
@@ -35379,8 +35384,6 @@ with pkgs;
tart = callPackage ../applications/virtualization/tart { };
- tecoc = callPackage ../applications/editors/tecoc { };
-
viber = callPackage ../applications/networking/instant-messengers/viber { };
wavebox = libsForQt5.callPackage ../applications/networking/instant-messengers/wavebox { };
@@ -41496,8 +41499,6 @@ with pkgs;
xbps = callPackage ../tools/package-management/xbps { };
- zkg = callPackage ../tools/package-management/zkg { };
-
xcftools = callPackage ../tools/graphics/xcftools { };
xhyve = callPackage ../applications/virtualization/xhyve {
@@ -42127,4 +42128,6 @@ with pkgs;
};
code-maat = callPackage ../development/tools/code-maat {};
+
+ mdhtml = callPackage ../tools/text/mdhtml { };
}
diff --git a/pkgs/top-level/perl-packages.nix b/pkgs/top-level/perl-packages.nix
index 425ece6b7bee..ea65b3a70268 100644
--- a/pkgs/top-level/perl-packages.nix
+++ b/pkgs/top-level/perl-packages.nix
@@ -4954,7 +4954,12 @@ with self; {
url = "mirror://cpan/authors/id/B/BA/BARTB/Crypt-HSXKPasswd-v3.6.tar.gz";
hash = "sha256-lZ3MX58BG/ALha0i31ZrerK/XqHTYrDeD7WuKfvEWLM=";
};
- buildInputs = [ Clone DateTime FileHomeDir FileShare FileShareDir GetoptLong JSON ListMoreUtils MathRound Readonly TextUnidecode TypeTiny ];
+ nativeBuildInputs = lib.optional stdenv.isDarwin shortenPerlShebang;
+ propagatedBuildInputs = [ Clone DateTime FileHomeDir FileShare FileShareDir GetoptLong JSON ListMoreUtils MathRound Readonly TextUnidecode TypeTiny ];
+ postInstall = lib.optionalString stdenv.isDarwin ''
+ shortenPerlShebang $out/bin/hsxkpasswd
+ '';
+
meta = {
description = "A secure memorable password generator";
homepage = "http://www.bartb.ie/hsxkpasswd";
diff --git a/pkgs/top-level/python-aliases.nix b/pkgs/top-level/python-aliases.nix
index 66be4900a11b..164475b96eb8 100644
--- a/pkgs/top-level/python-aliases.nix
+++ b/pkgs/top-level/python-aliases.nix
@@ -290,6 +290,7 @@ mapAliases ({
pymc3 = pymc; # added 2022-06-05, module was rename starting with 4.0.0
pymssql = throw "pymssql has been abandoned upstream."; # added 2020-05-04
PyMVGLive = pymvglive; # added 2023-02-19
+ pymyq = python-myq; # added 2023-10-20
pyqt4 = throw "pyqt4 has been removed, because it depended on the long EOL qt4"; # added 2022-06-09
pyramid_beaker = pyramid-beaker; # added 2023-08-23
pyramid_chameleon = pyramid-chameleon; # added 2023-08-23
@@ -353,6 +354,7 @@ mapAliases ({
Quandl = quandl; # added 2023-02-19
qiskit-aqua = throw "qiskit-aqua has been removed due to deprecation, with its functionality moved to different qiskit packages";
rabbitpy = throw "rabbitpy has been removed, since it is unmaintained and broken"; # added 2023-07-01
+ ratelimiter = throw "ratelimiter has been removed, since it is unmaintained and broken"; # added 2023-10-21
rdflib-jsonld = throw "rdflib-jsonld is not compatible with rdflib 6"; # added 2021-11-05
recaptcha_client = throw "recaptcha_client has been removed since it is no longer maintained"; # added 2023-10-20
rednose = throw "rednose is no longer maintained (since February 2018)"; # added 2023-08-06
diff --git a/pkgs/top-level/python-packages.nix b/pkgs/top-level/python-packages.nix
index 2ae3133dc39c..57c9a0eb33df 100644
--- a/pkgs/top-level/python-packages.nix
+++ b/pkgs/top-level/python-packages.nix
@@ -198,6 +198,8 @@ self: super: with self; {
aioecowitt = callPackage ../development/python-modules/aioecowitt { };
+ aioelectricitymaps = callPackage ../development/python-modules/aioelectricitymaps { };
+
aioemonitor = callPackage ../development/python-modules/aioemonitor { };
aioesphomeapi = callPackage ../development/python-modules/aioesphomeapi { };
@@ -1775,6 +1777,8 @@ self: super: with self; {
canopen = callPackage ../development/python-modules/canopen { };
+ cantools = callPackage ../development/python-modules/cantools { };
+
camelot = callPackage ../development/python-modules/camelot { };
capstone = callPackage ../development/python-modules/capstone {
@@ -10452,7 +10456,7 @@ self: super: with self; {
pymvglive = callPackage ../development/python-modules/pymvglive { };
- pymyq = callPackage ../development/python-modules/pymyq { };
+ python-myq = callPackage ../development/python-modules/python-myq { };
pymysensors = callPackage ../development/python-modules/pymysensors { };
@@ -11991,8 +11995,6 @@ self: super: with self; {
ratelimit = callPackage ../development/python-modules/ratelimit { };
- ratelimiter = callPackage ../development/python-modules/ratelimiter { };
-
rauth = callPackage ../development/python-modules/rauth { };
raven = callPackage ../development/python-modules/raven { };
@@ -12026,6 +12028,8 @@ self: super: with self; {
readlike = callPackage ../development/python-modules/readlike { };
+ readmdict = callPackage ../development/python-modules/readmdict { };
+
readme = callPackage ../development/python-modules/readme { };
readme_renderer = callPackage ../development/python-modules/readme_renderer { };
@@ -13722,6 +13726,8 @@ self: super: with self; {
textile = callPackage ../development/python-modules/textile { };
+ textparser = callPackage ../development/python-modules/textparser { };
+
textual = callPackage ../development/python-modules/textual { };
textual-universal-directorytree = callPackage ../development/python-modules/textual-universal-directorytree { };